CATALOG 2020

CATALOG 2020 PRIMARY CUSTOM MANUFACTURER EXPERIENCE 40years + 5 Mfg Sites GLOBAL © 2019 Promega Corporation. All Rights Reserved. Don’t settle for just a supplier. Find a custom manufacturing partner. Your specifications. Your format. Our scientists waiting to help. Selecting a supplier for your biotechnology and biopharma products can be a challenge—especially one who can adapt to your specific needs. Don’t settle for just a supplier. Instead, partner with Promega and work with a custom manufacturer willing to provide you with the scientific expertise, ongoing technical support and quality standards that support your success. Learn more with our video: promega.com/CustomProcess Table of Contents Table of Contents Promega 2020 Life Science Catalog APPLIED SCIENCES Food, Plant, Water and Cosmetic Testing 1 CELL BIOLOGY Cell Health 7 Cell Line and Sample Identification 33 Cell Signaling 37 Energy Metabolism 55 Imaging and Immunological Detection 63 Luciferase Assays 73 NUCLEIC ACID ANALYSIS Cloning and DNA Markers 97 Nucleic Acid Extraction 133 Nucleic Acid Quantitation and Analysis 159 Epigenetics Research Kits and Reagents 173 PCR 183 Sequencing 199 Vectors 211 DRUG DEVELOPMENT Bioassays for Biologics 231 Drug Discovery 247 HUMAN IDENTIFICATION Genetic Identity 251 LAB EQUIPMENT AND SUPPLIES Biochemicals and Labware 267 Lab Automation 287 Plate Readers, Fluorometers and Luminometers 295 MOLECULAR DIAGNOSTICS Clinical Laboratory Products 301 PROTEIN ANALYSIS Mass Spectrometry 319 Protein Expression 329 Protein Quantitation and Detection 339 Protein Interactions 353 Protein Purification 363 I N D E X A N D LEGAL REFERENCE 371 CATALOG 2020 ABOUT THE COVER The cover image Illustrates the power and simplicity of bioluminescence for monitoring biological events in real time. This artist’s rendition shows the luminescent signal generated upon annexin V binding to phosphatidylserine on the cell surface during early apoptosis. This is the basis of the Promega RealTime-Glo™ Annexin V Apoptosis Assay. For complete and up-to-date product and related information visit: www.promega.com Ask A Scientist Our worldwide technical support scientists have extensive lab experience and are available to answer all your questions about Promega products. Contact us via chat, telephone or email: techserv@promega.com Visit us online at: www.promega.com/Support Promega offers best-in-class technical support for scientists. Services Include: • Troubleshooting experiments • Training on Promega technologies • Supporting Promega technologies on automated systems © 2020 Promega Corporation. All Rights Reserved. 1 1 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Food, Plant, Water and Cosmetic Testing Food, Plant, Water and Cosmetic Testing Food Testing 2 Plant Testing 3 Water Testing 4 Cosmetic Testing 6 Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 2 For complete and up-to-date product information visit: www.promega.com Food Testing Maxwell® RSC PureFood Pathogen Kit Product Size Cat.# Maxwell® RSC PureFood Pathogen Kit 48 preps AS1660 Not For Medical Diagnostic Use. Description: If you need to make quick decisions about potential food spoilage and contamination, the Maxwell® RSC PureFood Pathogen Kit offers a simple extraction protocol to obtain high-quality bacterial DNA from a variety of food sample types. The kit works with inhibiting sample types, and can lyse both Gram+ or Gram– bacteria, eliminating laborious sample preparation steps like enzymatic pretreatment. The extracted DNA is ready for advanced downstream molecular analyses including NGS, serotyping, and identification of spoilage organisms. The high-performance Maxwell® chemistries coupled with the trusted benchtop Maxwell® RSC instrument allow you to purify bacterial DNA from food samples in as little as 40 minutes, giving you the ability to get answers more quickly. Features: • Isolate DNA from raw or processed food samples • Works well with inhibiting sample types • No need for labor-intensive sample processing Storage Conditions: Store at 15–30°C. Maxwell® RSC Plant DNA Kit Product Size Cat.# Maxwell® RSC Plant DNA Kit 48 preps AS1490 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® RSC Plant DNA Kit is used with the Maxwell® RSC Instrument (Cat.# AS4500) to provide an easy method for efficient, automated purification of genomic DNA (gDNA) from plant tissue samples. The Maxwell® RSC Instrument is supplied with preprogrammed purification methods and is designed for use with predispensed reagent cartridges, maximizing simplicity and convenience. The instrument can process up to 16 samples in 45 minutes, and the purified DNA can be used directly in a variety of downstream applications, including PCR and agarose gel electrophoresis. Features: • Extract Nucleic Acid from Corn, Soybean and Arabidopsis Tissue Samples: The kit provides amplifiable nucleic acids compatible with downstream amplifications such as qPCR with minimal contaminants and enzyme inhibitors. • Experience Consistent Performance: Less variability compared to traditional competing methods (CTAB and manual spin columns). • Achieve Walkaway Automation with Faster Results: Free up laboratory resources to focus on higher value activities. • Perform Minimal Protocol Steps and No Organic Extractions: Quickly purify up to 16 plant tissue samples in less than 60 minutes with minimal preprocessing. Storage Conditions: Store at 15–30°C. Maxwell® RSC PureFood GMO and Authentication Kit Product Size Cat.# Maxwell® RSC PureFood GMO and Authentication Kit 48 preps AS1600 Available Separately Size Cat.# CTAB Buffer 100 ml MC1411 Not for Medical Diagnostic Use. Description: The Maxwell® RSC PureFood GMO and Authentication Kit used with the Maxwell® RSC Instrument is designed to provide an easy and automated method for efficient purification of DNA used in PCR-based testing for Genetically Modified Organism (GMO) DNA sequences and PCR-based food and ingredient authentication. The Maxwell® RSC Instrument is supplied with preprogrammed purification methods and is designed for use with the predispensed reagent cartridges, maximizing simplicity and convenience. The instrument can purify DNA from 1 to 16 raw and processed food samples including corn, soybeans, canola, ground pork, ground beef, pork gelatin, breaded fish, tortillas, corn chips and rice cakes in approximately 40 minutes. Features: • Use an Optimized System: Extract nucleic acid from a variety of food samples. • Rely on Consistent Performance: Experience less variability compared to traditional competing methods. • Take Advantage of Walkaway Automation: Achieve faster results. Free up laboratory resources to focus on higher value activities. • Work with an Easy-to-Use Kit: Perform minimal protocol steps and no organic extractions. Quickly purify up to 16 food samples in less than 60 minutes with minimal preprocessing. Storage Conditions: Store at 15–30°C. Wizard® Magnetic DNA Purification System for Food Product Size Cat.# Wizard® Magnetic DNA Purification System for Food 200 preps FF3750 400 preps FF3751 Available Separately Lysis Buffer A, Food 100 ml A8191 Lysis Buffer B, Food 100 ml Z3191 Precipitation Solution, Food 150 ml Z3201 FF3750, FF3751 For in vitro use only. A8191, Z3191, Z3201 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® Magnetic DNA Purification System for Food is designed for purification of DNA from a variety of food samples, including corn seeds, cornmeal, soybeans, soy flour and soy milk. Processed food, such as corn chips, chocolate and chocolate-containing foods, lecithin and vegetable oils may also be used with the suggested protocol variations. The DNA purified from these samples can be used in PCR-based testing for genetically modified organism (GMO) DNA sequences. Features: • Improved Productivity: Obtain results in one-third the time of current methods. • Ease of Handling: Requires minimal centrifugation and eliminates organic extractions. • Versatility and Robustness: Validated with a broad variety of foodstuffs, including difficult samples such as lecithin and vegetable oils. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 3 1Food, Plant, Water and Cosmetic Testing For complete and up-to-date product information visit: www.promega.com Plant Testing Maxwell® RSC Plant DNA Kit Product Size Cat.# Maxwell® RSC Plant DNA Kit 48 preps AS1490 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® RSC Plant DNA Kit is used with the Maxwell® RSC Instrument (Cat.# AS4500) to provide an easy method for efficient, automated purification of genomic DNA (gDNA) from plant tissue samples. The Maxwell® RSC Instrument is supplied with preprogrammed purification methods and is designed for use with predispensed reagent cartridges, maximizing simplicity and convenience. The instrument can process up to 16 samples in 45 minutes, and the purified DNA can be used directly in a variety of downstream applications, including PCR and agarose gel electrophoresis. Features: • Extract Nucleic Acid from Corn, Soybean and Arabidopsis Tissue Samples: The kit provides amplifiable nucleic acids compatible with downstream amplifications such as qPCR with minimal contaminants and enzyme inhibitors. • Experience Consistent Performance: Less variability compared to traditional competing methods (CTAB and manual spin columns). • Achieve Walkaway Automation with Faster Results: Free up laboratory resources to focus on higher value activities. • Perform Minimal Protocol Steps and No Organic Extractions: Quickly purify up to 16 plant tissue samples in less than 60 minutes with minimal preprocessing. Storage Conditions: Store at 15–30°C. Maxwell® RSC PureFood GMO and Authentication Kit Product Size Cat.# Maxwell® RSC PureFood GMO and Authentication Kit 48 preps AS1600 Available Separately Size Cat.# CTAB Buffer 100 ml MC1411 Not for Medical Diagnostic Use. Description: The Maxwell® RSC PureFood GMO and Authentication Kit used with the Maxwell® RSC Instrument is designed to provide an easy and automated method for efficient purification of DNA used in PCR-based testing for Genetically Modified Organism (GMO) DNA sequences and PCR-based food and ingredient authentication. The Maxwell® RSC Instrument is supplied with preprogrammed purification methods and is designed for use with the predispensed reagent cartridges, maximizing simplicity and convenience. The instrument can purify DNA from 1 to 16 raw and processed food samples including corn, soybeans, canola, ground pork, ground beef, pork gelatin, breaded fish, tortillas, corn chips and rice cakes in approximately 40 minutes. Features: • Use an Optimized System: Extract nucleic acid from a variety of food samples. • Rely on Consistent Performance: Experience less variability compared to traditional competing methods. • Take Advantage of Walkaway Automation: Achieve faster results. Free up laboratory resources to focus on higher value activities. • Work with an Easy-to-Use Kit: Perform minimal protocol steps and no organic extractions. Quickly purify up to 16 food samples in less than 60 minutes with minimal preprocessing. Storage Conditions: Store at 15–30°C. Maxwell® RSC Plant RNA Kit Product Size Cat.# Maxwell® RSC Plant RNA Kit 48 preps AS1500 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® RSC Plant RNA Kit is used with the Maxwell® RSC Instruments to provide an easy method for efficient, automated purification of RNA from plant tissue samples. The kit provides the reagents required for processing 48 samples and uses prefilled cartridges for purification, maximizing simplicity and convenience. The Maxwell® RSC Instrument can process from 1 to 16 samples and the Maxwell® RSC 48 can process 1 to 48 samples in under an hour. The purified RNA can be used directly in a variety of downstream applications including RT-qPCR, gel electrophoresis, microarrays and Next Gen sequencing. Features: • Extracts amplifiable nucleic acids with minimal contaminants and enzyme inhibitors. • Provides consistent extraction; less variability compared to traditional methods (CTAB and manual spin columns). • Purifies up to 48 plant tissue samples in less than 60 minutes with minimal preprocessing and no organic reagents. Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 4 For complete and up-to-date product information visit: www.promega.com Maxwell® 16 LEV Plant DNA Kit Product Size Cat.# Maxwell® 16 LEV Plant DNA Kit 48 preps AS1420 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® 16 LEV Plant DNA Kit is used with the Maxwell® 16 Instrument to provide an easy method for efficient, automated purification of genomic DNA (gDNA) from plant tissue samples. The Maxwell® 16 Instrument is supplied with preprogrammed purification methods and is designed for use with predispensed reagent cartridges, maximizing simplicity and convenience. The instrument can process up to 16 samples in 45 minutes, and the purified DNA can be used directly in a variety of downstream applications, including PCR and agarose gel electrophoresis. Features: • Optimized System: Extract nucleic acid from corn, soybean and Arabidopsis tissue samples. The kit provides amplifiable nucleic acids compatible with downstream amplifications such as qPCR with minimal contaminants and enzyme inhibitors. • Consistent Performance: Experience less variability compared to traditional competing methods (CTAB and manual spin columns). • Walkaway Automation: Achieve faster results. Free up laboratory resources to focus on higher value activities. • Easy to Use Kit: Perform minimal protocol steps and no organic extractions. Quickly purify up to 16 plant tissue samples in less than 60 minutes with minimal preprocessing. Storage Conditions: Store at 15–30°C. Maxwell® 16 LEV Plant RNA Kit Product Size Cat.# Maxwell® 16 LEV Plant RNA Kit 48 preps AS1430 AS1430 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® 16 LEV Plant RNA Kit is used with the Maxwell® 16 Research Instrument (Cat.# AS2000) to provide an easy method for efficient, automated purification of RNA from plant tissue samples. The Maxwell® 16 Instrument is supplied with preprogrammed purification methods and is designed for use with the predispensed reagent cartridges supplied in the Maxwell® 16 LEV Plant RNA Kit. The instrument can process from 1 to 16 samples in under an hour, and the purified RNA can be used directly in downstream applications including real-time RT-qPCR, gel electrophoresis, microarrays and sequencing (e.g., NGS and Sanger). Features: • Consistent processing and higher yields; less re-isolation of samples, reducing costs and increasing reliability of results. • No organic extraction and minimal preprocessing required. Storage Conditions: Store at 15–30°C. Water Testing Water-Glo™ Microbial Water Testing Kit Product Size Cat.# Water-Glo™ Complete Aqueous 1 each AM1001 Water-Glo™ Reagents Aqueous 1 each AM1002 Water-Glo™ 96 Reagents Aqueous 1 each AM1003 Water-Glo™ Reagents Organic 1 each AM1004 Water-Glo™ 96 Reagents Organic 1 each AM1005 Available Separately Size Cat.# Water-Glo™ Organic Wash Solution 50ml AM1041 Not for Medical Diagnostic Use. Description: Bacteria present in water samples cause issues such as biofilm formation (membrane fouling) and microbially induced or influenced corrosion (MIC). Traditional testing methods such as heterotrophic plate count (HPC) requires days of culturing bacteria. By the time you find out there’s contamination, it’s already too late. The Water-Glo™ System is based on ATP bioluminescence technology, allowing consistent low-level detection of all live microbes in minutes instead of days. It’s the ideal early warning system to protect your process. Features: • Get results in minutes • Measure up to 96 samples at once • Detect all live microbes in freshwater, seawater or wastewater Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 5 1Food, Plant, Water and Cosmetic Testing For complete and up-to-date product information visit: www.promega.com BacTiter-Glo™ Microbial Cell Viability Assay Product Size Cat.# BacTiter-Glo™ Microbial Cell Viability Assay 10 ml G8230 10 × 10 ml G8231 100 ml G8232 10 × 100 ml G8233 Available Separately Size Cat.# rATP, 10mM 0.5 ml P1132 G8230, G8231, G8232, G8233 For Research Use Only. Not for Use in Diagnostic Procedures. P1132 For Laboratory Use. Description: The BacTiter-Glo™ Microbial Cell Viability Assay provides a method for determining the number of viable microbial cells in culture based on quantitation of the ATP present. ATP is an indicator of metabolically active cells. The homogeneous assay procedure involves adding a single reagent (BacTiter-Glo™ Reagent) directly to bacterial cells cultured in medium and measuring luminescence. This assay format reduces pipetting errors that may be introduced during the multiple steps required by other methods of ATP measurement. The formulation of the reagent supports bacterial cell lysis and generation of a luminescent signal in an “add-mix-measure” format. The luminescent signal is proportional to the amount of ATP present, which is directly proportional to the number of viable cells in culture. The assay relies on the properties of a proprietary thermostable luciferase (Ultra-Glo™ Recombinant Luciferase) and a proprietary buffer formulation for extracting ATP from bacteria. The assay has been shown to detect a variety of bacteria and fungi. Features: • Simplify Microbial Detection: The “add-mix-measure” format reduces the number of handling steps to fewer than that required for similar ATP assays, with no separate lysis step, and no injectors required, allowing easy automation. • Get Results Quickly: Data can be recorded in 5 minutes or less after adding reagent and mixing. Superior sensitivity allows you to detect growth or toxicity quickly after inoculation. • Increase Your Sensitivity: Measure ATP from as few as 10 bacterial cells, 1,000-fold more sensitive than absorbance (O.D.) readings. • Choose Your Format: Can be used with various multiwell-plate or single-use formats. Data can be recorded by luminometer or CCD camera. • Process Plates Consecutively: The “glow-type” luminescent signal is stable, with a half-life generally over 30 minutes. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: For long-term storage, the lyophilized BacTiter-Glo™ Substrate and BacTiter-Glo™ Buffer should be stored at –20°C. ENLITEN® ATP Assay System Product Size Cat.# ENLITEN® ATP Assay System 100 assays FF2000 For in vitro use only. Description: The ENLITEN® ATP Assay System can be used to measure ATP levels for the indirect detection of biocontamination on food processing surfaces, in cosmetics and beverages or to assay for enzymes that degrade ATP and to quantitate ATP in biological fluids. Features: • Less Variation: Stable light output. • User Friendly: Easy-to-prepare reagents. • Performance: Fast and convenient assay method. • Sensitive: Detects as little as 10–15 moles of ATP. Storage Conditions: Store at –20°C unopened. See product insert for individual component storage conditions before and after opening. ENLITEN® rLuciferase/Luciferin Reagent Product Size Cat.# ENLITEN® rLuciferase/Luciferin Reagent 100 assays FF2021 For in vitro use only. Description: The ENLITEN® rLuciferase/Luciferin Reagent is intended for the rapid and quantitative detection of ATP in liquid samples. The reagent is designed to measure 10–11 to 10–15 moles of ATP. Some of the applications may include the indirect measurement of bacteria, yeasts and fungi on surfaces or in products, assaying enzymes that degrade ATP or quantitation of ATP in biological fluids. Features: • Less Variation: Stable light output. • User Friendly: Easy-to-prepare reagents. • Performance: Fast and convenient assay method. • Sensitive: Detects as little as 10–15 moles of ATP. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Future-proof your lab and learn more about cell-based alternatives to animal testing: www.promega.com/CosmeticTesting Cosmetic testing using cells will soon replace animal testing. Is your lab ready? 7 2 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Cell Health Cell Health ADME Assays 8 Apoptosis Assays 13 Autophagy Detection 18 Cell Viability Assays 19 Cytotoxicity Assays 25 Inflammation Assay 29 Oxidative Stress Assays 29 Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 8 For complete and up-to-date product information visit: www.promega.com ADME Assays CYP450 Assay Systems Product Size Cat.# P450-Glo™ CYP2B6 Assay 10 ml V8321 50 ml V8322 P450-Glo™ CYP1A2 Induction/Inhibition Assay 10 ml V8421 50 ml V8422 P450-Glo™ CYP3A4 Assay with Luciferin-IPA 10 ml V9001 50 ml V9002 P450-Glo™ CYP3A4 Assay (Luciferin-PPXE) DMSO-Tolerant Assay 10 ml V8911 50 ml V8912 P450-Glo™ CYP3A4 Assay (Luciferin-PFBE) Cell-Based/Biochemical Assay 10 ml V8901 50 ml V8902 P450-Glo™ CYP1A1 Assay 10 ml V8751 50 ml V8752 P450-Glo™ CYP1B1 Assay 10 ml V8761 50 ml V8762 P450-Glo™ CYP1A2 Assay 10 ml V8771 50 ml V8772 P450-Glo™ CYP2C8 Assay 10 ml V8781 50 ml V8782 P450-Glo™ CYP2C9 Assay 10 ml V8791 50 ml V8792 P450-Glo™ CYP3A4 Assay 10 ml V8801 50 ml V8802 P450-Glo™ CYP3A7 Assay 10 ml V8811 50 ml V8812 P450-Glo™ CYP2C19 Assay 10 ml V8881 50 ml V8882 P450-Glo™ CYP2D6 Assay 10 ml V8891 50 ml V8892 Available Separately NADPH Regeneration System 1,000 assays V9510 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The P450-Glo™ CYP450 Assays provide a homogeneous, luminescent method for measuring cytochrome P450 activity. The assays are designed to measure the activities of P450s from recombinant and native sources and for testing the effects of analytes such as drugs and new chemical entities on P450 activities. These luminescent assays exhibit exquisite sensitivity, low background signals and broad dynamic range. P450-Glo™ Assays employ luminogenic P450 substrates that are derivatives of beetle luciferin, a substrate for luciferase enzymes. The derivatives are not substrates for luciferase but are converted by P450s to luciferin, which in turn reacts with luciferase to produce light that is directly proportional to the activity of the P450. The P450-Glo™ Assays generate a “glow-type” luminescent signal, produced using derivatized luciferins as P450 substrates and a recombinant stabilized luciferase (Ultra-Glo™ Luciferase) coupled with a proprietary buffer system. The half-life of the luminescent output is greater than two hours, eliminating the need for luminometers with injectors and allowing batch plate processing. The formulation also minimizes the incidence of false positives due to inhibition of luciferase by analytes when screening for cytochrome P450 inhibitors. Drug-induced changes in expression of CYP450 genes are a key cause of drug-drug interactions. The ability to measure enzymatic activity of the specific human isoforms that are induced is critical for developing safer drugs. Currently, the most important inducible human isoforms are CYP1A2, CYP2B6 and CYP3A4. The luciferin-based substrates are readily taken up by cells and rapidly converted into luciferin inside the cell, which reduces the incubation time required (typically 30–60 minutes). The low background and high signalto-noise ratios produced mean less starting material is required. Dimethyl sulfoxide (DMSO), a common solvent used to solubilize chemical compounds, can significantly inhibit the activity of the 3A4 isoform of cytochrome P450, even at low concentrations (<0.1%).The P450-Glo™ CYP3A4 System (Luciferin-PPXE) DMSO-Tolerant Assay is specifically designed to tolerate DMSO in the 3A4 reaction. The assay exhibits little to no change in the signal-to-background ratio in the presence of 0.2% DMSO compared to a no-DMSO control. Features: • Obtain Reliable Results: The broad dynamic range, low background and better sensitivity result in less ambiguous data. • Avoid Fluorescence Interference: Luminescent output eliminates interference from fluorescent test compounds. • Save Time: Homogeneous assay with simple “add-and-read” format. • Avoid False Hits: Special formulation results in low false-hit rate. • Save Money: Scalable to 384-well format, reducing cost per well. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store the CYP1A2, CYP2C9 and CYP3A4 membranes at –70°C. Cytochrome P450 may lose activity with repeated freeze-thaw cycles. Avoid multiple freeze-thaw cycles by dispensing the CYP1A2, CYP2C9 and CYP3A4 membranes into single-use aliquots (e.g., 50μl for 96 reactions). Store aliquots at –70°C. All other components can be stored at –20°C or –70°C and protected from light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 9 2Cell Health For complete and up-to-date product information visit: www.promega.com P450-Glo™ CYP450 Screening Systems Product Size Cat.# P450-Glo™ CYP3A4 Screening System with Luciferin-IPA 1,000 assays V9920 P450-Glo™ CYP2B6 Screening System 1,000 assays V9781 P450-Glo™ CYP3A4 Screening System (Luciferin-PPXE) DMSO-Tolerant Assay 1,000 assays V9910 P450-Glo™ CYP1A2 Screening System 1,000 assays V9770 P450-Glo™ CYP2C9 Screening System 1,000 assays V9790 P450-Glo™ CYP3A4 Screening System 1,000 assays V9800 P450-Glo™ CYP2C19 Screening System 1,000 assays V9880 P450-Glo™ CYP2D6 Screening System 1,000 assays V9890 Available Separately NADPH Regeneration System 1,000 assays V9510 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The P450-Glo™ Screening Systems provide a complete set of reagents for performing luminescent cytochrome P450 assays. The systems include a membrane preparation containing recombinant human cytochrome P450 enzyme, a luminogenic cytochrome P450 substrate appropriate for the enzyme, an NADPH Regeneration System, reaction buffer, Luciferin Detection Reagent and Luciferin-Free Water. The membranes are prepared from baculovirus-infected insect cells and contain human cytochrome P450 and P450 reductase (and cytochrome b5 for CYP2C9 and CYP3A4). The P450-Glo™ Screening Systems also contain a membrane fraction devoid of cytochrome P450 activity as a negative control. The assays are ideal for testing the effects of drugs and new chemical entities on cytochrome P450 enzyme activities. The cytochrome P450 reaction is performed by incubating a luminogenic cytochrome P450 substrate with a cytochrome P450 enzyme and the NADPH Regeneration System. The luminogenic P450-Glo™ Substrates are derivatives of beetle luciferin ((4S)-4,5-dihydro-2-(6-hydroxybenzothiazolyl)- 4-thiazolecarboxylic acid or d-luciferin), a substrate of firefly luciferase. The P450-Glo™ Substrates do not react with luciferase but are converted by cytochrome P450 to luciferin, which in turn reacts with luciferase to produce light. Light is used to monitor cytochrome P450 activity because the amount of light produced is directly proportional to the amount of d-luciferin produced by cytochrome P450. Dimethyl sulfoxide (DMSO), a common solvent used to solubilize chemical compounds, can significantly inhibit the activity of the 3A4 isoform of cytochrome P450, even at low concentrations (<0.1%). The P450-Glo™ CYP3A4 Screening System (Luciferin-PPXE) DMSO-Tolerant Assay is specifically designed to tolerate DMSO in the 3A4 reaction. The assay exhibits little to no change in the signal-to-background ratio in the presence of 0.2% DMSO compared to a no-DMSO control. After the cytochrome P450 reaction has been performed, the reconstituted Luciferin Detection Reagent is added. This reagent simultaneously stops the cytochrome P450 reaction and initiates a stable glow-type luminescent signal. The glow-type reaction produces a stable signal and eliminates the need for strictly timed luminescence detection. Protocols are configured for multiwell plate formats but can be easily adapted for single-tube applications. Features: • Complete Systems: The systems include a membrane preparation containing recombinant human cytochrome P450 enzyme, a luminogenic cytochrome P450 substrate appropriate for the enzyme, an NADPH regeneration system, reaction buffer, Luciferin Detection Reagent and Luciferin-Free Water. • Speed: The luminescent format eliminates the need for time-consuming analyses such as HPLC. • Robust: Z´ values greater than 0.8 in either 96- or 384-well plate formats. Highly predictive results. • Luminescent Output: No interference by fluorescent compounds. • Broad Dynamic Range and Low Background: Excellent sensitivity. • Low False-Positive Rate: Use of a proprietary stabilized firefly luciferase and a proprietary luciferase assay formulation minimizes the incidence of false positives due to inhibition of luciferase by analytes when screening for cytochrome P450 inhibitors. • Scalable: Easily scalable to 384-well plate format. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ Storage Conditions: Store the CYP1A2, CYP2C9 and CYP3A4 membranes at –70°C. Cytochrome P450 may lose activity with repeated freeze-thaw cycles. Avoid multiple freeze-thaw cycles by dispensing the CYP1A2, CYP2C9 and CYP3A4 membranes into single-use aliquots (e.g., 50μl for 96 reactions). Store aliquots at –70°C. All other components can be stored at –20°C or –70°C and protected from light. The reconstituted Luciferin Detection Reagent can be stored at –20°C for up to 3 months. For convenience, the reconstituted Luciferin Detection Reagent can be stored at room temperature (approximately 23°C) without loss of activity for 24 hours or at 4°C for 1 week. Avoid multiple freeze-thaw cycles of all components. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 10 For complete and up-to-date product information visit: www.promega.com Luciferin Detection Reagent Product Size Cat.# Luciferin Detection Reagent 50 ml V8921 10 ml V8920 Luciferin Detection Reagent with esterase 50 ml V8931 10 ml V8930 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferin Detection Reagent (LDR) is used to detect luciferin formed following enzymatic modification of pro-luciferin substrates. Enzymes such as CYP450s convert specific pro-luciferin substrates into luciferin, which is then converted into light following the addition of LDR through the action of Ultra-Glo™ Luciferase. The LDR reagent simultaneously stops the initial enzymatic reaction and initiates a stable glow-type luminescent signal with a half-life >2 hours. Pgp-Glo™ Assay Systems Product Size Cat.# Pgp-Glo™ Assay System 10 ml V3591 Pgp-Glo™ Assay System with P-glycoprotein 10 ml V3601 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Pgp-Glo™ Assay Systems provide the necessary reagents for performing luminescent P-glycoprotein (Pgp) ATPase assays. Pgp, also known as MDR1 and ABCB1, is a 170kDa integral plasma membrane protein that functions as an ATP-dependent drug efflux pump and plays an important role in multidrug resistance and certain adverse drug-drug interactions. Compounds that interact with Pgp can be identified as stimulators or inhibitors of its ATPase activity. Compounds that are substrates for transport by Pgp typically stimulate its ATPase activity. The Pgp-Glo™ Assay detects the effects of compounds on recombinant human Pgp in a cell membrane fraction. The assay relies on the ATP dependence of the light-generating reaction of firefly luciferase. ATP is first incubated with Pgp; then the Pgp ATPase reaction is stopped, and the remaining unmetabolized ATP is detected as a luciferase-generated luminescent signal. Pgp-dependent decreases in luminescence reflect ATP consumption by Pgp; thus the greater the decrease in signal, the higher the Pgp activity. Accordingly, samples containing compounds that stimulate the Pgp ATPase will have significantly lower signals than untreated samples. Features: • Complete System: Cat.# V3591 includes all the reagents required to run the assay except the P-glycoprotein: A Pgp reaction buffer, MgATP, Verapamil, Na3 VO4 , and a lyophilized ATP detection reagent and its reconstitution buffer. Cat.# V3601 includes all the reagents provided in the Pgp-Glo™ System with the addition of Recombinant Human Pgp Membranes to provide a completely optimized kit. • Stable Activities: “Glow-type” signal allows processing of multiple samples without concern of variability over time. • Low False-Positive Rate: Use of a proprietary stabilized firefly luciferase and a proprietary luciferase assay formulation minimizes the incidence of false positives due to inhibition of luciferase by analytes when screening for compounds that affect Pgp activity. • Simple: The simple protocol makes the assay amenable to highthroughput screening in multiwell plates. Storage Conditions: Store Recombinant Human Pgp Membranes at –70°C. All other components can be stored at –70°C or –20°C, protected from light. MAO-Glo™ Assay Systems Product Size Cat.# MAO-Glo™ Assay 200 assays V1401 1,000 assays V1402 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MAO-Glo™ Assay provides a homogeneous luminescent method for measuring monoamine oxidase (MAO) activity from recombinant and native sources and for testing the effects of test compounds on MAO activity. The MAO-Glo™ Assay is performed by incubating the MAO enzyme source with a luminogenic MAO substrate. The substrate of the MAO-Glo™ Assay is a derivative of beetle luciferin. Upon reaction with MAO, the derivative is converted into luciferin, which in turn reacts with luciferase to produce light. The amount of light produced is directly proportional to the activity of MAO. After the MAO reaction has been performed, the reconstituted Luciferin Detection Reagent is added. The reagent simultaneously stops the MAO reaction and initiates a stable glow-type luminescent signal with a half-life greater than 5 hours. This eliminates the need for strictly timed luminescent detection. The MAO-Glo™ Assay includes a luminogenic MAO substrate, two MAO Reaction Buffers (one that can be used with either MAO A or MAO B enzyme and one that is designed specifically for MAO B), a lyophilized Luciferin Detection Reagent and the Luciferin Detection Buffer. The user supplies the sample material containing MAO. Protocols are configured for multiwell plate formats but easily can be adapted for single-tube applications. Features: • Speed: The luminescence format eliminates the need for time-consuming analyses such as HPLC. • Simplified Method: The simple “add and read” protocol makes the assay amenable to high-throughput screening in multiwell plates. • Greater Sensitivity: Less MAO enzyme is required in these assays than in typical HPLC or fluorometric methods because of the enhanced sensitivity. • No Fluorescence Interference: Luminescent output eliminates interference from fluorescent test compounds. • Stable Signal: “Glow-type” luminescence provides a stable signal with a half-life of greater than 5 hours. This eliminates the need for strictly timed luminescent detection. Storage Conditions: Store at –20°C protected from light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 11 2Cell Health For complete and up-to-date product information visit: www.promega.com GloResponse™ Luciferase Reporter Cell Lines Product Size Cat.# GloResponse™ CRE-luc2P HEK293 Cell Line 2 vials E8500 GloResponse™ NFAT-RE-luc2P HEK293 Cell Line 2 vials E8510 GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line 2 vials E8520 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloResponse™ Luciferase Reporter Cell Lines contain optimized, state-of-the-art luciferase reporter technology integrated into a cell line. This allows the rapid development of a reporter assay based on the pathway of interest regulating the luciferase gene. Assays configured using the GloResponse™ Cell Lines are amenable for high-throughput screening. These assays typically have greater response dynamics (fold of induction) than other assay formats and good quality as indicated by the high Z´ values. GloResponse™ Cell Lines were developed to study a variety of signaling pathways. Activators of these pathways may be native to the HEK293 cell line. Activity of non-native activators can be studied after they have been introduced by transfection. GPCRs regulate a wide-range of biological functions and are one of the most important target classes for drug discovery. GPCR signaling pathways can be categorized into three classes based on the G protein α-subunit involved: Gs, Gi/o and Gq. The GloResponse™ CRE-luc2P HEK293 Cell Line can be used to study and configure screening assays for Gs- and Gi/o-coupled GPCRs, which signal through cAMP and the cAMP Response Element (CRE). For Gq-coupled GPCRs, which signal through calcium ion release and activate the Nuclear Factor of Activated T-Cells response element (NFAT-RE), the GloResponse™ NFAT-RE-luc2P HEK293 Cell Line should be used. NF-κB-REs are the DNA binding sequences for the NF-κB transcription factor complex, which is responsible for regulating inflammation, immune response, cell growth and apoptosis. The GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line is designed for rapid and convenient analysis of any cellular response that results in modulation of NF-κB activities. The GloResponse™ Cell Lines were generated by clonal selection of HEK293 cells stably transfected with pGL4-based vectors carrying specific response elements for the pathway of interest. These cell lines incorporate the improvements developed for the pGL4 family of reporter vectors for enhanced performance. The destabilized luc2P luciferase reporter is used for improved responsiveness to transcriptional dynamics. The luc2P gene is codon optimized for enhanced expression in mammalian cells, and the pGL4 plasmid backbone was engineered to reduce background reporter expression. The result is a cell line with very high induction levels when the pathway of interest is activated. Features: • Convenient: Prebuilt, optimized luciferase reporter cell lines. • Robust: Large assay window provided by high levels of induction and low background expression. • Faster Results: Improved responsiveness to transcriptional dynamics with destabilized luciferase. Storage Conditions: Place frozen cells in storage at less than or equal to –140°C (mechanical deep freeze or vapor phase liquid nitrogen) until you are ready to thaw and propagate them. We strongly recommend that the cells are propagated, using the provided procedure, as soon as possible. This will ensure the optimal cell viability and assay performance. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 12 For complete and up-to-date product information visit: www.promega.com Signaling Pathway Analysis (Minimal Promoter-Driven) Firefly Luciferase Vectors Product Size Cat.# pGL4.37[luc2P/ARE/Hygro] Vector 20 μg E3641 pGL4.38[luc2P/p53 RE/Hygro] Vector 20 μg E3651 pGL4.39[luc2P/ATF6 RE/Hygro] Vector 20 μg E3661 pGL4.40[luc2P/MRE/Hygro] Vector 20 μg E4131 pGL4.41[luc2P/HSE/Hygro] Vector 20 μg E3751 pGL4.42[luc2P/HRE/Hygro] Vector 20 μg E4001 pGL4.43[luc2P/XRE/Hygro] Vector 20 μg E4121 pGL4.44[luc2P/AP1 RE/Hygro] Vector 20 μg E4111 pGL4.45[luc2P/ISRE/Hygro] Vector 20 μg E4141 pGL4.47[luc2P/SIE/Hygro] Vector 20 μg E4041 pGL4.48[luc2P/SBE/Hygro] Vector 20 μg E3671 pGL4.49[luc2P/TCF-LEF RE/Hygro] Vector 20 μg E4611 pGL4.52[luc2P/STAT5RE/Hygro] Vector 20 μg E4651 pGL4.29[luc2P/CRE/Hygro] Vector 20 μg E8471 pGL4.30[luc2P/NFAT-RE/Hygro] Vector 20 μg E8481 pGL4.32[luc2P/NF-κB-RE/Hygro] Vector 20 μg E8491 pGL4.33[luc2P/SRE/Hygro] Vector 20 μg E1340 pGL4.34[luc2P/SRF-RE/Hygro] Vector 20 μg E1350 Available Separately pGL4.23[luc2/minP] Vector 20 μg E8411 pGL4.24[luc2P/minP] Vector 20 μg E8421 GloResponse™ NFAT-RE-luc2P HEK293 Cell Line 2 vials E8510 GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line 2 vials E8520 pGL4.25[luc2CP/minP] Vector 20 μg E8431 pGL4.26[luc2/minP/Hygro] Vector 20 μg E8441 pGL4.27[luc2P/minP/Hygro] Vector 20 μg E8451 pGL4.28[luc2CP/minP/Hygro] Vector 20 μg E8461 GloResponse™ CRE-luc2P HEK293 Cell Line 2 vials E8500 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Creating a cell line with an indicator of a functional signaling pathway is useful for deciphering the components in a signaling pathway. These tools are made by insertion of multiple repeats of a response element upstream of a minimal promoter (minP). Promega has designed vectors that report the activity of a variety of pathways using the optimized luc2 firefly luciferase gene in the pGL4 backbone. These vectors also have a hygromycin resistance selectable marker, allowing use either in transient transfection experiments or for selection of a stable cell line. Also available for construction of pathway reporters are minimal promoter (minP) vectors with three varieties of engineered firefly luciferase genes: luc2, luc2P or luc2CP. The luc2 gene is engineered to remove most cryptic transcription factor binding sites and improve mammalian expression through codon optimization. The luc2P and luc2CP and RapidResponse™ genes are luc2 genes appended with degradation sequences to influence the cellular half-life of the luc2 gene. The RapidResponse™ genes respond more rapidly to stimuli but at the expense of signal intensity. The luc2P (1-hour half-life) gene responds more rapidly than luc2 (3-hour half-life) with moderate signal intensity, and the luc2CP (0.4-hour half-life) responds more quickly with the lowest signal intensity. The minP vectors are available with or without selectable markers (hygromycin). To speed research, several pre-designed response element vectors are available already assembled in the pGL4.27 Vector. Some of these also are available stable cell lines (GloResponse™ Cell Lines). Features: • Pre-designed vectors remove the need to clone and validate an assay. • Increased Reporter Gene Expression: Codon optimization of synthetic genes for mammalian expression. • Reduced Background and Risk of Expression Artifacts: Removal of cryptic DNA regulatory elements and transcription factor binding sites. • Improved Temporal Response: Rapid Response™ technology using destabilized luciferase genes. • Easy Transition from Transient to Stable Cells: Choice of mammalian selectable markers. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 13 2Cell Health For complete and up-to-date product information visit: www.promega.com Apoptosis Assays RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay Product Size Cat.# RealTime-Glo™ Annexin V Apoptosis Assay 100 assays JA1000 1,000 assays JA1001 RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay 100 assays JA1011 1,000 assays JA1012 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay measures the real-time exposure of phosphatidylserine (PS) on the outer leaflet of cell membranes during the apoptotic process. Annexin V luciferase fusion proteins supplied in the assay reagent bind to PS during early apoptosis and are detected with a simple luminescence signal. The reagent also includes a DNA-binding dye, which enters the cell and generates a fluorescent signal upon loss of membrane integrity. The combination and timing of luminescent and fluorescent signals is used to differentiate secondary necrosis occurring during late apoptosis from necrosis caused by other cytotoxic events. The assay is nonlytic and the simple “add-and-read” method allows multiple readings from a single assay well. Apoptosis can be monitored in real time, without the need for multiple plates, complicated processing or specialized detection equipment. A multimode reader capable of detecting luminescence and fluorescence is the only instrument required. Features: • No-wash, one-step Annexin V binding assay. • Nonlytic: allows continual monitoring of cell state to accurately determine apoptotic onset. • Scalable for high-throughput screening applications. Storage Conditions: Store at –30°C to –10°C. ApoTox-Glo™ Triplex Assay Product Size Cat.# ApoTox-Glo™ Triplex Assay 10 ml G6320 5 × 10 ml G6321 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ApoTox-Glo™ Triplex Assay combines three assay chemistries to easily assess viability, cytotoxicity and apoptosis events in the same cell-based assay well. First, viability and cytotoxicity are determined by measuring two differential protease biomarkers simultaneously with the addition of a single nonlytic reagent containing two peptide substrates. The live-cell protease activity is restricted to intact viable cells and is measured using a fluorogenic, cell-permeant peptide substrate (GF-AFC Substrate). The substrate enters intact cells, where it is cleaved to generate a fluorescent signal proportional to the number of living cells. This live-cell protease activity marker becomes inactive upon loss of membrane integrity and leakage into the surrounding culture medium. A second, cell-impermeant, fluorogenic peptide substrate (bis-AAF-R110 Substrate) is used simultaneously to measure dead-cell protease activity that has been released from cells that have lost membrane integrity. This results in ratiometric, inversely correlated measures of cell viability and cytotoxicity. The ratio of viable cells to dead cells is independent of cell number and, therefore, can be used to normalize data. A second reagent containing luminogenic DEVD-peptide substrate for caspase-3/7 and Ultra-Glo™ Recombinant Thermostable Luciferase is added. Caspase-3/7 cleavage of the substrate releases luciferin, which is a substrate for luciferase and generates light. The light output, measured with a luminometer, correlates with caspase-3/7 activation as a key indicator of apoptosis. Features: • Measure Viability, Cytotoxicity and Apoptosis in the Same Sample Well: Determine mechanism of cell death for cells in the same sample well. • Easily Implement: Assay follows a simple sequential “add-mix-measure” format. • Normalize Data with a Built-In Control: The ratio of the number of live cells/number of dead cells is independent of cell number and normalizes data. This normalization makes results more comparable well-to-well, plate-to-plate and day-to-day. • Easily Automate this Flexible Assay: Component volumes can be scaled to meet throughput needs. Amenable to automation in 96- and 384-well plates. • Improve Efficiency and Save Lab Budget: Reduce cell culture and labor costs by performing three assays in a single well. Storage Conditions: Store all components at –20°C protected from light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 14 For complete and up-to-date product information visit: www.promega.com ApoLive-Glo™ Multiplex Assay Product Size Cat.# ApoLive-Glo™ Multiplex Assay 10 ml G6410 5 × 10 ml G6411 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ApoLive-Glo™ Multiplex Assay measures both the number of viable cells as a marker of cytotoxicity and caspase activation as a marker of apoptosis within a single assay well to determine the mechanism of cell death. The first part of the assay measures the activity of a protease marker of cell viability. The live-cell protease activity is restricted to intact viable cells and is measured using a fluorogenic, cell-permeant, peptide substrate (glycyl-phenylalanyl-amino fluorocoumarin; GF-AFC). The substrate enters intact cells, where it is cleaved by the live-cell protease activity to generate a fluorescent signal proportional to the number of living cells. This live-cell protease becomes inactive upon loss of cell membrane integrity and leakage into the surrounding culture medium. The second part of the assay uses the Caspase-Glo® Assay technology to detect caspase activation, a key biomarker of apoptosis. The Caspase-Glo® Assay provides a luminogenic caspase-3/7 substrate, which contains the tetrapeptide sequence DEVD, in a reagent optimized for caspase activity, luciferase activity and cell lysis. Adding the Caspase-Glo® 3/7 Reagent in an ‘add-mix-measure’ format results in cell lysis, followed by caspase cleavage of the substrate and generation of a ‘glow-type’ luminescent signal produced by luciferase. Luminescence is proportional to the amount of caspase activity present. Features: • Measure Viability and Apoptosis in the Same Sample Well: Accurately determine the mechanism of cell death in less time with less sample. • Easy to Implement: The assay uses a simple sequential ‘add-mix-measure’ format. • Normalize Caspase Data with Viability Control: The ratio of caspase activity to viable cell is useful for determining the extent of caspase activation and for normalizing cell numbers. • Flexible and Easily Automated: The volumes of each assay component can be scaled to meet throughput needs, and the assay is amenable to automation in 96- and 384-well plates. • Reveal cell death even if the window of caspase activity is missed. • Multiplex with Other Assays: The nonlytic nature of the first step of the assay allows further multiplexing with spectrally distinct fluorescent assay chemistries. Storage Conditions: Store all components at –20°C protected from light. Caspase-Glo® 3/7 Assay Systems Product Size Cat.# Caspase-Glo® 3/7 Assay 2.5 ml G8090 10 ml G8091 10 × 10 ml G8093 100 ml G8092 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Caspase-Glo® 3/7 Assay provides a homogeneous luminescent assay that measures caspase-3/7 activities. The assay provides a proluminescent caspase-3/7 DEVD-aminoluciferin substrate and a proprietary thermostable luciferase in a reagent optimized for caspase-3/7 activity, luciferase activity and cell lysis. Adding the single Caspase-Glo® 3/7 Reagent in an “add-mix-measure” format results in cell lysis, followed by caspase cleavage of the substrate. This liberates free aminoluciferin, which is consumed by the luciferase, generating a “glow-type” luminescent signal. The signal is proportional to caspase-3/7 activity. The stabilized luciferase and proprietary buffer system improve assay performance across a wide range of assay conditions, and the assay is less likely to be affected by compound interference unlike fluorescent- or colorimetric-based assays. The Caspase-Glo® 3/7 Assay is designed for use with multiwell plate formats using either purified enzyme or cells in culture. Features: • Simplify Apoptosis or Caspase Detection: The “add-mix-measure” protocol makes the assay easy to automate; simply add an equal volume of reagent to sample volume. • Use Less Enzyme or Fewer Cells: The low background luminescence results in excellent signal-to-noise ratios and superior sensitivity not achieved by other caspase formats, allowing assays to be performed in 96- or 384-well formats. • Decrease Assay Time: No sample preparation or manipulation required, and no extended incubation times are necessary, as with fluorescencebased assays. Maximum sensitivity is achieved in as little as 0.25–1 hour. • Rely on a Performance-Tested Assay: The assay delivers excellent Z´- factor values in cell and purified enzyme models. • Process Plates in Batch Mode: The extended-glow signal allows the plates to be read over a 3-hour period of time for batch processing; no injectors required. • Get More Information: Multiplex with other cell-based assays from Promega. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 15 2Cell Health For complete and up-to-date product information visit: www.promega.com Caspase-Glo® 8 Assay Systems Product Size Cat.# Caspase-Glo® 8 Assay 2.5 ml G8200 10 ml G8201 100 ml G8202 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Caspase-Glo® 8 Assay is a homogeneous luminescent assay that measures caspase-8 activity. The assay provides a proluminogenic caspase-8 substrate in a buffer system optimized for caspase activity, luciferase activity and cell lysis. The addition of a single Caspase-Glo® 8 Reagent in an “add-mix-read” format results in cell lysis, followed by caspase cleavage of the substrate and generation of a “glow-type” luminescent signal. The signal generated is proportional to the amount of caspase activity present. The Caspase-Glo® Reagent relies on the properties of a proprietary thermostable luciferase (Ultra-Glo™ Recombinant Luciferase), which generates the stable “glow-type” luminescent signal and improves performance across a wide range of assay conditions. The system now includes a separate vial of a protease inhibitor, MG-132 Inhibitor, which may be used to reduce background, thus improving the performance of the Caspase-Glo® 8 Assay in cell-based applications. Features: • Simplify Apoptosis or Caspase Detection: The homogeneous “add-mix-read” protocol makes the assay easy to automate; simply add an equal volume of reagent to sample volume. • Use Less Enzyme: The low background luminescence results in excellent signal-to-noise ratios and superior sensitivity not achieved by other caspase formats, allowing assays to be performed in 96- or 384-well formats. • Decrease Assay Time: No sample preparation or manipulation required, and no extended incubation times are necessary as with fluorescent-based assays. Maximum sensitivity is achieved in as little as 0.5–1 hour. • Rely on a Performance-Tested Assay: The assay delivers excellent Z´-factors in cell and purified enzyme models. • Get More Information: Multiplex with other cell-based assays from Promega. • Experience Improved Caspase-8 Selectivity: The Caspase-Glo® 8 Assay uses a luminogenic substrate containing the LETD sequence, which has been shown to be selective for caspase-8. The assay includes an optional proteasome inhibitor (MG-132), which when added to the Caspase-Glo® 8 Reagent significantly reduces nonspecific background in cell-based assays. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C protected from light. Caspase-Glo® 9 Assay Systems Product Size Cat.# Caspase-Glo® 9 Assay 2.5 ml G8210 10 ml G8211 100 ml G8212 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Caspase-Glo® 9 Assay is a homogeneous luminescent assay that measures caspase-9 activity. The assay provides a proluminogenic caspase-9 substrate in a buffer system optimized for caspase activity, luciferase activity and cell lysis. The addition of a single Caspase-Glo® 9 Reagent in an “add-mix-read” format results in cell lysis, followed by caspase cleavage of the substrate and generation of a “glow-type” luminescent signal. The signal generated is proportional to the amount of caspase activity present. The Caspase-Glo® Reagent relies on the properties of a proprietary thermostable luciferase (Ultra-Glo™ Recombinant Luciferase), which generates the stable “glow-type” luminescent signal and improves performance across a wide range of assay conditions. The system now includes a separate vial of a protease inhibitor, MG-132 Inhibitor, which may be used to reduce background, thus improving the performance of the Caspase-Glo® 9 Assay in cell-based applications. Features: • Simplify Apoptosis or Caspase Detection: The homogeneous “addmix-read” protocol makes the assay easy to automate; simply add an equal volume of reagent to sample volume. • Use Less Enzyme: The low background luminescence results in excellent signal-to-noise ratios and superior sensitivity not achieved by other caspase formats, allowing assays to be performed in 96- or 384-well formats. • Decrease Assay Time: No sample preparation or manipulation required, and no extended incubation times are necessary as with fluorescent-based assays. Maximum sensitivity is achieved in as little as 0.5–1 hour. • Rely on a Performance-Tested Assay: The assay delivers excellent Z´-factors in cell and purified enzyme models. • Get More Information: Multiplex with other cell-based assays from Promega. • Experience Improved Caspase-9 Selectivity: The Caspase-Glo® 9 Assay uses a luminogenic substrate containing the LEHD sequence, which has been shown to be selective for caspase-9. The assay includes an optional proteasome inhibitor (MG-132), which when added to the Caspase-Glo® 9 Reagent significantly reduces nonspecific background in cell-based assays. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C protected from light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 16 For complete and up-to-date product information visit: www.promega.com Apo-ONE® Homogeneous Caspase-3/7 Assay Product Size Cat.# Apo-ONE® Homogeneous Caspase-3/7 Assay 1 ml G7792 10 ml G7790 100 ml G7791 Available Separately Apo-ONE® Homogeneous Caspase-3/7 Buffer 100 ml G7781 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Apo-ONE® Homogeneous Caspase-3/7 Assay provides the necessary reagents for fast and sensitive measurement of active caspase-3 and -7 in a homogeneous format. The assay includes a profluorescent caspase-3/7 consensus substrate, rhodamine 110 bis-(N-CBZ-l-aspartyll-glutamyl-l-valyl-aspartic acid amide) (Z-DEVD-R110), and an optimized bifunctional cell lysis/activity buffer. The buffer efficiently lyses cultured mammalian cells and supports optimal caspase-3/7 enzymatic activity. The substrate and buffer are combined to make the Apo-ONE® Caspase-3/7 Reagent that is added directly to samples. Upon cleavage on the C-terminal side of the aspartate residue in the DEVD peptide substrate sequence by caspase-3/7 enzymes, the rhodamine 110 becomes fluorescent when excited at a wavelength of 498nm. The emission maximum is 521nm. The amount of fluorescent product generated is representative of the amount of active caspase-3/7 present in the sample. Features: • Get Results Faster: The simple “add-mix-measure” format combined with the high sensitivity of the assay dramatically decreases the “time to first result” by eliminating cumbersome sample preparation and lengthy incubation steps. • Use Less Enzyme or Fewer Cells: Optimized caspase-3/7 activity buffer, in conjunction with the R110-labeled substrate, allows increased sensitivity over existing fluorescent caspase assay methods. • Adapt to Your Format and Throughput Needs: The assay can be flexibly configured (from cuvette to 384-well plate) for use in highthroughput systems by maintaining a 1:1 ratio of sample to assay reagent and may be used with purified enzyme preparations, cell extracts or cultures of adherent, suspension or primary cells. • Get More Information: Perform more than one assay on the same sample. This assay can be multiplexed with other assay methods such as the CellTiter-Blue® Assay (Cat.# G8080) or the Caspase-Glo® 8 or 9 Assays (Cat.# G8200 or G8210). • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C protected from light and moisture. CaspACE™ FITC-VAD-FMK In Situ Marker Product Size Cat.# CaspACE™ FITC-VAD-FMK In Situ Marker 50 μl G7461 125 μl G7462 For Research Use Only. Not for Use in Diagnostic Procedures. Description: CaspACE™ FITC-VAD-FMK In Situ Marker is a fluorescent analog of the pan caspase inhibitor Z-VAD-FMK (carbobenzoxy-valyl-alanylaspartyl-[O-methyl]-fluoromethylketone). The fluorescein isothiocyanate (FITC) group has been substituted for the carbobenzoxy (Z) N-terminal blocking group to create the fluorescent apoptosis marker. This structure allows delivery of the inhibitor into the cell where it irreversibly binds to activated caspases. The FITC label allows a single-reagent addition to assay for caspase activity in situ. The FITC-VAD-FMK is supplied as a 5mM solution in DMSO and is intended for in situ monitoring of caspase activity by fluorescence detection. The suggested concentration for use in anti-Fas-treated Jurkat cell culture is 10μM. Features: • Simplify Your Protocol: Add FITC-VAD-FMK, incubate, wash and view fluorescence. • Use a Variety of Detection Methods: Detect apoptotic cells by fluorescence microscopy or flow cytometry; combine with other immunomarkers to assess cell populations or determine apoptotic frequency within a population; adaptable to high-throughput applications. • Get Results Faster: Quick, single-reagent addition to cell culture; no preparation of cell extracts or long incubation steps. Use as a preliminary screen for apoptosis. • Get Reliable Results: Synthesized peptide provides consistent results from every batch, unlike Annexin V, which can be highly variable between batches. • Use With Live Cells: Easily moves in and out of cells and remains anchored inside cultured apoptotic cells. Storage Conditions: Store at –20°C protected from light and moisture. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 17 2Cell Health For complete and up-to-date product information visit: www.promega.com DeadEnd™ Colorimetric TUNEL System Product Size Cat.# DeadEnd™ Colorimetric TUNEL System 20 reactions G7360 40 reactions G7130 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The DeadEnd™ Colorimetric TUNEL System is a modified TUNEL Assay that provides simple, accurate and rapid detection of apoptotic cells in situ at the single-cell level. The assay measures nuclear DNA fragmentation, an important biochemical indicator of apoptosis, and can be used to detect apoptotic cell death in tissue sections and cultured cells. The fragmented DNA of apoptotic cells is end-labeled using a modified TUNEL (TdT-mediated dUTP Nick-End Labeling) assay. Biotinylated nucleotide is incorporated at the 3´-OH DNA ends using Terminal Deoxynucleotidyl Transferase (TdT). Horseradishperoxidase-labeled streptavidin (Streptavidin HRP) is then bound to these biotinylated nucleotides, which are detected using the peroxidase substrate, hydrogen peroxide, and the stable chromogen, diaminobenzidine (DAB). Using this procedure, apoptotic nuclei are stained dark brown. Note: The protocol for the DeadEnd™ TUNEL Assay recommends an optional DNase I treatment of samples as a positive control to detect DNA fragmentation. RQ1 RNase-Free DNase (Cat.# M6101) can be used to generate the positive control and is available separately. Features: • Assay Cells or Tissue: Detect apoptosis in thick tissue sections or assess cell morphology. • Simplify: Includes DAB substrate and H2 O2 for color detection and plastic coverslips that simplify sample handling. • Proven Applications: Vibratome® sections of neuronal tissue, Jurkat cells, HL-60 cells. Storage Conditions: Store the Equilibration Buffer, TdT Enzyme, Biotinylated Nucleotide Mix and Proteinase K at –20°C. Store the Streptavidin HRP, DAB 20X Chromogen, DAB Substrate 20X Buffer and Hydrogen Peroxide 20X at 4°C. Store the SSC 20X and Plastic Coverslips at room temperature. DeadEnd™ Fluorometric TUNEL System Product Size Cat.# DeadEnd™ Fluorometric TUNEL System 60 reactions G3250 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The DeadEnd™ Fluorometric TUNEL System is a classic TUNEL Assay designed for the specific detection and quantitation of apoptotic cells within a cell population. This system measures nuclear DNA fragmentation, an important biochemical hallmark of apoptosis in many cell types, providing simple, accurate and rapid detection of apoptotic cells in situ at the single-cell level or in cell suspensions. The DeadEnd™ Fluorometric TUNEL System measures the fragmented DNA of apoptotic cells by catalytically incorporating fluorescein-12-dUTP at 3´-OH DNA ends using Terminal Deoxynucleotidyl Transferase (TdT), which forms a polymeric tail using the principle of the TUNEL (TdT-mediated dUTP Nick-End Labeling) assay. The fluorescein-12-dUTPlabeled DNA can then be visualized directly by fluorescence microscopy or quantitated by flow cytometry. Note: The protocol for the DeadEnd™ TUNEL Assay recommends an optional DNase I treatment of samples as a positive control to detect DNA fragmentation. RQ1 RNase-Free DNase (Cat.# M6101) can be used to generate the positive control and is available separately. Features: • Save Money: System provides sufficient reagents for 60 assays of 50μl each. • Save Time: Direct incorporation of fluorescent nucleotide reduces number of incubation steps. • Choose Sample Type: Use to detect apoptosis in cultured cells and formalin-fixed, paraffin-embedded tissue sections. • Convenient: Plastic coverslips provided simplify sample handling. Storage Conditions: Store at –20°C. Store the Nucleotide Mix protected from light at –20°C. Caspase Inhibitor Z-VAD-FMK Product Size Cat.# Caspase Inhibitor Z-VAD-FMK, 20mM 50 μl G7231 125 μl G7232 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Z-VAD-FMK (carbobenzoxy-valyl-alanyl-aspartyl-[O-methyl]- fluoromethylketone) is a cell-permeant pan caspase inhibitor that irreversibly binds to the catalytic site of caspase proteases and can inhibit induction of apoptosis. For inhibition of apoptosis, Z-VAD-FMK should be added at the same time that apoptosis is induced. Z-VAD-FMK is provided at 20mM in DMSO for convenient addition to cell culture or extracts. The peptide is O-methylated in the P1 position on aspartic acid, providing enhanced stability and increased cell permeability. The suggested concentration for use in the anti-Fas mAb-treated Jurkat cell culture model system is 20μM. Storage Conditions: Store at –20°C protected from light and moisture. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 18 For complete and up-to-date product information visit: www.promega.com Anti-ACTIVE® Caspase-3 pAb Product Size Cat.# Anti-ACTIVE® Caspase-3 pAb 50 μl G7481 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Anti-ACTIVE® Caspase-3 pAb is intended for use as a marker of apoptosis; it specifically stains apoptotic cells without staining nonapoptotic cells. Includes sufficient antibody to perform 125 immunocytochemical assays (100μl/assay) at a 1:250 dilution. Features: • Immunogen: Peptide derived from the p17 fragment of caspase-3 and having sequence homology in human, mouse, rat and hamster. • Antibody Form: Affinity-purified rabbit IgG; supplied in Dulbecco’s PBS. • Specificity: Specifically recognizes the cleaved active form of caspase-3 in human, rat and mouse. Storage Conditions: store at–20°C. Anti-PARP p85 Fragment pAb Product Size Cat.# Anti-PARP p85 Fragment pAb 50 μl G7341 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Poly (ADP-ribose) polymerase (PARP), a nuclear enzyme involved in DNA repair, is a well known substrate for caspase-3 cleavage during apoptosis. Anti-PARP p85 Fragment pAb is a rabbit polyclonal antibody specific for the p85 fragment of PARP that results from caspase cleavage of the 116kDa intact molecule and thus provides an in situ marker for apoptosis. The antibody is affinity-purified using a peptide that corresponds to a region of the p85 fragment of PARP. The PARP immunogen is a synthetic peptide, gly-val-asp-glu-val-ala-lys (GVDEVAK), representing the N terminus of the large C-terminal fragment of human PARP that results from caspase-3 cleavage. Each batch of antibody is quality assurance tested for use in immunostaining applications and contains sufficient antibody for 50 immunocytochemical reactions at the suggested working dilution of 1:100. Features: • Immunogen: N-terminal peptide from p85 fragment. • Antibody Form: Affinity-purified rabbit polyclonal antibody provided in Dulbecco’s PBS. • Specificity: Specifically detects PARP p85 fragment in human, rat and bovine cells and tissues. Does not recognize the 116kDa intact PARP protein. Storage Conditions: Store at –20°C. Autophagy Detection Autophagy Assay Product Size Cat.# HEK293 Autophagy LC3 HiBiT Reporter Cell Line and Detection System 1 each GA1040 U2OS Autophagy LC3 HiBiT Reporter Cell Line and Detection System 1 each GA1050 Autophagy LC3 HiBiT Reporter Vector and Detection System 1 each GA2550 Not for Medical Diagnostic Use. Description: The Autophagy LC3 HiBiT Reporter Assay System is a platebased assay using a luminescent LC3 reporter to quantitatively measure autophagic flux. The easy one-step protocol eliminates wash steps and the need for complex imaging or flow cytometry systems. Choose from one of two prepared reporter cell lines (HEK293 or U2OS) or stably transfect the reporter vector into the cell line of your choice. Features: • Quantitative, unambiguous LC3 reporter assay • Easy add-mix-measure protocol • Scalable for high-throughput applications Storage Conditions: Upon arrival, immediately transfer cell vials to at or below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will negatively impact cell viability and cell performance. Store the Nano-Glo® HiBiT Lytic Detection System at –30°C to –10°C. The Nano-Glo® HiBiT Lytic Buffer may be stored at 4°C for 1 year or at room temperature for 3 months. Store the Autophagy LC3 HiBiT Reporter Vector at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 19 2Cell Health For complete and up-to-date product information visit: www.promega.com Cell Viability Assays RealTime-Glo™ MT Cell Viability Assay Product Size Cat.# RealTime-Glo™ MT Cell Viability Assay 100 reactions G9711 10 × 100 reactions G9712 1,000 reactions G9713 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The RealTime-Glo™ MT Cell Viability Assay is a nonlytic, homogeneous, bioluminescent method to determine in real time the number of viable cells in culture by measuring the reducing potential of cells and thus metabolism (MT). The assay involves adding NanoLuc® luciferase and a cell-permeant pro-NanoLuc® substrate to cells in culture. Viable cells reduce the proprietary pro-substrate to generate a substrate for NanoLuc® luciferase. This substrate diffuses from cells into the surrounding culture medium, where it is rapidly used by the NanoLuc® enzyme to produce a luminescent signal. The signal correlates with the number of viable cells, making the assay well suited for cytotoxicity studies. The reagent is stable and nontoxic to cells for up to 72 hours. No cell washing, removal of medium or further reagent addition is required to determine the number of viable cells. The nonlytic nature of this assay enables cells to be monitored over time in the same well, which reduces the amount of cells used and cell culture costs, and in downstream applications, including assay multiplexing and nucleic acid analysis. Features: • Real-Time Cell Viability Measurements: Monitor cell viability in real time to determine onset of toxicity, analyze potency versus efficacy over time and analyze differential cell growth with a simple, plate-based protocol. • Superior Sensitivity: The bioluminescent assay provides a greater signal-to-background ratio and higher sensitivity in less time compared to colorimetric or fluorometric viability assays that are based on the reducing potential of cells. • Assay Setup Flexibility: Perform real-time measurements by adding reagents when cells are plated, when test compound is added to the cells or at any time point when cell viability measurements are needed. Alternatively, set up the assay for an endpoint cell viability determination. • Nonlytic Assay Format: The RealTime-Glo™ MT Cell Viability Assay does not require cell lysis. Use cells to multiplex with other luminescent or fluorescent assays without the need for special filters or use cells later in a variety of downstream applications. This means you will use less sample and obtain more informative data points per sample. • Well Established Marker of Cell Viability: The assay chemistry is based on the reducing potential of the cell, which is a trusted metabolic marker of cell viability. • Compatibility with Automation: The assay is compatible with automated and high-throughput protocols. Reactions are scalable and can be performed at low volumes in 96-, 384- and 1,536-well plates. Storage Conditions: Store the RealTime-Glo™ MT Cell Viability Assay reagents at –20°C, protected from light. Avoid prolonged exposure to light of the MT Cell Viability Substrate, 1,000X. Avoid multiple freeze-thaw cycles. See product label for expiration date. CellTiter-Glo® 2.0 Assay Product Size Cat.# CellTiter-Glo® 2.0 Assay 10 ml G9241 100 ml G9242 500 ml G9243 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter-Glo® 2.0 Assay provides a homogeneous method for determining the number of viable cells in culture by measuring the amount of ATP present, which indicates the presence of metabolically active cells. The CellTiter-Glo® 2.0 Assay is based on the original CellTiter-Glo® Assay chemistry but with improved storage convenience for easy implementation. The CellTiter-Glo® 2.0 Assay is provided as a single, ready-to-use reagent that can be stored at 4°C for up to 5 months with >90% activity remaining or at room temperature for 1 week with >85% activity remaining. The CellTiter-Glo® 2.0 Assay is designed for use with multiwell plate formats, making it ideal for automated high-throughput screening (HTS), cell proliferation and cytotoxicity assays. The homogeneous assay procedure involves adding the single reagent (CellTiter-Glo® 2.0 Reagent) directly to cells cultured in serum-supplemented medium. Cell washing, removal of medium and multiple pipetting steps are not required. The system detects as few as 15 cells/well in a 384-well format in 10 minutes after adding reagent. The homogeneous “add-mix-measure” format results in cell lysis and generation of a luminescent signal proportional to the amount of ATP present. The amount of ATP is directly proportional to the number of cells present in culture. The CellTiter-Glo® 2.0 Assay generates a “glow-type” luminescent signal, which has a half-life generally greater than three hours, depending on cell type and medium used. The extended half-life eliminates the need to use reagent injectors and provides flexibility for continuous or batch-mode processing of multiple plates. Features: • Ready-to-Use Reagent: The single, ready-to-use reagent and convenient storage stability at 4°C or 22°C eliminate reagent thawing and preparation, freeing up resources and time, and allow fast and easy implementation. • Improved Storage Stability: Storage stability at 4°C or room temperature allows the same kit to be used multiple times over several days or weeks while maintaining performance. • Robust: Stable luminescent signal with a half-life >3 hours, depending on cell type and culture medium used, allowing batch processing; delivers excellent Z´-factor values for screening applications. • Flexible: The assay can be used with various multiwell formats (96-well, regular or low-volume 384-well and 1,536-well plates. Reagents are offered in volumes to accommodate low-throughput to high-throughput applications. Data can be recorded by luminometer or CCD camera or other imaging device capable of reading luminescence in multiwell plates. • Able to Multiplex: Can be used with other nonlytic-compatible cell-based assay chemistries from Promega. • Simple Protocol: Uses a simple add-mix-read protocol with just a 10-minute incubation. Storage Conditions: The CellTiter-Glo® 2.0 Assay is shipped frozen and can be stored at –30°C to –10°C through the expiration date of the reagent. The CellTiter-Glo® 2.0 Reagent can maintain >90% activity upon storage at 4°C for 5 months or >85% activity upon storage at 22–25°C for 7 days. The CellTiter-Glo® 2.0 Reagent can withstand four additional freeze-thaw cycles after the first thaw with no loss of activity when the reagent is stored at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 20 For complete and up-to-date product information visit: www.promega.com CellTiter-Glo® Luminescent Cell Viability Assay Product Size Cat.# CellTiter-Glo® Luminescent Cell Viability Assay 10 ml G7570 10 × 10 ml G7571 100 ml G7572 10 × 100 ml G7573 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter-Glo® Luminescent Cell Viability Assay is a homogeneous method of determining the number of viable cells in culture based on quantitation of the ATP present, an indicator of metabolically active cells. The CellTiter-Glo® Assay is designed for use with multiwell formats, making it ideal for automated high-throughput screening (HTS), cell proliferation and cytotoxicity assays. The homogeneous assay procedure involves adding the single reagent (CellTiter-Glo® Reagent) directly to cells cultured in serum-supplemented medium. Cell washing, removal of medium and multiple pipetting steps are not required. The system detects as few as 15 cells/well in a 384-well format in 10 minutes after adding reagent and mixing. The homogeneous “add-mix-measure” format results in cell lysis and generation of a luminescent signal proportional to the amount of ATP present. The amount of ATP is directly proportional to the number of cells present in culture. The CellTiter-Glo® Assay generates a “glow-type” luminescent signal, which has a half-life generally greater than five hours, depending on cell type and medium used. The extended half-life eliminates the need to use reagent injectors and provides flexibility for continuous or batch mode processing of multiple plates. The unique homogeneous format avoids errors that may be introduced by other ATP measurement methods that require multiple steps. Features: • Simplify Cell Viability Assays: Homogeneous “add-mix-measure” format dramatically reduces the number of plate handling steps required for similar assays. • Use Fewer Cells: Detects as few as 15 cells/well in a 384-well format or 50 cells/well in a 96-well format. Accurately measures cells at numbers below the detection limits of standard colorimetric and fluorometric assays. Reduces the number of cells required per assay. • Get Results Quickly: Data can be recorded 10 minutes after adding reagent. • Choose Your Format: Can be used with various multiwell formats. Data can be recorded by luminometer or CCD camera imaging device. • Process Plates Consecutively: Luminescent signal is very stable, with a half-life generally >5 hours, dependent on cell type and medium used, allowing batch processing; delivers excellent Z´-factor values for screening applications. • Get More Information: Multiplex with other cell-based assays from Promega. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: For long-term storage, the lyophilized CellTiter-Glo® Substrate and CellTiter-Glo® Buffer should be stored at –20°C. Reconstituted CellTiter-Glo® Reagent can be stored at 4°C for 48 hours with ~5% loss of activity or at 4°C for 4 days with ~20% loss of activity. CellTiter-Glo® One Solution Assay Product Size Cat.# CellTiter-Glo® One Solution Assay 100 ml G8461 500 ml G8462 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter-Glo® One Solution Assay is a homogeneous method of determining the number of viable cells in culture based on quantitation of the ATP present, which indicates the presence of metabolically active cells. This frozen, ready-to-use format is based on the original CellTiter-Glo® Luminescence Cell Viability Assay chemistry and eliminates the need to combine buffer with lyophilized substrate when preparing reagent. The CellTiter-Glo® Assay is designed for use with multiwell-plate formats, making it ideal for automated high-throughput screening (HTS) in 96- to 1536-well format, and cell proliferation and cytotoxicity assays. The homogeneous “add-mix-measure” format results in cell lysis and generation of a luminescent signal proportional to the amount of ATP present. The amount of ATP is directly proportional to the number of cells present in culture. The CellTiter-Glo® One Solution Assay generates a stable “glow-type” luminescent signal with a half-life of greater than three hours. This extended half-life eliminates the need for reagent injectors and provides flexibility for continuous or batch-mode processing of multiple plates. Features: • Convenient: No reagent preparation is required; simply thaw and “add-mix-measure”. Volumes convenient for HTS applications. • Homogeneous: “Add-mix-measure” format reduces the number of plate-handling steps. • Fast: Data can be recorded 10 minutes after reagent addition. • Sensitive: Measures cells at numbers below the detection limits of standard colorimetric and fluorometric assays. • Flexible: Can be used with various multiwell formats (96-, regular or low-volume 384- and 1536-well plates). Data can be recorded by luminometer or CCD camera imaging device. • Robust: Stable luminescent signal with a half-life >3 hours, depending on cell type and culture medium used. • Ability to Multiplex: Can be used with other nonlytic compatible assay chemistries from Promega. Storage Conditions: Store the CellTiter-Glo® One Solution Assay below –10°C. CellTiter-Glo® One Solution Assay can be stored at 4°C for 48 hours or at 22°C for 10 hours with ~10–12% loss of activity. CellTiter-Glo® One Solution Assay can withstand two additional freeze-thaw cycles after the first thaw, with approximately 10% loss of activity with each additional freeze-thaw cycle. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 21 2Cell Health For complete and up-to-date product information visit: www.promega.com CellTiter-Glo® 3D Cell Viability Assay Product Size Cat.# CellTiter-Glo® 3D Cell Viability Assay 10 ml G9681 10 × 10 ml G9682 100 ml G9683 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter-Glo® 3D Cell Viability Assay is a homogeneous method to determine the number of viable cells in 3D cell culture based on quantitation of the ATP present, which is a marker for the presence of metabolically active cells. This ready-to-use reagent is based on the original CellTiter-Glo® Luminescent Cell Viability Assay chemistry and eliminates the need to combine buffer with lyophilized substrate when preparing reagent. The CellTiter-Glo® 3D Cell Viability Assay is formulated with more robust lytic capacity and is designed for use with microtissues produced in 3D cell culture. The homogeneous assay procedure involves addition of a single reagent (CellTiter-Glo® 3D Reagent) directly to cells cultured in serum-supplemented medium. Cell washing, removal of medium and multiple pipetting steps are not required. This assay is compatible with multiwell-plate formats, making it ideal for automated high-throughput screening (HTS). The CellTiter-Glo® 3D Assay has been used successfully with 3D microtissue cell culture produced via hangingdrop plates, ultra-low attachment plates, Matrigel®-coated plates, agarose-coated plates, cultures suspended in methylcellulose and Alvetex® plates. Features: • Robust Penetration into Microtissues: Improved lytic capacity allows use over a broad range of microtissue sizes compared to other viability assay methods. • Ready-to-Use Reagent: No mixing of components required; simply thaw, equilibrate to room temperature and “add-mix-incubate-measure”. Convenient for HTS applications. • Fast Results: Data can be recorded in 30 minutes or less after adding reagent, quicker than when using colorimetric or fluorometric viability assays. • Superior Sensitivity: The signal-to-background ratio of this assay applied to microtissues is much greater than that of standard colorimetric and fluorometric assays. • Flexible Format: The assay can be used with various multiwell formats (96-well and regular or low-volume 384-well). Data can be recorded by luminometer, CCD camera or other imaging devices capable of reading luminescence in multiwell plates. • Glow-Type Signal: Stable luminescent signal half-life >3 hours, depending on cell type and culture medium used, allows batch mode or consecutive processing of multiple plates. Storage Conditions: Store at –30 to –10°C until the expiration date on the kit label. BacTiter-Glo™ Microbial Cell Viability Assay Product Size Cat.# BacTiter-Glo™ Microbial Cell Viability Assay 10 ml G8230 10 × 10 ml G8231 100 ml G8232 10 × 100 ml G8233 Available Separately Size Conc. Cat.# rATP, 10mM 0.5 ml mM P1132 G8230, G8231, G8232, G8233 For Research Use Only. Not for Use in Diagnostic Procedures. P1132 For Laboratory Use. Description: The BacTiter-Glo™ Microbial Cell Viability Assay provides a method for determining the number of viable microbial cells in culture based on quantitation of the ATP present. ATP is an indicator of metabolically active cells. The homogeneous assay procedure involves adding a single reagent (BacTiter-Glo™ Reagent) directly to bacterial cells cultured in medium and measuring luminescence. This assay format reduces pipetting errors that may be introduced during the multiple steps required by other methods of ATP measurement. The formulation of the reagent supports bacterial cell lysis and generation of a luminescent signal in an “add-mix-measure” format. The luminescent signal is proportional to the amount of ATP present, which is directly proportional to the number of viable cells in culture. The assay relies on the properties of a proprietary thermostable luciferase (Ultra-Glo™ Recombinant Luciferase) and a proprietary buffer formulation for extracting ATP from bacteria. The assay has been shown to detect a variety of bacteria and fungi. Features: • Simplify Microbial Detection: The “add-mix-measure” format reduces the number of handling steps to fewer than that required for similar ATP assays, with no separate lysis step, and no injectors required, allowing easy automation. • Get Results Quickly: Data can be recorded in 5 minutes or less after adding reagent and mixing. Superior sensitivity allows you to detect growth or toxicity quickly after inoculation. • Increase Your Sensitivity: Measure ATP from as few as 10 bacterial cells, 1,000-fold more sensitive than absorbance (O.D.) readings. • Choose Your Format: Can be used with various multiwell-plate or single-use formats. Data can be recorded by luminometer or CCD camera. • Process Plates Consecutively: The “glow-type” luminescent signal is stable, with a half-life generally over 30 minutes. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: For long-term storage, the lyophilized BacTiter-Glo™ Substrate and BacTiter-Glo™ Buffer should be stored at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 22 For complete and up-to-date product information visit: www.promega.com Fluorescent Cell Viability Assay Product Size Cat.# CellTiter-Fluor™ Cell Viability Assay 10 ml G6080 5 × 10 ml G6081 2 × 50 ml G6082 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter-Fluor™ Cell Viability Assay is a nonlytic, single-reagent-addition fluorescence assay that measures the relative number of viable cells in a population. The assay is based on measurement of a conserved and constitutive protease activity within live cells and therefore serves as a biomarker of cell viability. The live-cell protease activity is restricted to intact viable cells and is measured using a fluorogenic, cell-permeant, peptide substrate (Gly-Phe-AFC). The substrate enters intact cells, where it is cleaved by the live-cell protease activity to generate a fluorescent signal proportional to the number of living cells. The live-cell protease becomes inactive upon loss of membrane integrity and leakage into the surrounding culture medium. The CellTiter-Fluor™ Assay also can be used in a single-well, sequential, multiplex format with other downstream assay chemistries to normalize data by cell number. Data from the assay can serve as an internal control and allow identification of errors resulting from cell clumping or compound cytotoxicity. The assay is compatible with many Promega luminescence assays or spectrally distinct fluorescence assay methods, such as measuring caspase activation, reporter gene expression or orthogonal measures of viability. Features: • Obtain Better Data from Every Well: The assay can be performed in multiplex with many Promega luminescence assays or spectrally distinct fluorescence assays. • Normalize Data for Cell Number: Normalizing data for live-cell number makes results more comparable well-to-well, plate-to-plate, day-to-day. • Save on Cell Culture Costs: Multiplexing assays in the same well eliminates parallel plate processing, thus reducing cell culture costs. Storage Conditions: Store at –20°C. CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) Product Size Cat.# CellTiter 96® AQueous One Solution Cell Proliferation Assay 200 assays G3582 1,000 assays G3580 5,000 assays G3581 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter 96® AQueous One Solution Cell Proliferation Assay is a colorimetric method for determining the number of viable cells in proliferation, cytotoxicity or chemosensitivity assays. The CellTiter 96® AQueous One Solution Reagent contains a tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5- (3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS] and an electron coupling reagent (phenazine ethosulfate; PES). PES has enhanced chemical stability, which allows it to be combined with MTS to form a stable solution. The CellTiter 96® AQueous Assay uses phenazine methosulfate (PMS) as the electron coupling reagent, and PMS Solution and MTS Solution are supplied separately. PES has enhanced chemical stability, which allows it to be combined with MTS to form a stable solution. Assays are performed by adding a small amount of the CellTiter 96® AQueous One Solution Reagent directly to culture wells, incubating for 1–4 hours and then recording absorbance at 490nm with a 96-well plate reader. The quantity of formazan product as measured by the amount of 490nm absorbance is directly proportional to the number of living cells in culture. If you currently use a [3 H]-thymidine incorporation assay, addition of the CellTiter 96® AQueous One Solution Reagent can be substituted for the pulse of [3 H]-thymidine at the time point in the assay when the pulse of radioactive thymidine is usually added. Previous bioassay data comparing [3 H]-thymidine incorporation to the MTS-based CellTiter 96® AQueous Assay and the original MTT-based CellTiter 96® Assay demonstrate that tetrazolium reagents can be substituted for [3 H]-thymidine incorporation. Features: • Simplify Colorimetric Viability Assays: “Add-incubate-measure” format (single-step reagent addition) enables design of homogeneous high-throughput screening assays. • Use a Single Solution: Use as a single solution, filter sterilized and ready to add to assay plates (unlike MTT). • Perform Fewer Steps: Perform the assay in 96-well plates with no washing or cell harvesting. Also eliminates solubilization steps normally required for MTT assays. • Gain Flexibility: Plates can be read and returned to incubator for further color development (unlike MTT). • Avoid Organic Solvents: Requires no volatile organic solvent to solubilize the formazan product (unlike MTT). • Non-Radioactive: Requires no scintillation cocktail or radioactive waste disposal (unlike [3 H]-thymidine incorporation assays). • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C, protected from light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 23 2Cell Health For complete and up-to-date product information visit: www.promega.com CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay (MTS) Product Size Cat.# CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay 1,000 assays G5421 5,000 assays G5430 50,000 assays G5440 Available Separately CellTiter 96® AQueous MTS Reagent Powder 1 g G1111 250 mg G1112 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay is a homogeneous, colorimetric method for determining the number of viable cells in proliferation, cytotoxicity or chemosensitivity assays. The CellTiter 96® AQueous Assay is composed of solutions of a novel tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)- 2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS] and an electron coupling reagent (phenazine methosulfate) PMS. MTS is bioreduced by cells into a formazan product that is soluble in tissue culture medium. The absorbance of the formazan product at 490nm can be measured directly from 96-well assay plates without additional processing. The conversion of MTS into the aqueous soluble formazan product is accomplished by dehydrogenase enzymes found in metabolically active cells. The quantity of formazan product as measured by the amount of 490nm absorbance is directly proportional to the number of living cells in culture. If you currently use a [3 H]-thymidine incorporation assay, addition of the combined MTS/PMS solution can be substituted for [3 H]-thymidine at the time point in the assay when the pulse of radioactive thymidine is usually added. Data from proliferation bioassays comparing the CellTiter 96® AQueous Assay and [3 H]-thymidine incorporation show similar results. This is in agreement with similar radioactivity incorporation studies performed using the original CellTiter 96® Assay. CellTiter 96® AQueous MTS Reagent Powder is a novel tetrazolium compound for use in colorimetric assays for determining the number of viable cells in proliferation, cytotoxicity or chemosensitivity assays. It is provided in powdered form. Features: • Easy to Use: Combine provided MTS and PMS solutions, add to cells, incubate and read absorbance. • Fast: Perform the assay in a 96-well plate with no washing or cell harvesting. Also eliminates solubilization steps because the MTS formazan product is soluble in tissue culture medium. • Non-Radioactive: Requires no scintillation cocktail or radioactive waste disposal (unlike [3 H]-thymidine). • Flexible: Plates can be read and returned to incubator for further color development (unlike MTT). • Safe: Requires no volatile organic solvent to solubilize the formazan product (unlike MTT). Storage Conditions: For long-term storage, store MTS and PMS Solutions at –20°C, protected from light. CellTiter 96® Non-Radioactive Cell Proliferation Assay (MTT) Product Size Cat.# CellTiter 96® Non-Radioactive Cell Proliferation Assay 1,000 assays G4000 5,000 assays G4100 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter 96® Assay is a collection of qualified reagents that provide a convenient method of determining viable cell number. The CellTiter 96® Assay is a modification of the MTT assay method described by Mosmann and incorporates several improvements to the method that address previous technical problems including: 1) serum protein precipitation caused by adding organic solvent; 2) interference by phenol red; 3) incomplete solubilization of the formazan crystals resulting in lower sensitivity; and 4) stability of the colored product. The CellTiter 96® Assay is performed by adding a premixed, optimized Dye Solution to culture wells of a 96-well plate, usually containing various concentrations of growth factor or test substance. During a 4-hour incubation, living cells convert the MTT tetrazolium component of the Dye Solution into a formazan product. If you currently use a [3 H]-thymidine incorporation assay, the addition of Dye Solution can be substituted for the pulse of radioactive thymidine at the time point in the assay when the pulse of [3 H]-thymidine is usually added. The Solubilization/Stop Solution is then added to the culture wells to solubilize the formazan product, and the absorbance at 570nm is recorded using a 96-well plate reader. In addition, direct comparison between [ 3 H]-thymidine incorporation and tetrazolium conversion have demonstrated less than a 5% difference between the two assays for determination of growth factor content of several samples. Features: • Gain Sensitivity: Detect as few as 1,000 cells/well with a 96-well plate reader. Greater sensitivity than the neutral red assay procedure. • Use a Variety of Cells: Assay mammalian, plant and yeast cells. • Non-Radioactive: Requires no scintillation cocktail or radioactive waste disposal. • Save Time: Perform the assay in a 96-well plate with no washing steps, no cell harvesting and no scintillation counting. • Adapt to Your Needs: Follow either a 4-hour or overnight protocol. • Convenient: Requires no weighing or mixing of dye components. Storage Conditions: Store Dye Solution at –20°C and Solubilization/Stop Solution at room temperature. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 24 For complete and up-to-date product information visit: www.promega.com CellTiter-Blue® Cell Viability Assay Product Size Cat.# CellTiter-Blue® Cell Viability Assay 20 ml G8080 100 ml G8081 10 × 100 ml G8082 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter-Blue® Cell Viability Assay provides a homogeneous, fluorescent method for monitoring cell viability. The assay is based on the ability of living cells to convert a redox dye (resazurin) into a fluorescent end product (resorufin). Nonviable cells rapidly lose metabolic capacity and thus do not generate a fluorescent signal. The homogeneous assay procedure involves adding the single reagent directly to cells cultured in serum-supplemented medium. After an incubation step, data are recorded using either a platereading fluorometer (preferred) or spectrophotometer. Features: • Save Time: The homogeneous, add-incubate-measure format reduces the number of handling steps. • Perform More Than One Assay on the Same Sample: The system can be multiplexed with other assay methods such as the Apo-ONE® Homogeneous Caspase-3/7 Assay (Cat.# G7790) or the Caspase-Glo® Assays (Cat.# G8090, G8200, G8210) for detecting apoptosis. • Gain Flexibility: The CellTiter-Blue® Assay has an excellent Z´ factor and offers more flexibility in assay incubation times compared to other resazurin-based assays. • Safe: The reagent is generally nontoxic to cells, allowing extended incubation periods in some situations. Requires no scintillation cocktail, radioactive waste disposal (unlike [3 H]-thymidine incorporation assays) or hazardous solvents (as required for MTT tetrazolium-based assays). • Adapt to Your Throughput Needs: The reagent is designed to provide sufficient volumes for accurate pipetting into 96- or 384-well formats. Convenient product sizes available for high-throughput screening. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store frozen at –20°C protected from light. Viral ToxGlo™ Assay Product Size Cat.# Viral ToxGlo™ Assay 10 ml G8941 10 × 10 ml G8942 100 ml G8943 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Viral ToxGlo™ Assay is a simple, quantifiable method of determining viral-induced cytopathic effects (CPE) in host cells caused by lytic virions. The assay measures cellular ATP as a surrogate measure of host cell viability. When CPE occurs due to viral infection, ATP depletion can be measured and correlated with viral burden. The amount of ATP detected is directly proportional to the number of viable host cells in culture and can be used as a simple method to quantify viral-induced CPE. The homogeneous “add-mix-measure” assay procedure involves adding the single reagent (ATP Detection Reagent) directly to host cells following viral treatment. A “glow-type” luminescent signal is generated that is proportional to the amount of ATP present. Cell washing, multiple pipetting steps and visual assessment are not required to assess CPE. The system detects as few as 15 cells/well in a 384-well format in 10 minutes after reagent addition and mixing and is designed for use in multiwell formats, making it ideal for automated highthroughput screening (HTS). Features: • Objectively Quantify CPE: The assay provides quantifiable data by luminescence detection, which obviates subjective operator error associated with visual scoring methods. • Decrease Time to Results: Data can be recorded and analysis begun 10 minutes after reagent addition. • Simplify Assessment of CPE: The homogeneous “add-mix-measure” protocol dramatically reduces the manual steps required for CPE assessment. • Choose Your Format: The reagent is scalable from 96- to 1536-well plate formats. • Amenable to High Throughput Screening: Luminescent signal is very stable with a half-life generally >5 hours dependent on cell type and medium used, allowing batch or consecutive processing. No fluorescence interference results in high signal to background and delivers excellent Z´ values in screening applications. • Choose Your Reagent Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: For long-term storage, the lyophilized ATP Detection Substrate and ATP Detection Buffer should be stored at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 25 2Cell Health For complete and up-to-date product information visit: www.promega.com Cytotoxicity Assays LDH-Glo™ Cytotoxicity Assay Product Size Cat.# LDH-Glo™ Cytotoxicity Assay 10ml J2380 50ml J2381 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The LDH-Glo™ Cytotoxicity Assay is a bioluminescent plate-based assay for quantifying lactate dehydrogenase (LDH) release into the culture medium upon plasma membrane damage. The bioluminescent detection is more sensitive than colorimetric or fluorescent methods, allowing accurate detection of LDH from a small number of cells, including primary cells and 3D cell cultures. The assay involves removing only a small amount of cell media (2–5µl) from each treated well, allowing you to get more data by sampling the same well over time, and by using the remaining media and cells for other cell-based assays. Features: • Detects LDH release from small numbers of cells, including 3D cell models • Monitors cytotoxicity from the same sample over time • Provides more data per well through multiplexing with other cell-based assays Storage Conditions: Store complete kits below –65°C. Alternatively, store the Reductase Substrate below –65°C protected from light, and store all other components at –30°C to –10°C. MultiTox-Glo Multiplex Cytotoxicity Assay Product Size Cat.# MultiTox-Glo Multiplex Cytotoxicity Assay 10 ml G9270 5 × 10 ml G9271 2 × 50 ml G9272 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MultiTox-Glo Multiplex Cytotoxicity Assay is a sequentialreagent-addition fluorescent and luminescent assay that measures the relative number of live and dead cells in cell populations. The MultiTox-Glo Assay sequentially measures two protease activities; one is a marker of viability, and the other is a marker of cytotoxicity. The live-cell protease activity is restricted to intact viable cells and is measured using a fluorogenic, cell-permeant, peptide substrate (GF-AFC). This substrate enters intact cells, where it is cleaved by the live cell protease activity to release AFC and generate a fluorescent signal that is proportional to the number of viable cells. The live-cell protease becomes inactive upon loss of membrane integrity and leakage into the surrounding culture medium. A second, luminogenic cell-impermeant peptide substrate (AAF-aminoluciferin) is used to measure dead-cell protease activity, which is released from cells that have lost membrane integrity. The liberated aminoluciferin product is measured as “glow type” luminescence generated by Ultra-Glo™ Recombinant Luciferase provided in the assay reagent. The MultiTox-Glo Assay gives ratiometric, inversely correlated measures of cell viability and cytotoxicity, which correlate with established methods for measuring viability and cytotoxicity. The ratio of viable cells to dead cells is independent of cell number and, therefore, can be used to normalize data. Having complementary cell viability and cytotoxicity measures reduces errors associated with pipetting and cell clumping, as well as serving as an internal control to allow identification of errors resulting from chemical interference from test compounds or media components. Features: • Measure the Number of Live Cells and Dead Cells in Culture: Sequential-reagent-addition assay with a homogeneous “add-mixmeasure” protocol. • Normalize Data with a Built-In Internal Control: The ratio of the number of live cells/number of dead cells is independent of cell number and can be used to normalize data. This normalization makes results more comparable well-to-well, plate-to-plate and day-to-day. • Immediately Identify More False-Positives and False-Negatives: Independent cell viability and cytotoxicity measurements serve as controls for each other. If test compounds interfere with one assay chemistry, the other serves as an internal control. • Improve your Data: Reduce statistical probability of false-positives (or false-negatives), and eliminate fluorescence interference issues by luminescence readout. Storage Conditions: Store at –20°C, protected from light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 26 For complete and up-to-date product information visit: www.promega.com MultiTox-Fluor Multiplex Cytotoxicity Assay Product Size Cat.# MultiTox-Fluor Multiplex Cytotoxicity Assay 10 ml G9200 5 × 10 ml G9201 2 × 50 ml G9202 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MultiTox-Fluor Multiplex Cytotoxicity Assay is a singlereagent-addition, homogeneous, fluorescent assay that measures the number of live and dead cells simultaneously in culture wells. The assay simultaneously measures cell viability and cytotoxicity by detecting two distinct protease activities. The live-cell protease activity is restricted to intact viable cells and is measured using a fluorogenic, cell-permeant peptide substrate (GF-AFC Substrate). The substrate enters intact cells where it is cleaved to generate a fluorescent signal proportional to the number of living cells. This live-cell protease activity marker becomes inactive upon loss of membrane integrity and leakage into the surrounding culture medium. A second, cell-impermeant, fluorogenic peptide substrate (bis-AAF-R110 Substrate) is used to measure dead-cell protease activity that has been released from cells that have lost membrane integrity. Features: • Measure the Number of Live and Dead Cells in Culture: Homogeneous, “add-mix-measure” protocol eliminates parallel plate processing and reduces cell culture costs. • Normalize Data for Cell Number: The ratio of live:dead cells is independent of cell number and normalizes data. Data normalization for cell number makes results more comparable well-to-well, plate-to-plate, day-to-day. • Reduce False-Positive and -Negative Results: Complementary liveand dead-cell measures with independent chemistries serve as internal controls for each other. • Get More Data from Every Well: Multiplex the MultiTox-Fluor Assay with most Promega bioluminescent cell-based apoptosis or genetic reporter assays. • Reduce Assay Variability: The homogeneous “add-mix-measure” protocol avoids the cumulative error associated with multistep protocols. Storage Conditions: Store at –20°C. ApoTox-Glo™ Triplex Assay Product Size Cat.# ApoTox-Glo™ Triplex Assay 10 ml G6320 5 × 10 ml G6321 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 13. CellTox™ Green Cytotoxicity Assay Product Size Cat.# CellTox™ Green Cytotoxicity Assay 10 ml G8741 50 ml G8742 100 ml G8743 CellTox™ Green Express Cytotoxicity Assay 200 μl G8731 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTox™ Green Cytotoxicity Assay measures changes in membrane integrity that occur as a result of cell death. The assay is intended to assess cytotoxicity in cell culture after experimental manipulation. The assay system uses a proprietary asymmetric cyanine dye that is excluded from viable cells but preferentially stains the DNA from dead cells. When the dye binds DNA released from cells, its fluorescence properties are substantially enhanced. Viable cells produce no appreciable increases in fluorescence. Therefore, the fluorescence signal produced by the binding interaction with dead-cell DNA is proportional to cytotoxicity. The CellTox™ Green Dye is nontoxic to cells, and the signal remains constant after exposure of 72 hours, making it ideal for determining toxic effects of treatments throughout an extended exposure or as an endpoint determination. Features: • Accurate Cytotoxicity Determination: The CellTox™ Green Dye stably binds DNA of cells that have lost membrane integrity throughout a 72-hour exposure and won’t underestimate cytotoxicity. • Kinetic Cytotoxicity Measures: Measure cytotoxicity at convenient time points from the same sample well to detect onset of toxicity with no duplication of plates. • Simple and Flexible Protocols: Add assay reagent directly to cells prior to plating or with dosing media to perform kinetic cytotoxicity measurements, eliminating a reagent dispensing step, or add diluted dye directly to cell culture wells as an endpoint add-mix-measure assay. • Multiplexing-Compatible: Get more informative data per well and reduce cell culture expenses by multiplexing with fluorescent and luminescent cell-based assays in the same well with no sample manipulation. • Easily Automated: Easily scale from 96- to 1536-well plate formats with “no-addition” or “single-addition” protocols. Storage Conditions: Store at –20°C. Lysis Solution Product Size Cat.# Lysis Solution 5 ml G1821 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Lysis Solution is a detergent solution useful for lysing cells and creating a cytotoxicity positive control. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27 2Cell Health For complete and up-to-date product information visit: www.promega.com CytoTox-Glo™ Cytotoxicity Assay Product Size Cat.# CytoTox-Glo™ Cytotoxicity Assay 10 ml G9290 5 × 10 ml G9291 2 × 50 ml G9292 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CytoTox-Glo™ Assay is a luminescent cytotoxicity assay that measures the relative number of dead cells in cell populations. The CytoTox-Glo™ Assay measures the extracellular activity of a distinct intracellular protease activity (dead-cell protease) when the protease is released from membrane-compromised cells. A luminogenic cell-impermeant peptide substrate (AAF-aminoluciferin) is used to measure dead-cell protease activity. The liberated aminoluciferin product is measured as “glow type” luminescence generated by Ultra-Glo™ Recombinant Luciferase provided in the assay reagent. The AAF-aminoluciferin substrate cannot cross the intact membrane of viable cells and does not generate any appreciable signal from the live-cell population. The amount of luminescence directly correlates with the percentage of cells undergoing cytotoxic stress. With the addition of a lysis reagent (provided), the CytoTox-Glo™ Assay also can deliver the luminescent signal associated with the total number of cells in each assay well. Viability can be calculated by subtracting the luminescent dead-cell signal from the total luminescent value, thus allowing you to normalize assay data to cell number and mitigate assay interferences that may lead to erroneous conclusions. The cytotoxicity protease biomarker is constitutive and conserved across cell lines, and the CytoTox-Glo™ Assay demonstrates excellent correlation with other methods of assessing cell viability. Features: • Measure the Relative Number of Dead Cells in Culture: Measure cytotoxicity by adding a single reagent with the homogeneous “add-mixmeasure” protocol. • Distinguish Between Small Differences in Viability: The assay provides a linear response and can distinguish between small differences in viability across the entire spectrum of cytotoxicity, from modest cytotoxicity (100 to 95% viability) to profound cytotoxicity (5 to 0% viability). • Normalize Data for Cytotoxicity: Data normalization for dead-cell number makes results more comparable well-to-well, plate-to-plate and day-to-day. • Measure the Relative Number of Remaining Viable Cells Using a Total Lysis Protocol: Correlate increased cytotoxicity with a reduction in viable cells. • Improve your Data: Reduce statistical probability of false-positives (or false-negatives), and eliminate fluorescence interference issues with a stable luminescence readout. Storage Conditions: Store at –20°C, protected from light. CytoTox-Fluor™ Cytotoxicity Assay Product Size Cat.# CytoTox-Fluor™ Cytotoxicity Assay 10 ml G9260 5 × 10 ml G9261 2 × 50 ml G9262 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CytoTox-Fluor™ Cytotoxicity Assay is a single-reagentaddition, homogeneous, fluorescent assay that measures the relative number of dead cells in cell populations. The assay measures a distinct protease activity associated with cytotoxicity and uses a fluorogenic peptide substrate (bisalanyl-alanyl-phenylanlanyl-rhodamine 110; bis-AAF-R110) to measure “deadcell activity,” which has been released from cells that have lost membrane integrity. The bis-AAF-R110 substrate cannot cross the intact membrane of live cells and therefore gives no signal from live cells. The assay is designed to accommodate downstream multiplexing with several Promega luminescent assays or spectrally distinct fluorescent assay methods, such as assays to measure caspase activation, reporter gene expression or orthogonal measures of viability. Features: • Measure the Relative Number of Dead Cells in Culture: Homogeneous, “add-mix-measure” protocol eliminates parallel plate processing and reduces cell culture costs. • Get More Data from Every Well: Multiplex the CytoTox-Fluor™ Assay with several Promega luminescent cell-based assays. • Normalize Downstream Multiplex Data for Cytotoxicity: Data normalization for dead-cell number makes results more comparable wellto-well, plate-to-plate, day-to-day. • Reduce Assay Variability: The homogeneous “add-mix-measure” protocol avoids the cumulative error associated with multistep protocols. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 28 For complete and up-to-date product information visit: www.promega.com CytoTox-ONE™ Homogeneous Membrane Integrity Assay Product Size Cat.# CytoTox-ONE™ Homogeneous Membrane Integrity Assay 200–800 assays G7890 1,000–4,000 assays G7891 CytoTox-ONE™ Homogeneous Membrane Integrity Assay, HTP 1,000–4,000 assays G7892 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CytoTox-ONE™ Homogeneous Membrane Integrity Assay is a fluorometric method for estimating the number of nonviable cells present in multiwell plates. The CytoTox-ONE™ Assay rapidly measures the release of lactate dehydrogenase (LDH) from cells with a damaged membrane. LDH released into the culture medium is measured with a 10-minute coupled enzymatic assay that results in the conversion of resazurin into a fluorescent resorufin product. The amount of fluorescence produced is proportional to the number of lysed cells using a 96- or 384-well format. The CytoTox-ONE™ Reagent does not damage normal healthy cells; therefore the reactions to measure released LDH can be performed directly in a homogeneous format in assay wells containing a mixed population of viable and damaged cells. The CytoTox-ONE™ Homogeneous Membrane Integrity Assay, HTP (Cat.# G7892), offers convenient, alternative packaging for processing multiple plates. Each bottle of reagent supplied with the system is sufficient to perform 500 assays in a 96-well format or 2,000 assays in a 384-well format when the recommended volumes are used. Features: • Save Time: Complete the assay in the cell culture plate, eliminating the sample transfer step common in many LDH assays; the plates are incubated for 10 minutes before reading data, compared to 30 minutes or more with classic LDH assays. • Multiplex This Assay: Perform multiple assays on one sample with other homogeneous cell-based assays from Promega. • Adapt Protocol to Your Needs: Completed assays can be read over several hours after the provided stop solution has been added while still maintaining good signal. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C protected from light. CytoTox 96® Non-Radioactive Cytotoxicity Assay Product Size Cat.# CytoTox 96® Non-Radioactive Cytotoxicity Assay 1,000 assays G1780 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CytoTox 96® Non-Radioactive Cytotoxicity Assay is a colorimetric alternative to radioactive cytotoxicity assays. The CytoTox 96® Assay quantitatively measures lactate dehydrogenase (LDH), a stable cytosolic enzyme that is released upon cell lysis, in much the same way as [51Cr] is released in radioactive assays. Released LDH in culture supernatants is measured with a 30-minute coupled enzymatic assay that results in the conversion of a tetrazolium salt (INT) into a red formazan product. The amount of color formed is proportional to the number of lysed cells. Visible wavelength absorbance data are collected using a standard 96-well plate reader. The assay can be used to measure membrane integrity for cell-mediated cytotoxicity assays in which a target cell is lysed by an effector cell, or to measure lysis of target cells by bacteria, viruses, proteins, chemicals, etc. Features: • Non-Radioactive: Requires no radioactive waste disposal or [51Cr]. • Save Time: Eliminates labeling of target cells prior to experiment. • Use Standard Equipment: Collect absorbance (visible wavelength) data with a standard 96-well plate reader. • Adapt to Your Needs: Used for a variety of applications including measurement of: 1) cell-mediated cytotoxicity; 2) chemical-mediated cytotoxicity; and 3) total cell number. • Gain Sensitivity: Can reveal early, low-level damage to cell membranes that is often missed with other methodologies. Storage Conditions: Store Substrate Mix and Assay Buffer at –20°C. Store LDH Positive Control, Lysis Solution (10X) and Stop Solution at 4°C. Digitonin Product Size Conc. Cat.# Digitonin 40 μl 20 mg/ml in DMSO G9441 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Digitonin is a detergent solution useful for permeabilizing cells and for creating a cytotoxicity chemistry positive control. Storage Conditions: Store at –20°C protected from light. ADCC Bioassays Product Size Cat.# ADCC Reporter Bioassay, Complete (Raji) 1 each G7015 ADCC Reporter Bioassay, Complete (WIL2-S) 1 each G7014 ADCC Reporter Bioassay, Core Kit 1 each G7010 ADCC Reporter Bioassay, Target (Raji) 1 each G7016 ADCC Reporter Bioassay, Target (WIL2-S) 1 each G7013 ADCC Reporter Bioassay, Core Kit 5X 1 each G7018 ADCC Bioassay Effector Cells, Propagation Model 1 each G7102 ADCC Reporter Bioassay, F Variant, Core Kit 1 each G9790 ADCC Reporter Bioassay, F Variant, Core Kit 5X 1 each G9798 ADCC Bioassay Effector Cells, F Variant, Propagation Model 1 each G9302 G7015, G7014, G7010, G7016, G7013, G7018 For Research Use Only. Not for Use in Diagnostic Procedures. G7102, G9790, G9798, G9302 Not For Medical Diagnostic Use. All products not available in all countries. For additional information see page 236. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 29 2Cell Health For complete and up-to-date product information visit: www.promega.com Inflammation Assay Caspase-Glo® 1 Inflammasome Assay Product Size Cat.# Caspase-Glo® 1 Inflammasome Assay 10 ml G9951 5 × 10 ml G9952 100 ml G9953 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Caspase-Glo® 1 Inflammasome Assay is a homogeneous, bioluminescent method to selectively measure the activity of caspase-1, a member of the cysteine aspartic acid-specific protease (caspase) family and an essential component of the inflammasome. Inflammasomes are protein complexes induced by diverse inflammatory stimuli. Innate immune cells respond to pathogens and other danger signals with inflammasome formation and conversion of procaspase-1 zymogen into catalytically active caspase-1. Caspase-1 activation results in: 1) the processing and release of cytokines IL-1β and IL-18 and 2) pyroptosis, an immunogenic form of cell death. The Caspase-Glo® 1 Inflammasome Assay provides a luminogenic caspase-1 substrate, Z-WEHD-aminoluciferin, in a lytic reagent optimized for caspase-1 activity and luciferase activity. A single addition of this reagent results in cell lysis, substrate cleavage by caspase-1 and generation of light by a proprietary, thermostable, recombinant luciferase (Ultra-Glo™ Recombinant Luciferase). The coupled-enzyme system reaches a steady-state between caspase cleavage of the substrate and luciferase conversion of aminoluciferin. These simultaneous reactions generate a stable luminescent signal, which is proportional to caspase activity. Inclusion of the proteasome inhibitor MG-132 in the reagent eliminates nonspecific proteasome-mediated cleavage of the substrate, enabling sensitive measurement of caspase-1 activity. Features: • Spend Minimal Hands-On Time: The assay measures caspase-1 activity directly in cells or medium from cultured cells in multiwell plates. No lysate preparation or multiple pipetting steps required. • Confirm Specific Activity: The selective caspase-1 substrate (Z-WEHD) and Inhibitor (MG-132) enable direct detection of caspase-1 activity in cells or culture media. The kit includes a caspase-1-specific inhibitor to confirm specific activity in parallel samples. • Perform Assay Quickly: No sample preparation or manipulation is required. Add the Caspase-Glo® 1 Reagent to wells and measure luminescence after only 1 hour. Less time and labor required compared to Western blot and ELISA. • Measure Only Catalytically Active Caspase-1: Functional and quantitative assay enables precise time courses of enzyme function. Western blots and ELISAs don’t necessarily monitor the active enzyme. • Expect Sensitivity: The assay provides the sensitivity required to measure caspase-1 activity directly in cells or medium in multiwell plates. • Enjoy Flexible Assay Setup: An equal volume of reagent is added to cell culture medium in sample wells, enabling easy scaling to different multiwell formats. • Use Batch Processing: The luminescent caspase-1 signal is stable in the Caspase-Glo® 1 Reagent (half-life >3 hours), allowing plates to be read over a few hours. There is no need to use a luminometer with reagent injectors. • Employ Assay Multiplexing: Caspase-1 activity can be monitored in culture medium, preserving the biological sample for use with other assays. In addition, same-well multiplexing can be performed with compatible assay chemistries (e.g., CellTox™ Green Cytotoxicity Assay). Storage Conditions: Store at –30°C to –10°C. Oxidative Stress Assays Mitochondrial Toxicity Assay Product Size Cat.# Mitochondrial ToxGlo™ Assay 10 ml G8000 100 ml G8001 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Mitochondrial ToxGlo™ Assay is a cell-based assay method that employs a sequential addition, multiplexed assay chemistry for predicting potential mitochondrial dysfunction as a result of xenobiotic exposure. The assay is based on the differential measurement of biomarkers associated with changes in cell membrane integrity and cellular ATP levels relative to vehicle-treated control cells during short exposure periods. Cell membrane integrity is first assessed by measuring the presence or absence of a distinct protease activity associated with necrosis using a fluorogenic peptide substrate (bis-AAF-R110) to measure “dead cell protease activity”. The bis-AAF-R110 Substrate cannot cross the intact membrane of live cells and therefore gives no signal with viable cells. Next, ATP is measured by adding an ATP detection reagent, resulting in cell lysis and generation of a luminescent signal proportional to the amount of ATP present. The two sets of data can be combined to produce profiles representative of mitochondrial dysfunction or non-mitochondrial related cytotoxic mechanisms. Mammalian cells generate ATP by mitochondrial (oxidative phosphorylation) and non-mitochondrial (glycolysis) methods. To achieve optimal mitochondrial responsiveness, it may be necessary to refine cell culture conditions. Replacing glucose-supplemented medium with galactose-containing medium may increase cellular oxygen consumption and augment mitochondrial susceptibility to mitotoxicants. Features: • Distinguish Primary Mitochondrial Dysfunction from Secondary Cytotoxic Events: Cell-based, multiplexed method measures ATP (a proximal measure of mitochondrial function) in conjunction with a membrane integrity biomarker to distinguish primary mitochondrial dysfunction from secondary cytotoxic events directly in the same sample well. • Predictive for Mitochondrial Toxicities: Produces profiles that are consistent with mitochondrial toxicity and discernible from other non-mitotoxic mechanisms of cell death. • Easy to Implement: The assay uses a simple sequential “add-mix-read” format. • Fast: Quickly assess potential mitochondrial liabilities in under an hour. • Cost-Effective: Assays are performed directly in cell culture plates using standard multimode detection instrumentation. • Flexible and Easily Automated: The volume of reagent addition can be scaled to meet throughput needs; the assay is amenable to automation in 96- and 384-well plates. Storage Conditions: Store the Mitochondrial ToxGlo™ Assay components at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 30 For complete and up-to-date product information visit: www.promega.com ROS-Glo™ H2 O2 Assay Product Size Cat.# ROS-Glo™ H2 O2 Assay 10 ml G8820 50 ml G8821 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ROS-Glo™ H2 O2 Assay is a homogeneous, fast and sensitive bioluminescent assay that measures the level of hydrogen peroxide (H2 O2 ), a reactive oxygen species (ROS), directly in cell culture or in defined enzyme reactions. A derivatized luciferin substrate is incubated with sample and reacts directly with H2 O2 to generate a luciferin precursor. Addition of ROS-Glo™ Detection Solution converts the precursor to luciferin and provides Ultra-Glo™ Recombinant Luciferase to produce light signal that is proportional to the level of H2 O2 present in the sample. Features: • Direct Cell-Based Detection: The assay can be performed in various cell culture media with or without serum, eliminating the need to remove the media from cultured cells before performing the assay. • Simple and Fast Assay: The homogeneous assay is performed following a simple two-reagent-addition protocol that does not require sample manipulation. The assay can be completed in less than 2 hours after reagent addition. • Non-HRP-Based Detection: The ROS-Glo™ H2 O2 Substrate reacts directly with H2 O2 , obviating the need for horseradish peroxidase (HRP) as a coupling enzyme and thus eliminating false hits associated with HRP inhibition. • Automation-Compatible Format: Easily scale from 96- to 384-well plate formats. • Flexible Assay: The assay can be used to screen compounds in both cell-based and enzyme-based formats. • Multiplex-Compatible System: Get more informative data per well and reduce cell culture expenses by multiplexing with a real-time cytotoxicity assay (CellTox™ Green Cytotoxicity Assay) in the same well or with a viability assay. Storage Conditions: Store all components at –30°C to –10°C. GSH/GSSG-Glo™ Assay Product Size Cat.# GSH/GSSG-Glo™ Assay 10 ml V6611 50 ml V6612 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GSH/GSSG-Glo™ Assay is a luminescence-based system for the detection and quantification of total glutathione (GSH +GSSG), GSSG and GSH/GSSG ratios in cultured cells. A change in GSH levels is important in the assessment of toxicological responses and is an indicator of oxidative stress, potentially leading to apoptosis or cell death. The assay provides a simple, rapid multiwell-plate format where stable luminescent signals are correlated with either the total GSH or the GSSG concentration of a sample directly in culture wells. Both total glutathione and GSSG determinations are based on the reaction where GSH-dependent conversion of a GSH probe, Luciferin-NT, to luciferin by a glutathione-S-transferase enzyme is coupled to a firefly luciferase reaction. Light from luciferase is dependent on the amount of luciferin formed, which is in turn dependent on the amount of GSH present. This makes the luminescent signal proportional to the amount of GSH. Determination of total glutathione and GSSG are performed in parallel reactions. In one configuration the assay reagents measure total glutathione using a reducing agent that converts all the glutathione, GSH and GSSG in a cell lysate to the reduced form, GSH. In a second configuration the assay reagents are used to measure only the oxidized form, GSSG. In this case, a reagent is added that blocks all the GSH while leaving the GSSG intact. This blocking step is followed by a reducing step that converts the GSSG to GSH for quantification in the luminescent reaction. Because the assays are performed directly on cells in culture wells, loss of GSH or GSSG is minimized, reducing variability. Features: • Physiologically Relevant GSH/GSSG Ratios: Actual levels of total glutathione and GSSG are measured directly in cell-culture wells, minimizing the loss of GSH and GSSG, compared to conventional assays that require upfront sample preparation and indirect GSSG calculation. • More Robust Performance: Bioluminescent technology and a simple protocol minimize sample handling, reducing variability. • Simplified Protocol: Assay reagents are added directly to cells cultured in multiwell plates. The homogeneous add-mix-read format eliminates time-consuming sample deproteination and centrifugation steps required of conventional assays. • Greater Sensitivity: Fewer cells are required in these assays than in conventional assays because of the enhanced sensitivity. • Faster Results: The homogeneous add-mix-read protocol minimizes handson time, and the bioluminescence technology minimizes incubation time. • Adaptable to Automation: The glow-type signal is stable, with a half-life greater than two hours, and the protocol is adaptable to automation in 96- and 384-well plates. • No Fluorescence Interference: Using luminescence readout eliminates the fluorescent interference between reagents and test compounds sometimes seen in fluorescence assays. Such overlap can confound analysis and present misleading or irrelevant data. Storage Conditions: Store at –20°C protected from light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 31 2Cell Health For complete and up-to-date product information visit: www.promega.com GSH-Glo™ Glutathione Assay Product Size Cat.# GSH-Glo™ Glutathione Assay 10 ml V6911 50 ml V6912 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GSH-Glo™ Assay is a luminescent-based assay for the detection and quantification of glutathione (GSH) in cells or in various biological samples. A change in GSH levels is important in assessment of toxicological responses and is an indicator of oxidative stress, potentially leading to apoptosis or cell death. The assay is based on the conversion of a luciferin derivative into luciferin in the presence of GSH. The reaction is catalyzed by a glutathione S-transferase (GST) enzyme supplied in the kit. The luciferin formed is detected in a coupled reaction using Ultra-Glo™ Recombinant Luciferase that generates a glow type luminescence that is proportional to the amount of glutathione present in cells. The assay provides a simple, fast and sensitive alternative to colorimetric and fluorescent methods and can be adapted easily to high-throughput applications. Features: • Fast: Results in as little as 30 minutes. • Simplified Method: The simple two-reagent-addition assay minimizes the number of assay steps compared to conventional GSH assays and is adapted easily to higher throughput applications. No deproteination step required! • Greater Sensitivity: The luminescent method avoids inherent background fluorescence associated with other methods thereby providing excellent signal-to-background ratios. • Stable Signal: Half-life greater than 5 hours. Storage Conditions: Store at –20°C protected from light. Griess Reagent System Product Size Cat.# Griess Reagent System 1,000 assays G2930 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Griess Reagent System measures nitrite (NO2 – ), which is one of two primary stable and nonvolatile breakdown products of nitric oxide (NO). Nitric oxide is an important physiological messenger and effector molecule in many biological systems, including immunological, neuronal and cardiovascular tissues. This assay relies on a diazotization reaction that was originally described by Griess in 1879. Through the years, many modifications to the original reaction have been described. The Griess Reagent System is based on a chemical reaction that uses sulfanilamide and N-1-naphthylethylenediamine dihydrochloride (NED) under acidic (phosphoric acid) conditions. This system detects NO2 – in a variety of biological and experimental liquid matrices such as plasma, serum, urine and tissue culture medium. The nitrite sensitivity is dependent on the matrix. The limit of detection is 2.5μM (125pmol) nitrite (in ultrapure, deionized, distilled water) using the protocol described in Technical Bulletin #TB229. Storage Conditions: Store at 4°C. Keep all solutions in their original light-protective plastic bottles. Table of Contents Section Contents Available in the Helix® on-site stocking system © 2020 Promega Corporation. All Rights Reserved. www.promega.com/CompareGloMax 33 3 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Cell Line and Sample Identification Cell Line Authentication 34 Mixed Sample Analysis 35 Cell Line and Sample Identification Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 34 For complete and up-to-date product information visit: www.promega.com Cell Line and Sample Identification Cell Health and Metabolism Cell Line Authentication GenePrint ® 10 System Product Size Cat.# GenePrint ® 10 System 50 reactions B9510 Available Separately Size Conc. Cat.# 2800M Control DNA 25 μl 10 ng/µl DD7101 Internal Lane Standard 600 150 μl DG1071 Water, Amplification Grade 6,250 μl DW0991 B9510, DD7101, DW0991 Not For Medical Diagnostic Use. DG1071 For Laboratory Use. Description: The GenePrint ® 10 System allows co-amplification and three-color detection of nine human loci, including the ASN-0002 loci (TH01, TPOX, vWA, Amelogenin, CSF1PO, D16S539, D7S820, D13S317 and D5S818) as well as D21S11. These loci collectively provide a genetic profile with a random match probability of 1 in 2.92 × 109 . The GenePrint ® 10 System is compatible with the ABI PRISM® 3100 and 3100-Avant Genetic Analyzers and Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. You may need to optimize protocols including the amount of template DNA, cycle number, injection conditions and loading volume for your laboratory instrumentation. The GenePrint ® 10 System contains all materials necessary to amplify STR regions of human genomic DNA, including a hot-start thermostable DNA polymerase, which is a component of the GenePrint ® 10 5X Master Mix. An internal lane standard (ILS) and allelic ladder are provided for standardization, and the 2800M Control DNA is supplied as a positive control. The ILS is added to every sample after amplification and used within each capillary electrophoresis run to determine the size of each amplified product. The allelic ladder consists of the most common alleles at a particular locus and is used as a standard to positively identify each allele. GenePrint ® 10 Allelic Ladder Mix information, including the size range and repeat numbers for each allele, can be found in the GenePrint® 10 System Technical Manual. The 2800M Control DNA has a known genotype and can be used to verify genotyping accuracy. Features: • Amplification of ANSI-0002-Recommended Loci (plus Amelogenin and D21S11 for extra power of discrimination): Accurately discriminate between biological samples and human cell lines. The resulting STR profiles are compatible with publicly available databases. Fewer loci simplify data interpretation. • Improved Buffer Formulation: Compatibility with direct amplification from FTA® and nonFTA cards saves labor and time and reduces manipulation and possible introduction of inhibitors or contaminants. • Tolerance of Higher DNA Template Input: Better balance for aneuploid samples. • Reduced PCR Time: Amplify in less than 1.5 hours. • One Complete Kit: Validated and quality-control tested for sample identification and cell line authentication. • Automatic Assignment of Genotypes: Panels and bins text files are required to automatically assign genotypes using the GeneMapper® ID and ID-X software and are available for download at: www.promega.com/ resources/tools/genemapper-id-software-panels-and-bin-sets/ Storage Conditions: Store at –20°C. Upon receipt, remove 2800M Control DNA and store at 4°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 35 3Cell Line and Sample Identification For complete and up-to-date product information visit: www.promega.com Mixed Sample Analysis GenePrint ® 24 System Product Size Cat.# GenePrint ® 24 System 100 reactions B1870 400 reactions B1874 Available Separately Size Conc. Cat.# WEN Internal Lane Standard 500 200 µl DG5001 GenePrint ® 5C Matrix Standard 5 preps B1930 Water, Amplification Grade 6,250 µl DW0991 2800M Control DNA 25 µl 10 ng/µl DD7101 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GenePrint ® 24 System is a 24-locus multiplex system designed to generate a multi-locus human DNA profile from a variety of human-derived biological sources. This five-color system allows coamplification and fluorescent detection of the following autosomal STR loci: CSF1PO, FGA, TH01, TPOX, vWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11, D10S1248, D22S1045, D2S441, D1S1656, D12S391, D2S1338, D19S433, Penta D and Penta E plus Amelogenin for gender determination. In addition, the male-specific DYS391 locus is included to identify null Y allele results for Amelogenin. The GenePrint ® 24 System is compatible with 2.5 to 5ng of extracted DNA samples and requires fewer PCR cycles in lower reaction volumes than previous STR systems. This is particularly important when optimal heterozygote balance is desired. The GenePrint ® 24 System is compatible with the Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Panels and bins text files are required for automatic assignment of genotypes using the GeneMapper® and GeneMarker® software and are available for download. Features: • Use Specialized Assay: STR assay specifically for DNA fingerprinting and mixed sample analysis with abundant source material. • Obtain Optimal Heterozygote Balance: Higher sample input for optimal heterozygote balance using up to 5ng of DNA template. • Take Advantage of High Power of Discrimination: Identify unique alleles to resolve complex mixtures from related individuals or multiple sources. • Employ Streamlined Workflow: Improve productivity with rapid cycling and more loci. • Simplify Validation: Simplify validation and continuity using loci in concordance with previously generated data. Storage Conditions: Store kit at –20°C. Upon receipt, move 2800M Control DNA and WEN ILS 500 to 4°C storage. GenePrint ® 5C Matrix Standard Product Size Cat.# GenePrint ® 5C Matrix Standard 5 preps B1930 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GenePrint ® 5C Matrix Standard allows the GenePrint ® 24 System to be analyzed on the Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Proper generation of a spectral calibration file is critical to evaluate multicolor systems. The GenePrint ® 5C Matrix Standard contains matrix fragments labeled with five fluorescent dyes: Fluorescein, JOE, TMR-ET, CXR-ET and CC5. Once generated, the spectral calibration file is applied during collection of PowerPlex® data to calculate and compensate for spectral overlap between different fluorescent dye colors. Storage Conditions: Store GenePrint ® 5C Matrix Standard at 4°C after the first use. The matrix standard is light-sensitive; therefore, minimize light exposure. Table of Contents Section Contents Available in the Helix® on-site stocking system Ask A Scientist Our worldwide technical support scientists have extensive lab experience and are available to answer all your questions about Promega products. Contact us via chat, telephone or email: techserv@promega.com Visit us online at: www.promega.com/Support Promega offers best-in-class technical support for scientists. Services Include: • Troubleshooting experiments • Training on Promega technologies • Supporting Promega technologies on automated systems © 2020 Promega Corporation. All Rights Reserved. 37 4 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Cell Signaling Glycobiology 38 GPCR Signaling Assays 39 Kinase Target Engagement 42 Kinase Activity Assays 44 Signaling Pathway Assays 50 Cell Signaling Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 38 For complete and up-to-date product information visit: www.promega.com Cell Signaling Cell Signaling Glycobiology GDP-Glo™ Glycosyltransferase Assay Product Size Cat.# GDP-Glo™ Glycosyltransferase Assay 200 assays VA1090 400 assays VA1091 4,000 assays VA1092 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GDP-Glo™ Glycosyltransferase Assay is a homogeneous, single-reagent-addition method to rapidly detect GDP formation in glycosyltransferase reactions. After the glycosyltransferase reaction, an equal volume of GDP Detection Reagent is added to simultaneously convert the GDP product to ATP and generate light in a luciferase reaction. The light generated is detected using a luminometer, and the light output is proportional to the concentration of GDP from low nM to 25μM. Luminescence can be correlated to GDP concentration by using a GDP standard curve. Features: • Easy, “add-incubate-read” protocol • Detects any glycosyltransferase that uses GDP-sugar as a substrate • Ideal for low-activity glycosyltransferases Storage Conditions: Store at less than –65°C. Alternatively, store GDP-Glo™ Enzyme at less than –65°C and the other components at –30°C to –10°C. UMP/CMP-Glo™ Glycosyltransferase Assay Product Size Cat.# UMP/CMP-Glo™ Glycosyltransferase Assay 200 assays VA1130 400 assays VA1131 4,000 assays VA1132 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The UMP/CMP-Glo™ Glycosyltransferase Assay is a homogeneous, single-reagent-addition method to rapidly detect UMP or CMP formation in glycosyltransferase reactions. After the glycosyltransferase reaction, an equal volume of UMP/CMP Detection Reagent is added to simultaneously convert the UMP or CMP product to ATP and generate light in a luciferase reaction. The light generated is detected using a luminometer, and the light output is proportional to the concentration of UMP or CMP from low nM to 50μM. Luminescence can be correlated to UMP or CMP concentration by using a UMP or CMP standard curve. Features: • Easy, “add-incubate-read” protocol • Detects sialyltransferases and phosphoglycosyltransferases that use CMP-, CDP- or UDP-sugars as donor substrates • Ideal for low-activity glycosyltransferases Storage Conditions: Store at less than –65°C. Alternatively, store UMP/CMP-Glo™ Enzyme at less than –65°C and the other components at –30°C to –10°C. Ultra Pure GDP-Sugar Substrates Product Size Cat.# Ultra Pure GDP-Fucose, 50mM 50µl VA1097 5 × 50µl VA1098 Ultra Pure GDP-Mannose, 100mM 50µl VA1099 5 × 50µl VA1100 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GDP-Fucose, 50mM, and GDP-Mannose, 100mM, are ultra pure GDP-sugar substrates designed for use with the GDP-Glo™ Glycosyltransferase Assay—a bioluminescent assay for detecting the activity of glycosyltransferases that use GDP-sugars as donor substrates. Glycosylation reactions catalyzed by glycosyltransferases are central to many biological processes, including cell:cell interactions, cell signaling and bacterial cell wall biosynthesis. Glycosyltransferases transfer sugar from a nucleotideglycosyl donor (e.g., GDP-Fucose and GDP-Mannose) to an acceptor molecule. In a glycosyltransferase reaction, the GDP moiety is released as a product; therefore, an assay that detects GDP can be used to monitor the activity of all the GDP-sugar-utilizing glycosyltransferases (e.g., Fucosyltransferases). Storage Conditions: Store at less than –65°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 39 4Cell Signaling For complete and up-to-date product information visit: www.promega.com GPCR Signaling Assays GTPase-Glo™ Assay Product Size Cat.# GTPase-Glo™ Assay 1,000 assays V7681 10,000 assays V7682 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GTPase-Glo™ Assay assesses the activities of GTPases, GAPs and GEFs, which are components of the GTPase cycle, by detecting the amount of GTP remaining after GTP hydrolysis in a GTPase reaction. The remaining GTP is converted to ATP using the GTPase-Glo™ Reagent, and the ATP is then detected using a proprietary thermostable luciferase (Ultra-Glo™ Recombinant Luciferase) and luciferin substrate to produce bioluminescence. The kit contains optimized reaction buffers, GTPase/GAP Buffer and GEF Buffer, for performing GTPase and GAP reactions and GEF reactions, respectively. These two buffers primarily differ in their Mg2+ content, which is critical for the nucleotide loading and unloading of the GTPase, thereby affecting the GTPase cycle. With the GTPase-Glo™ Assay, you can measure intrinsic GTPase activity, GAP-stimulated GTPase activity, GAP activity and GEF activity. GTPase, GAP and GEF activity is inversely correlated to the amount of light produced. A highly active GTPase hydrolyzes more GTP, reducing the amount of ATP produced from GTP and reducing light output. A less active GTPase hydrolyzes less GTP, leaving a larger amount of GTP to be converted to ATP and producing more light. Features: • Easily Monitor GTPase Activity: Simple add-and-read format. • Measure the Effects of Associated Proteins: Use to measure the effects of GEFs and GAPs, for example. • Produce Excellent Signal-to-Noise Ratios at Low Enzyme Concentrations: Sensitive assay with low background and large dynamic range. • Use Natural Substrates: No need to modify substrates, which can lead to kinetic artifacts. • Scale Your Assay: Suitable for 96-, 384- and 1536-well plates. • Rely on a Stable Luminescent Signal: Perform batch plate processing without need for strictly timed incubations; flexible. Storage Conditions: Store the GTPase-Glo™ Assay at –20°C, where it is stable for 6 months. Before use, thaw all components completely at room temperature and mix thoroughly. At first use, dispense the Detection Reagent into single-use aliquots and store at –20°C to minimize freeze-thaw cycles of the reagent. cAMP-Glo™ Assay Product Size Cat.# cAMP-Glo™ Assay 300 assays V1501 3,000 assays V1502 30,000 assays V1503 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The cAMP-Glo™ Assay is a homogeneous, bioluminescent and high-throughput assay for measuring cAMP levels in cells. The cAMP-Glo™ Assay monitors cAMP production in cells in response to the effects of test compounds on G protein-coupled receptors (GPCR). GPCRs that couple with adenylate cyclase will increase or decrease intracellular cAMP. The assay is based on the principle that cyclic AMP (cAMP) stimulates protein kinase A (PKA) holoenzyme activity, decreasing available ATP and leading to decreased light production in a coupled luciferase reaction. The cAMP-Glo™ Assay can be performed in 96-, 384- or 1536-well plates. The cells are induced with a test compound for an appropriate period of time to modulate cAMP levels. After induction, cells are lysed to release cAMP, then the cAMP detection solution, which contains protein kinase A, is added. The Kinase-Glo® Reagent is then added to terminate the PKA reaction and detect the remaining ATP via a luciferase reaction. Plates are read using a microplate-reading luminometer. Luminescence can be correlated to the cAMP concentrations by using a cAMP standard curve. The half-life for the luminescent signal is greater than 4 hours. This extended signal half-life eliminates the need for luminometers with reagent injectors and allows batch-mode processing of multiple plates. Features: Fast and Easy to Use: • Assay can be completed in approximately 45 minutes. • Homogeneous. • Two steps following lysis of cells. Excellent Signal-to-Noise Ratios: • Best signal:background ratio of all the cAMP assays. • Signal:Background >200 (with cAMP), >15 (on cells). • Easily scalable to 1536-well plate formats and beyond. Proven Luminescent Technology: • Powered by Ultra-Glo™ Recombinant Luciferase. • No interference by fluorescent compounds. • Non-radioactive. Storage Conditions: Store the system at –20°C. Once prepared, the cAMP detection solution (cAMP-Glo™ Reaction Buffer with Protein Kinase A) should not be frozen. Once prepared, the Kinase-Glo® Reagent should be dispensed into aliquots and stored at –20°C. See the product label for the expiration date. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 40 For complete and up-to-date product information visit: www.promega.com cAMP-Glo™ Max Assay Product Size Cat.# cAMP-Glo™ Max Assay 2 plates V1681 20 plates V1682 10 × 20 plates V1683 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The cAMP-Glo™ Max Assay is a homogeneous, bioluminescent and high-throughput assay to measure cyclic AMP (cAMP) levels in cells. Compounds that modulate GPCRs coupled with adenylate cyclase typically alter intracellular cAMP levels. The cAMP-Glo™ Max Assay monitors cAMP levels in cells in response to the effect of agonists, antagonists or test compounds on G protein-coupled receptors (GPCRs). The assay is based on the principle that cyclic AMP (cAMP) stimulates protein kinase A (PKA) holoenzyme activity, decreasing available ATP and leading to decreased light production in a coupled luciferase reaction. This improved version combines the lysis and cAMP reaction buffers into the cAMP-Glo™ ONE Buffer. This new format streamlines the protocol and reduces the time needed to complete the assay. The new ONE Buffer is supplied at a 5X concentration, which provides increased flexibility for starting cell culture volumes. The cAMP-Glo™ Max Assay can be performed in 96-, 384- or 1536-well plates. The cells are induced with a test compound for an appropriate period of time to modulate cAMP levels. After induction, cells are lysed, and the cAMP released stimulates protein kinase A in the reagent. The Kinase-Glo® Reagent is then added to terminate the PKA reaction and detect the remaining ATP via a luciferase reaction. Plates are read using a microplatereading luminometer. The half-life for the luminescent signal is greater than 4 hours providing ample time to read the plates and eliminating the need for luminometers with reagent injectors. Features: Fast and Easy to Use: • Improved—Lysis and cAMP detection steps combined (cAMP-Glo™ ONE Buffer). • ONE Buffer—5X concentration provides better flexibility for starting cell culture volumes. • Assay can be completed in approximately 30 minutes. Excellent Signal-to-Noise Ratios: • Best signal:background ratio of all the cAMP assays. • Signal:Background >200 (with cAMP), >15 (on cells). • Easily scalable to 1536-well plate formats and beyond. Proven Luminescent Technology: • Powered by Ultra-Glo™ Recombinant Luciferase. • No interference by fluorescent compounds. • Non-radioactive. Storage Conditions: Store the system at –20°C. Before use, completely thaw all components at room temperature, except for the Protein Kinase A, which should be kept on ice when not at –20°C. After thawing, mix all components thoroughly before use. Once prepared, the cAMP detection solution (cAMP-Glo™ ONE Buffer with Protein Kinase A) should not be frozen. Once prepared, the Kinase-Glo® Reagent should be dispensed into aliquots and stored at –20°C. See the product label for the expiration date. GloSensor™ cAMP Assay Product Size Cat.# pGloSensor™-22F cAMP Plasmid 20 μg E2301 pGloSensor™-20F cAMP Plasmid 20 μg E1171 GloSensor™ cAMP Reagent 25 mg E1290 250 mg E1291 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloSensor™ cAMP Assay presents a novel approach to measuring cAMP levels in live cells. cAMP is a key second messenger involved in signal transduction of GPCRs acting through Gα-s and Gα-i proteins. The new assay is based on the GloSensor™ Technology, a genetically modified form of firefly luciferase into which a cAMP-binding protein moiety has been inserted. Upon binding of cAMP, conformational change is induced leading to increased light output. This live-cell assay excels at kinetic and modulation studies of signaling through cAMP. Researchers can use the GloSensor™ cAMP Assay by transiently expressing a receptor of interest and the biosensor in the cell line of choice. Alternatively, stably transfected cell lines with both the biosensor and the receptor of interest can be made. The protocol is simple: Cells are pre-equilibrated with GloSensor™ cAMP Reagent for approximately 2 hours; then cells are treated with specific agonists/antagonists or compounds, and luminescence is measured after 10–30 minutes. No other reagent additions or manipulations are required. Most any common luminometer with injectors is sufficient to read the assay. GloSensor™ cAMP Reagent is required for use with this assay per the GloSensor™ Limited Use Label License. Choosing the Appropriate Plasmid We offer two variants of the biosensor, and we recommend the pGloSensor™-22F cAMP Plasmid as the first choice for most applications. pGloSensor™-22F cAMP Plasmid. Following cell-free expression in vitro, the version encoded by this construct shows an increased EC50 for activation together with increased signal-to-background ratio at cAMP saturation relative to the version encoded by the pGloSensor™-20F cAMP construct. In general, we have observed similar relationships between the two constructs when their performance is compared in living cells. pGloSensor™-20F cAMP Plasmid. The version encoded by this construct performs well in HEK293 cells at 37°C. Luminescence from the pGloSensor™-22F cAMP Plasmid construct can be more difficult to detect at physiologic temperatures. For a more thorough explanation of the general performance differences between the two plasmids, please consult Section 3.B, Recommendations on Choice of GloSensor™ Plasmid, in the Technical Manual (#TM076). Features: • Best-in-Class Performance: High Z´-factor values and large signal:background ratio values. Ideally suited to HTS/uHTS. Up to 1,000-fold changes in light output obtained. • Live-Cell, Nonlytic Assay Format: “Zero-step assay” greatly facilitates HTS/uHTS. Easy monitoring of cAMP in live cells enables a more complete analysis of receptor biology. • High Sensitivity and Increased Biological Relevance: Easy detection of low-abundance, endogenous receptors; direct detection of Gi-coupled receptor activation and inverse agonist activity in the absence of added forskolin. PDE inhibitors not needed. Storage Conditions: Store the pGloSensor™ cAMP Plasmid at –20°C and the GloSensor™ cAMP Reagent at –70°C. Store the resuspended GloSensor™ cAMP Reagent at –70°C in single-use aliquots. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 41 4Cell Signaling For complete and up-to-date product information visit: www.promega.com PDE-Glo™ Phosphodiesterase Assay Product Size Cat.# PDE-Glo™ Phosphodiesterase Assay 1,000 assays V1361 10,000 assays V1362 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PDE-Glo™ Phosphodiesterase Assay is a luminescent, high-throughput screening (HTS) method for measuring cyclic nucleotide phosphodiesterase activity from purified sources. Cyclic nucleotide phosphodiesterases (PDEs) are involved in a myriad of cellular processes due to their ability to hydrolyze, and thus control, the levels of the second-messenger signaling molecules cAMP and cGMP. The availability of selective inhibitors for PDEs has facilitated their use as tools to study cyclic nucleotide signaling and paved the way to investigate the role of PDEs in cellular and tissue pathologies. The PDE-Glo™ Phosphodiesterase Assay allows lead candidates to be identified from compound libraries. The assay is designed for 384-well plates, but assay volumes can easily be scaled for 96- or 1536-well plates. The PDE-Glo™ Phosphodiesterase Assay is optimized to work with both cAMP- and cGMP-dependent phosphodiesterases. The total time required for the assay from start to finish is less than 1 hour after the PDE reaction is complete. Features: Versatile: Works with both cAMP and cGMP PDEs. Sensitive: • Excellent signal:background ratios. • Scalable to 1536-well plate formats. Fast and Easy to Use: • Assay can be completed in <1 hour. • Homogeneous. Proven Luminescent Technology: • Powered by Ultra-Glo™ Luciferase. • Non-radioactive. No Interference by Fluorescent Compounds. Storage Conditions: Store the system at –20°C. See the product label for the expiration date. GloResponse™ Luciferase Reporter Cell Lines Product Size Cat.# GloResponse™ CRE-luc2P HEK293 Cell Line 2 vials E8500 GloResponse™ NFAT-RE-luc2P HEK293 Cell Line 2 vials E8510 GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line 2 vials E8520 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 92. GTPase-Glo™ Assay Product Size Cat.# GTPase-Glo™ Assay 1,000 assays V7681 10,000 assays V7682 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GTPase-Glo™ Assay assesses the activities of GTPases, GAPs and GEFs, which are components of the GTPase cycle, by detecting the amount of GTP remaining after GTP hydrolysis in a GTPase reaction. The remaining GTP is converted to ATP using the GTPase-Glo™ Reagent, and the ATP is then detected using a proprietary thermostable luciferase (Ultra-Glo™ Recombinant Luciferase) and luciferin substrate to produce bioluminescence. The kit contains optimized reaction buffers, GTPase/GAP Buffer and GEF Buffer, for performing GTPase and GAP reactions and GEF reactions, respectively. These two buffers primarily differ in their Mg2+ content, which is critical for the nucleotide loading and unloading of the GTPase, thereby affecting the GTPase cycle. With the GTPase-Glo™ Assay, you can measure intrinsic GTPase activity, GAP-stimulated GTPase activity, GAP activity and GEF activity. GTPase, GAP and GEF activity is inversely correlated to the amount of light produced. A highly active GTPase hydrolyzes more GTP, reducing the amount of ATP produced from GTP and reducing light output. A less active GTPase hydrolyzes less GTP, leaving a larger amount of GTP to be converted to ATP and producing more light. Features: • Easily Monitor GTPase Activity: Simple add-and-read format. • Measure the Effects of Associated Proteins: Use to measure the effects of GEFs and GAPs, for example. • Produce Excellent Signal-to-Noise Ratios at Low Enzyme Concentrations: Sensitive assay with low background and large dynamic range. • Use Natural Substrates: No need to modify substrates, which can lead to kinetic artifacts. • Scale Your Assay: Suitable for 96-, 384- and 1536-well plates. • Rely on a Stable Luminescent Signal: Perform batch plate processing without need for strictly timed incubations; flexible. Storage Conditions: Store the GTPase-Glo™ Assay at –20°C, where it is stable for 6 months. Before use, thaw all components completely at room temperature and mix thoroughly. At first use, dispense the Detection Reagent into single-use aliquots and store at –20°C to minimize freeze-thaw cycles of the reagent. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 42 For complete and up-to-date product information visit: www.promega.com Kinase Target Engagement NanoBRET™ TE Intracellular Kinase Assay Product Size Cat.# NanoBRET™ TE Intracellular Kinase Assay, K-4 100 assays N2520 1,000 assays N2521 NanoBRET™ TE Intracellular Kinase Detection Reagents, K-4 10,000 assays N2540 NanoBRET™ TE Intracellular Kinase Assay, K-5 100 assays N2500 1,000 assays N2501 NanoBRET™ TE Intracellular Kinase Detection Reagents, K-5 10,000 assays N2530 Intracellular TE Nano-Glo® Substrate/Inhibitor 1,000 assays N2160 10,000 assays N2161 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The NanoBRET™ Target Engagement (TE) Intracellular Kinase Assay measures compound binding at select target kinases in intact cells. The assay is based on the NanoBRET™ System, an energy transfer technique designed to measure molecular proximity in living cells. The NanoBRET™ TE Assay measures the apparent affinity of test compounds by competitive displacement of the NanoBRET™ tracer, reversibly bound to a NanoLuc® luciferase-kinase fusions in cells. Features: • Detect kinase target engagement in live cells • Choose from >125 kinase fusion vectors Storage Conditions: Store at less than –65°C. Alternatively, store NanoBRET™ Tracer at less than –65°C and all other components at less than –10°C. NanoBRET™ Tracer K-4-Compatible Kinase-NanoLuc® Fusion Vectors Product Size Cat.# NanoLuc®-ABL1 Fusion Vector 20μg NV1011 BMX-NanoLuc® Fusion Vector 20μg NV1101 CSF1R-NanoLuc® Fusion Vector 20μg NV1161 CSK-NanoLuc® Fusion Vector 20μg NV1171 DDR1-NanoLuc® Fusion Vector 20μg N2451 DDR2-NanoLuc® Fusion Vector 20μg NV1201 EPHA1-NanoLuc® Fusion Vector 20μg NV1221 EPHA2-NanoLuc® Fusion Vector 20μg NV1231 EPHA4-NanoLuc® Fusion Vector 20μg NV1241 EPHA5-NanoLuc® Fusion Vector 20μg NV1251 EPHA8-NanoLuc® Fusion Vector 20μg NV1281 EPHB2-NanoLuc® Fusion Vector 20μg NV1291 EPHB3-NanoLuc® Fusion Vector 20μg NV1301 EPHB4-NanoLuc® Fusion Vector 20μg NV1311 NanoLuc®-FGR Fusion Vector 20μg NV1381 FRK-NanoLuc® Fusion Vector 20μg NV1401 FYN-NanoLuc® Fusion Vector 20μg NV1411 KIT-NanoLuc® Fusion Vector 20μg NV1491 LCK-NanoLuc® Fusion Vector 20μg NV1521 LIMK2-NanoLuc® Fusion Vector 20μg NV1531 LYN-NanoLuc® Fusion Vector 20μg NV1551 NanoLuc®-MAPK11 Fusion Vector 20μg NV1651 MAPK14-NanoLuc® Fusion Vector 20μg NV1661 PTK6-NanoLuc® Fusion Vector 20μg NV1941 NanoLuc®-RIPK2 Fusion Vector 20μg NV1971 NanoLuc®-SIK1 Fusion Vector 20μg NV2031 NanoLuc®-SIK3 Fusion Vector 20μg NV2041 NanoLuc®-SNF1LK2 Fusion Vector 20μg NV2061 SRC-NanoLuc® Fusion Vector 20μg NV2071 NanoLuc®-TEC Fusion Vector 20μg NV2141 NanoLuc®-TESK1 Fusion Vector 20μg NV2161 TXK-NanoLuc® Fusion Vector 20μg NV2201 YES1-NanoLuc® Fusion Vector 20μg NV2241 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These NanoLuc® Fusion Vectors are designed for use with the NanoBRET™ Target Engagement (TE) Intracellular Kinase Assay, K-4, where the plasmid can be transfected into various cell lines for target engagement analysis. The NanoLuc® luciferase kinase fusion vectors are supplied transfection-ready. The CMV promoter drives the expression of the full-length NanoLuc® kinase fusion protein. Features: • Transfection-ready DNA to express full-length kinase of interest fused to NanoLuc® luciferase • Measures kinase target engagement in live cells • Use with NanoBRET™ TE Intracellular Kinase Assay, K-4 Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 43 4Cell Signaling For complete and up-to-date product information visit: www.promega.com NanoBRET™ Tracer K-5-Compatible Kinase-NanoLuc® Fusion Vectors Product Size Cat.# NanoLuc®-AAK1 Fusion Vector 20μg NV1001 ACVR1B-NanoLuc® Fusion Vector 20μg NV1021 AKT2-NanoLuc® Fusion Vector 20μg NV1031 AURKA-NanoLuc® Fusion Vector 20μg NV1041 AURKB-NanoLuc® Fusion Vector 20μg NV1051 AURKC-NanoLuc® Fusion Vector 20μg NV1061 AXL-NanoLuc® Fusion Vector 20μg NV1071 BTK-NanoLuc® Fusion Vector 20μg N2441 NanoLuc®-BMP2K Fusion Vector 20μg NV1091 NanoLuc®-BRSK2 Fusion Vector 20μg NV1111 CDK5-NanoLuc® Fusion Vector 20μg NV1121 NanoLuc®-CLK1 Fusion Vector 20μg NV1131 CLK2-NanoLuc® Fusion Vector 20μg NV1141 CLK4-NanoLuc® Fusion Vector 20μg NV1151 NanoLuc®-CSNK1G2 Fusion Vector 20μg NV1181 CSNK2A2-NanoLuc® Fusion Vector 20μg NV1191 NanoLuc®-DYRK1B Fusion Vector 20μg NV1211 EPHA6-NanoLuc® Fusion Vector 20μg NV1261 EPHA7-NanoLuc® Fusion Vector 20μg NV1271 ERN1-NanoLuc® Fusion Vector 20μg NV1321 FER-NanoLuc® Fusion Vector 20μg NV1331 FGFR1-NanoLuc® Fusion Vector 20μg NV1341 FGFR2-NanoLuc® Fusion Vector 20μg NV1351 FGFR3-NanoLuc® Fusion Vector 20μg NV1361 FGFR4-NanoLuc® Fusion Vector 20μg NV1371 FLT3-NanoLuc® Fusion Vector 20μg NV1391 NanoLuc®-GAK Fusion Vector 20μg NV1421 NanoLuc®-IKBKE Fusion Vector 20μg NV1431 NanoLuc®-IRAK3 Fusion Vector 20μg NV1441 IRAK4-NanoLuc® Fusion Vector 20μg NV1451 NanoLuc®-ITK Fusion Vector 20μg NV1461 JAK3-NanoLuc® Fusion Vector 20μg NV1471 JNK3-NanoLuc® Fusion Vector 20μg NV1481 LATS1-NanoLuc® Fusion Vector 20μg NV1501 LATS2-NanoLuc® Fusion Vector 20μg NV1511 LTK-NanoLuc® Fusion Vector 20μg NV1541 NanoLuc®-MAP3K10 Fusion Vector 20μg NV1561 NanoLuc®-MAP3K11 Fusion Vector 20μg NV1571 NanoLuc®-MAP3K12 Fusion Vector 20μg NV1581 MAP3K4-NanoLuc® Fusion Vector 20μg NV1591 NanoLuc®-MAP3K9 Fusion Vector 20μg NV1601 NanoLuc®-MAP4K1 Fusion Vector 20μg NV1611 NanoLuc®-MAP4K2 Fusion Vector 20μg NV1621 NanoLuc®-MAP4K3 Fusion Vector 20μg NV1631 NanoLuc®-MAPK1 Fusion Vector 20μg NV1641 NanoLuc®-MAPK3 Fusion Vector 20μg NV1671 NanoLuc®-MAPK4 Fusion Vector 20μg NV1681 NanoLuc®-MAPK6 Fusion Vector 20μg NV1691 NanoLuc®-MAPK8 Fusion Vector 20μg NV1701 NanoLuc®-MAPK9 Fusion Vector 20μg NV1711 NanoLuc®-MARK2 Fusion Vector 20μg NV1721 NanoLuc®-MARK4 Fusion Vector 20μg NV1731 NanoLuc®-MELK Fusion Vector 20μg NV1741 MET-NanoLuc® Fusion Vector 20μg NV1751 MUSK-NanoLuc® Fusion Vector 20μg NV1761 Product Size Cat.# MYLK2-NanoLuc® Fusion Vector 20μg NV1771 NanoLuc®-NEK2 Fusion Vector 20μg NV1781 NanoLuc®-NEK3 Fusion Vector 20μg NV1791 NanoLuc®-NEK9 Fusion Vector 20μg NV1801 NTRK1-NanoLuc® Fusion Vector 20μg NV1811 NTRK2-NanoLuc® Fusion Vector 20μg NV1821 NanoLuc®-NUAK1 Fusion Vector 20μg NV1831 PAK4-NanoLuc® Fusion Vector 20μg NV1841 PAK7-NanoLuc® Fusion Vector 20μg NV1851 NanoLuc®-PHKG1 Fusion Vector 20μg NV1861 PKMYT1-NanoLuc® Fusion Vector 20μg NV1871 NanoLuc®-PLK4 Fusion Vector 20μg NV1881 NanoLuc®-PRKAA2 Fusion Vector 20μg NV1891 PRKACA-NanoLuc® Fusion Vector 20μg NV1901 PRKX-NanoLuc® Fusion Vector 20μg NV1911 NanoLuc®-PTK2 Fusion Vector 20μg NV1921 PTK2B-NanoLuc® Fusion Vector 20μg NV1931 RET-NanoLuc® Fusion Vector 20μg NV1951 NanoLuc®-RIOK2 Fusion Vector 20μg NV1961 NanoLuc®-RPS6KA1 Fusion Vector 20μg NV1981 NanoLuc®-RPS6KA2 Fusion Vector 20μg NV1991 NanoLuc®-RPS6KA3 Fusion Vector 20μg NV2001 NanoLuc®-RPS6KA4 Fusion Vector 20μg NV2011 NanoLuc®-RPS6KA6 Fusion Vector 20μg NV2021 NanoLuc®-SLK Fusion Vector 20μg NV2051 NanoLuc®-STK11 Fusion Vector 20μg NV2081 NanoLuc®-STK16 Fusion Vector 20μg NV2091 NanoLuc®-STK32B Fusion Vector 20μg NV2101 NanoLuc®-STK33 Fusion Vector 20μg NV2111 STK38-NanoLuc® Fusion Vector 20μg NV2121 NanoLuc®-TBK1 Fusion Vector 20μg NV2131 TEK-NanoLuc® Fusion Vector 20μg NV2151 TIE1-NanoLuc® Fusion Vector 20μg NV2171 NanoLuc®-TNK1 Fusion Vector 20μg NV2181 TTK-NanoLuc® Fusion Vector 20μg NV2191 NanoLuc®-ULK1 Fusion Vector 20μg NV2211 NanoLuc®-ULK2 Fusion Vector 20μg NV2221 WEE1-NanoLuc® Fusion Vector 20μg NV2231 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These NanoLuc® Fusion Vectors are designed for use with the NanoBRET™ Target Engagement (TE) Intracellular Kinase Assay, K-5, where the plasmid can be transfected into various cell lines for target engagement analysis. The NanoLuc® luciferase kinase fusion vectors are supplied transfection-ready. The CMV promoter drives the expression of the full-length NanoLuc® kinase fusion protein. Features: • Transfection-ready DNA to express full-length kinase of interest fused to NanoLuc® luciferase • Measures kinase target engagement in live cells • Use with NanoBRET™ TE Intracellular Kinase Assay, K-5 Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 44 For complete and up-to-date product information visit: www.promega.com Kinase Activity Assays The Kinase Enzyme Systems allow you to easily screen and profile kinase inhibitors. They provide all the optimized components (enzyme, preferred substrate, required cofactors, buffer) that you need to generate a kinase selectivity profile for a compound. These sensitive and reliable kinase assays are easily scaled to meet your throughput needs. Select from over 370 Kinase Enzyme Systems spanning the breadth of the human kinome, including >100 mutant kinases. Visit: promega.com/kinome to learn more. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 45 4Cell Signaling For complete and up-to-date product information visit: www.promega.com Kinase Selectivity Profiling Systems Product Size Cat.# Kinase Selectivity Profiling System: TK-1 8 × 50 reactions V6850 Kinase Selectivity Profiling System: TK-1 + ADP-Glo™ Assay 8 × 50 reactions V6851 Kinase Selectivity Profiling System: TK-2 8 × 50 reactions V6852 Kinase Selectivity Profiling System: TK-2 + ADP-Glo™ Assay 8 × 50 reactions V6853 Kinase Selectivity Profiling System: TK-3 8 × 50 reactions V6920 Kinase Selectivity Profiling System: TK-3 + ADP-Glo™ Assay 8 × 50 reactions V6921 Kinase Selectivity Profiling System: TK-4 8 × 50 reactions V6922 Kinase Selectivity Profiling System: TK-4 + ADP-Glo™ Assay 8 × 50 reactions V6923 Kinase Selectivity Profiling System: CMGC-1 8 × 50 reactions V6854 Kinase Selectivity Profiling System: CMGC-1 + ADP-Glo™ Assay 8 × 50 reactions V6855 Kinase Selectivity Profiling System: CMGC-2 8 × 50 reactions V6856 Kinase Selectivity Profiling System: CMGC-2 + ADP-Glo™ Assay 8 × 50 reactions V6857 Kinase Selectivity Profiling System: AGC-1 8 × 50 reactions V6858 Kinase Selectivity Profiling System: AGC-1 + ADP-Glo™ Assay 8 × 50 reactions V6859 Kinase Selectivity Profiling System: AGC-2 8 × 50 reactions V6910 Kinase Selectivity Profiling System: AGC-2 + ADP-Glo™ Assay 8 × 50 reactions V6931 Kinase Selectivity Profiling System: CAMK-1 8 × 50 reactions V6932 Kinase Selectivity Profiling System: CAMK-1 + ADP-Glo™ Assay 8 × 50 reactions V6913 Kinase Selectivity Profiling System: CAMK-2 8 × 50 reactions V6924 Kinase Selectivity Profiling System: CAMK-2 + ADP-Glo™ Assay 8 × 50 reactions V6925 Kinase Selectivity Profiling System: TKL-1 8 × 50 reactions V6914 Kinase Selectivity Profiling System: TKL-1 + ADP-Glo™ Assay 8 × 50 reactions V6915 Kinase Selectivity Profiling System: STE-1 8 × 50 reactions V6916 Kinase Selectivity Profiling System: STE-1 + ADP-Glo™ Assay 8 × 50 reactions V6917 Kinase Selectivity Profiling System: Other/CK-1 8 × 50 reactions V6918 Kinase Selectivity Profiling System: Other/CK-1 + ADP-Glo™ Assay 8 × 50 reactions V6919 Kinase Selectivity Profiling System: Other-2 8 × 50 reactions V6926 Kinase Selectivity Profiling System: Other-2 + ADP-Glo™ Assay 8 × 50 reactions V6927 Kinase Selectivity Profiling System: General Panel 24 × 50 reactions V6928 Kinase Selectivity Profiling System: General Panel + ADP-Glo™ Assay 24 × 50 reactions V6929 V6850, V6851, V6852, V6920, V6922, V6854, V6856, V6858, V6910, V6931, V6932, V6913, V6924, V6914, V6916, V6918, V6926, V6928 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Kinase Selectivity Profiling Systems are easy-to-use kits for performing kinase selectivity profiling that rely on the ADP-Glo™ Kinase Assay technology. Each system includes kinase and substrate pairs organized in an easy-to-use, 8-tube strip format optimized for fast and simple kinase profiling reactions. Kinase Selectivity Profiling Systems offer kinases grouped either in single kinase family strips or as a general panel of kinases representative of the human kinome for a broad kinase profile. Each profiling system contains the reagents needed to complete a profile for a compound, including kinase reaction buffer, eight kinases in each multiwell strip and eight corresponding substrates and cofactors in another multiwell strip. The General Panel contains 24 kinases arranged in three 8-well strips. The kinase stock solutions are standardized in a way that, when kinases are diluted to the final concentration in the kinase reaction, the kinase activity will result in optimal ATP to ADP conversion in 5μl reactions (384-well plate), with a signal-to-background ratio of more than ten when used in conjunction with the ADP-Glo™ Kinase Assay (1). The substrate stock solutions are standardized in a similar fashion and provided in a second 8-tube strip with the substrates at corresponding positions. ADP-Glo™ Kinase Assay is a luminescent kinase assay that measures ADP formed from a kinase reaction; ADP is converted into ATP, which is converted into light by Ultra-Glo™ Luciferase. The luminescent signal positively correlates with ADP amount and kinase activity. The assay is well suited for measuring the effects chemical compounds have on the activity of a broad range of purified kinases—making it ideal for both primary screening as well as kinase selectivity profiling. The ADP-Glo™ Kinase Assay can be used to monitor the activity of virtually any ADP-generating enzyme (e.g., kinase or ATPase) using up to 1mM ATP. Features: • Fast Turnaround Time: Lead compounds can be profiled in-house in a matter of hours versus days when compounds are sent out. • Flexible Kinase Inhibitor Profiling: Each system has enough material to profile up to twenty compounds at a single dose or create a dose-response for two compounds against the eight kinases at once. • Fast and Simple Reaction Assembly: Two quick dilutions provide working stocks of kinases and substrate/cofactor solutions. • Optimized Kinase Activity for Inhibitor Profiling: All kinases have been optimized to provide 10–30% ADP production when assayed at 10µM ATP. • Formatted Strips Provide Access to Eight Kinases at One Time: Kinases from singular kinase families are grouped together for a more relevant selectivity profile. • Accurate: Accurately measure ADP levels at a wide range of starting ATP concentrations; activity measured truly reflects kinase activity and produces accurate IC50 values comparable to radioactivity-based assays. • Stable Luminescent Signal: Perform batch plate processing without need for strictly timed incubations; flexible. Storage Conditions: Store the Kinase Selectivity Profiling Systems below –65°C. Before use, thaw 5X Reaction Buffer A and 0.1M DTT at room temperature, and thaw the Substrate/Co-Factor Strip on ice. Immediately before use, thaw the Kinase Strip on ice, dilute and use immediately. After use, discard any remaining Kinase Working Stock and Substrate/Co-Factor Working Stock. Store any remaining 5X Reaction Buffer A and 0.1M DTT at –20°C for future use with the second Kinase Strip and Substrate/Co-Factor Strip. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 46 For complete and up-to-date product information visit: www.promega.com Lipid Kinase Assays and Reagents Product Size Cat.# PI3K-Glo™ Class I Profiling Kit 1 each V1690 ADP-Glo™ Kinase Assay with PI:3PS 1,000 assays V1781 10,000 assays V1782 ADP-Glo™ Kinase Assay with PIP2:3PS 1,000 assays V1791 10,000 assays V1792 Available Separately PI3K (p110α/p85α), 20µg 200 μl V1721 PI3K (p110α[E545K]/p85α), 20µg 200 μl V1731 PI3K (p110α[H1047R]/p85α), 20µg 200 μl V1741 PI3K (p110β/p85α), 20µg 200 μl V1751 PI3K (p120γ), 20µg 200 μl V1761 PI3K (p110δ/p85α), 20µg 200 μl V1771 PIP2:3PS Lipid Kinase Substrate, 0.25mg 0.25 ml V1701 PI:3PS Lipid Kinase Substrate, 0.5mg 0.5 ml V1711 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Phosphatidylinositol (PI) and its phosphorylated derivates, collectively called phosphoinositides, are important second messengers that are critical as signaling molecules and for cellular membrane remodeling. These derivatives are generated by a family of kinases called phosphoinositide lipid kinases (PIKs). Nineteen PIK isoforms have been identified in mammals. Based on their ability to preferentially phosphorylate the hydroxyl group of the inositol ring on position 3, 4 or 5, they have been broadly classified into three major families: phosphoinositide 3-kinases (PI3Ks), phosphoinositide 4-kinases (PI4Ks) and phosphoinositide phosphate-kinases (PIP5Ks and PIP4Ks). Promega lipid kinase enzymes, substrates and detection systems provide a complete set of reagents for performing phosphoinositide lipid kinase (PIK) reactions using a luminescent ADP-detection platform, the ADP-Glo™ Kinase Assay. The reagents include purified human recombinant proteins of Class I PI3Ks, optimized reaction buffer and ready-to-use lipid kinase substrates. The enzymes are available separately or can be purchased as part of the PI3K-Glo™ Class I Profiling Kit, which contains PI3Ks (α, β, γ and δ; 5μg each), PIP2:3PS Lipid Kinase Substrate (0.25mg) and the ADP-Glo™ Kinase Assay, 1,000 assays. The lipid substrates are supplied as frozen small unilamellar vesicles containing a mixture of phosphatidylinositol (PI) or phosphoinositol-4,5-bisphosphate (PIP2) at a 1:3 ratio with phosphatidylserine (PS) as carrier lipid. A substrate composed of PIP2 and PS at a 1:3 ratio was optimized to use with class I PI3Ks. A substrate composed of PI and PS at a 1:3 ratio was demonstrated to be recognized by the majority of family members and provides a universal PI lipid kinase substrate. The lipid kinase reaction is performed by incubating lipid substrate (PI:3PS or PIP2:3PS) with a recombinant enzyme and ATP, and the kinase activity is measured using the ADP-Glo™ Kinase Assay. The ADP-Glo™ Kinase Assay is performed in two steps. After the kinase reaction, an ATP-depletion reagent is added to terminate the lipid kinase reaction and deplete any remaining ATP, leaving only ADP. Next, a detection reagent is added to simultaneously convert ADP to ATP and allow the newly synthesized ATP to be converted to light using a coupled luciferase/luciferin reaction. Features: Employ Complete Solutions for Class I PI3Ks: • Purified human recombinant enzymes with high specific activity. • Ready-to-use lipid substrate (PI or PIP2). • Universal reaction buffer formulation. • Highly sensitive detection assay. Observe Excellent Selectivity: High signal-to-background ratios even at low % conversion of substrate. Obtain Reliable Results: The broad dynamic range, low background and excellent sensitivity result in less ambiguous data. Save Time: Homogeneous assay with simple “add-and-read” format. Avoid False Hits: The special formulation and luminescent signal results in low false-hit rate. Save Money: Easily scalable to 1,536-well format, reducing cost per well. Storage Conditions: Recombinant PI3K Enzymes: Store recombinant PI3K enzymes below –65°C. At first use, rapidly thaw and place on ice. Dispense any unused material into single-use aliquots and immediately snap-freeze the vials. Avoid multiple freeze-thaw cycles. Lipid Substrates: Store lipid substrates below –65°C. Before use, thaw at room temperature and allow substrate to equilibrate completely to room temperature. Mix extensively by vortexing for at least 1 minute. Thawed lipid substrates can be kept at room temperature (15–30°C) for at least 6 hours or stored at 2–10°C for one week.Buffers: Store 5X PI3K Reaction Buffer, 10X Lipid Dilution Buffer and 1M MgCl2 at –30°C to –10°C. ADP-Glo™ Kinase Assay: Upon receiving ADP-Glo™ Kinase Assay, remove ATP and store it below –65°C. Store the rest of the components at –30 to –10°C. Before use, thaw all components completely at room temperature. Once thawed, mix each component thoroughly before use. Because ATP is naturally prone to hydrolysis after freeze-thaw cycles, dispense into single-use aliquots and store below –65°C. Once thawed and prepared, dispense Kinase Detection Reagent (Kinase Detection Buffer + Substrate) and ADP-Glo™ Reagent into aliquots and store at –30 to –10°C. For convenience, both reagents may be used at room temperature for 24 hours without loss of signal. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 47 4Cell Signaling For complete and up-to-date product information visit: www.promega.com ADP-Glo™ Kinase Assay Product Size Cat.# ADP-Glo™ Kinase Assay 400 assays V6930 1,000 assays V9101 10,000 assays V9102 100,000 assays V9103 ADP-Glo™ Kinase Assay, Bulk Packaged 100,000 assays V9104 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ADP-Glo™ Kinase Assay is a luminescent kinase assay that measures ADP formed from a kinase reaction; ADP is converted into ATP, which is converted into light by Ultra-Glo™ Luciferase. The luminescent signal positively correlates with kinase activity. The assay is well suited for measuring the effects chemical compounds have on the activity of a broad range of purified kinases, making it ideal for both primary screening as well as kinase selectivity profiling. The ADP-Glo™ Kinase Assay can be used to monitor the activity of virtually any ADP-generating enzyme (e.g., kinase or ATPase) using up to 1mM ATP. The assay is performed in two steps; first, after the kinase reaction, an equal volume of ADP-Glo™ Reagent is added to terminate the kinase reaction and deplete the remaining ATP. In the second step, the Kinase Detection Reagent is added, which simultaneously converts ADP to ATP and allows the newly synthesized ATP to be measured using a coupled luciferase/luciferin reaction. The ADP-Glo™ Kinase Assay has a high dynamic range and produces a strong signal at low ATP to ADP conversion, making it well suited for screening low activity kinases such as growth factor receptor tyrosine kinases. The assay produces minimal false hits and Z´ values of greater than 0.8. Features: • High Signal Strength at Low ATP Conversion: Users can measure kinase activity that more closely mimics physiological conditions. This makes the assay very well suited for low-activity kinases such as receptor tyrosine kinases. • Sensitive: The assay is sensitive to low concentrations of ADP, thus requiring less enzyme than other assays; cost savings. • Universal: The assay can be used with virtually with any kinase—enables researchers to screen a wider range of kinases in-house, reducing dependency on costly outsourcing of kinase selectivity profiling. • Accurate: Accurately measures ADP levels at a wide range of starting ATP concentrations; users assured that activity measured truly reflects kinase activity and produces accurate IC50 values comparable to radioactivitybased assays. • Accommodate Wide Range of ATP Levels: The assay can be used at ATP concentrations up to 1mM, important for kinases with high Km values for ATP. • Stable Luminescent Signal: Users can perform batch plate processing without need for strictly timed incubations; flexible. Storage Conditions: Store the system at –20°C. Before use, thaw all reagents completely at room temperature. Once thawed, components should be thoroughly mixed before use. Once prepared, the Kinase Detection Reagent (Kinase Detection Buffer + Substrate) should be divided into aliquots and stored at –20°C. Kinase-Glo® Luminescent Kinase Assays Product Size Cat.# Kinase-Glo® Luminescent Kinase Assay 10 ml V6711 10 × 10 ml V6712 100 ml V6713 10 × 100 ml V6714 Kinase-Glo® Max Luminescent Kinase Assay 10 ml V6071 10 × 10 ml V6072 100 ml V6073 10 × 100 ml V6074 Kinase-Glo® Plus Luminescent Kinase Assay 10 ml V3771 10 × 10 ml V3772 100 ml V3773 10 × 100 ml V3774 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Kinase-Glo® Luminescent Kinase Assays are homogeneous non-radioactive methods for determining the activity of purified kinases by quantifying the amount of ATP remaining in solution following a kinase reaction. The assays are designed for use with multiwell plate formats, making them ideal for automated high-throughput screening (HTS), and they can be used to assay protein, lipid and sugar kinases. The assay procedure involves addition of a single reagent directly to a completed kinase reaction. This addition results in the generation of a luminescent signal correlated with the amount of ATP present and inversely proportional to the amount of kinase activity. The Kinase-Glo® Assays generate a “glow-type” luminescent signal produced using a patented stabilized luciferase (Ultra-Glo™ Luciferase) coupled with a proprietary buffer system. When assayed in the presence of kinase reaction buffers, such as the reaction buffer for PKA, the half-life of the luminescent output is greater than five hours, eliminating the need for luminometers with injectors and enabling batch plate processing. The assay produces excellent Z´-factor values of greater than 0.7 in 96- and 384-well formats, easily detects known kinase inhibitors and provides IC50 values comparable to those reported in the literature. The Kinase-Glo® Assay systems are differentiated by their linear response to ATP. The original Kinase-Glo® Assay is linear to 10μM ATP, while Kinase-Glo® Plus Assay is linear to 100μM ATP. The newest assay, Kinase-Glo® Max, is linear to 500μM ATP, making it well suited for use with kinases with high Km for ATP as well as for screening for kinase inhibitors that do not compete at the ATP binding site. Features: • Assay a Variety of Kinases: Can be used for a wide range of kinases (including lipid, sugar and alcohol kinases) and substrates (peptides, proteins, lipids, sugars and alcohols). • Obtain Reliable Results: Luminescence is much less susceptible to interference from library compounds than other luciferase-based ATP detection reagents. Z´-factor values greater than 0.7 in either 96- or 384-well plate formats. • Simplify Your Assay: Homogeneous—everything is performed in a single well. • Non-Radioactive: No radioactive waste disposal and safety issues. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ • Screen for Non-ATP Binding Site Inhibitors: Use ATP concentrations as high as 500μM (Kinase-Glo® Max Assay). Storage Conditions: Store at –20°C. Avoid multiple freeze-thaw cycles and exposure to frequent temperature changes. These fluctuations can greatly alter product stability. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 48 For complete and up-to-date product information visit: www.promega.com SAM2® Biotin Capture Membrane Product Size Cat.# SAM2® Biotin Capture Membrane 96 samples V2861 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The SAM2® Biotin Capture Membrane binds biotinylated molecules based on their affinity for streptavidin. The proprietary process by which the SAM2® Membrane is produced results in a high density of streptavidin on the filter, providing rapid, quantitative substrate binding in the nmol/cm2 range, depending upon the substrate used. In addition, the membrane is designed to minimize nonspecific binding. The membrane is available as a large, prenumbered, partially cut sheet (approximately 10.5 × 15.0cm. The partially cut membrane allows easy separation into 96 individual squares and is designed for small-scale experiments where high binding capacity is required. The membrane may be analyzed using phosphorimaging analysis, autoradiography or scintillation counting to quantitate results. The membrane was also used successfully with chemiluminescence detection techniques. The use of fluorescence for detection of captured molecules is not recommended at this time. Features: • Use a Variety of Substrates: Analysis of biotinylated substrates can be applied to a wide variety of substrate types without the need to optimize each substrate for binding to a matrix. The user can perform experiments with a wide array of sample numbers without changing the analysis technique, since the membrane is available as a 96-square (partially cut) sheet. • Minimize Nonspecific Binding: The combination of protein denaturant and high-salt washes minimizes nonspecific binding to the membrane without interfering with the high-affinity interaction between streptavidin and biotin. • Obtain High Signal-to-Noise Ratios: The stringent washing conditions employed assist in attaining very low background counts. • Perform Kinetic Studies: Membrane can linearly bind biotinylated substrates up to the nmol/cm2 range, allowing kinetic studies. • Strong Binding Reaction: Membrane retains the biotin conjugate over 8 logs of pH (pH 2–10), changes in temperature, organic solvents, ionic and nonionic detergents (SDS, CHAPS, Triton® X-100, Tween® 20 and Tween® 80) and denaturing agents (5M guanidine-HCl and 2M urea). • Rapid: Binds within 1 minute. • Convenient: Compatible with enzyme assays using radioactive detection. Membranes manufactured by this method have been shown to allow chemiluminescent detection. Storage Conditions: Store membranes at –20°C in resealable bag. SignaTECT® Protein Kinase Assay Systems Product Size Cat.# SignaTECT® Protein Kinase C (PKC) Assay System 96 reactions V7470 SignaTECT® Protein Tyrosine Kinase (PTK) Assay System 96 reactions V6480 SignaTECT® Calcium/Calmodulin-Dependent Protein Kinase (CaM KII) Assay System 96 reactions V8161 SignaTECT® DNA-Dependent Protein Kinase Assay System 96 reactions V7870 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The SignaTECT® Protein Kinase Assay Systems contain the proprietary SAM2® Biotin Capture Membrane, which offers significant advantages over other radioactive technologies for assaying protein kinases. The streptavidin-coated SAM2® Membranes possess high binding capacity and high specificity characteristics, which produce lower backgrounds and higher signal-to-noise ratios compared to the traditional P81 phosphocellulose method of capture and measurement. The perforated and numbered membrane allows researchers to measure from 1 up to 96 kinase reactions. The SAM2® Membrane format does not require as much “hands-on” manipulation as other methods used to measure kinase activity. Following the kinase reaction, samples are spotted onto the SAM2® Membrane, and a series of short wash steps are performed to remove nonspecific label. The process is complete in less than 1 hour. In addition, the nature of the SAM2® Membrane allows it to be used under a variety of buffer/reaction conditions (e.g., cell extracts), which many other methods do not allow. Lastly, the high binding capacity allows use of the SignaTECT® Systems for kinetic studies. Each system contains highly specific biotinylated peptide substrates for the appropriate kinase as well as the necessary reaction components. The researcher must supply [γ-32P]ATP. Storage Conditions: Store all SignaTECT® Systems except V7470 at –20°C. Store Cat.# V7470 at –70°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 49 4Cell Signaling For complete and up-to-date product information visit: www.promega.com PepTag® Non-Radioactive cAMP-Dependent Protein Kinase Assays Product Size Cat.# PepTag® Non-Radioactive cAMP-Dependent Protein Kinase Assay 120 reactions V5340 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PepTag® Non-Radioactive cAMP-Dependent Protein Kinase Assay System provides a rapid, sensitive and non-radioactive method to detect Protein Kinase A (PKA) activity. The PepTag® Assay uses brightly colored, fluorescent peptide substrates that are highly specific for PKA (PepTag® A1 Peptide-LRRASLG). Phosphorylation of the peptide alters the net charge from +1 to –1. This change in the net charge allows the phosphorylated and nonphosphorylated versions of the substrate to be rapidly separated on an agarose gel at neutral pH. Using fluorescent detection, less than 2ng of purified kinase can be detected in less than 2 hours. The PepTag® Non-Radioactive cAMP-Dependent Protein Kinase Assay System can detect kinase activity in partially purified samples as well as purified preparations of enzymes, making it a good choice for the rapid screening of column fractions or the screening of kinase activators and inhibitors. In addition to the assay components, the system includes purified kinase for use as a positive control. Features: • Non-Radioactive: The fluorescent tag on the peptide substrate facilitates quantitation of the phosphorylation reaction without the use of radioactivity. • Low Background: Because the phosphorylation of the colored peptide supplied with the system is used to measure kinase activity, phosphorylation of other substrates occurring naturally in the sample does not add to the kinase activity measured. • Convenient: Quantitation of the phosphorylated peptide can be accomplished using a densitometer, spectrophotometer, 96-well plate reader or fluorometer. Storage Conditions: Store at –70°C. cAMP-Dependent Protein Kinase, Catalytic Subunit Product Size Conc. Cat.# cAMP-Dependent Protein Kinase, Catalytic Subunit 2,500 u 1.5–3 mg/ml V5161 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The purified 40kDa cAMP-Dependent Protein Kinase (PKA), Catalytic Subunit, may be used to phosphorylate target proteins or for in vitro enzymological studies of neural and hormonal signal transduction. Intracellular targets include ion channels, transcriptional activator proteins, and regulatory enzymes of glycogen metabolism. Features: • Highly Pure: The PKA Catalytic Subunit has been purified from a recombinant E. coli strain expressing the catalytic subunit of bovine PKA and is 90% pure. Storage Conditions: Store at –70°C. DNA-Dependent Protein Kinase Product Size Cat.# DNA-Dependent Protein Kinase 2,500 u V5811 For Research Use Only. Not for Use in Diagnostic Procedures. Description: DNA-Dependent Protein Kinase (DNA-PK) phosphorylates several DNA-binding substrates in vitro, including the tumor suppressor protein p53, the SV40 large T antigen and several transcription factors. DNA-PK is thought to play a role in controlling gene regulation and cell growth. DNA-PK is isolated from HeLa nuclear extracts as a complex consisting of a 400kDa catalytic subunit and a 155kDa heterodimeric DNA-binding component named Ku, which itself consists of subunits of approximately 85kDa and 70kDa. Storage Conditions: Store at –70°C. Anti-ACTIVE® JNK pAb, Rabbit, (pTPpY) Product Size Cat.# Anti-ACTIVE® JNK pAb, Rabbit, (pTPpY) 40 μl V7931 120 μl V7932 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 69. Anti-ACTIVE® MAPK pAb, Rabbit, (pTEpY) Product Size Cat.# Anti-ACTIVE® MAPK pAb, Rabbit, (pTEpY) 40 μl V8031 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 69. Protein Kinase Inhibitors and Activators Product Size Cat.# MEK Inhibitor U0126 5 mg V1121 InCELLect™ AKAP St-Ht31 Inhibitor Peptide 150 μl V8211 InCELLect™ St-Ht31P Control Peptide 150 μl V8221 LY 294002 5 mg V1201 PMA 5 mg V1171 cGMP, 1mM 500 μl V6411 cAMP, 1mM 500 μl V6421 V1121, V8211, V8221, V1201, V1171 For Research Use Only. Not for Use in Diagnostic Procedures. V6411, V6421 For Laboratory Use. Protein Kinase Substrates Product Size Conc. Cat.# Kemptide (PKA) Peptide Substrate 1 mg 10 mg/ml V5601 DNA-Dependent Protein Kinase Peptide Substrate 1 mg 10 mg/ml V5671 For Research Use Only. Not for Use in Diagnostic Procedures. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 50 For complete and up-to-date product information visit: www.promega.com Signaling Pathway Assays UDP-Glo™ Glycosyltransferase Assay Product Size Cat.# UDP-Glo™ Glycosyltransferase Assay 200 assays V6961 400 assays V6962 4,000 assays V6963 UDP-Glo™ Glycosyltransferase Assay + UDP-GlcNAc 200 assays V6971 400 assays V6972 UDP-Glo™ Glycosyltransferase Assay + UDP-GalNAc 200 assays V6981 400 assays V6982 UDP-Glo™ Glycosyltransferase Assay + UDP-Glucose 200 assays V6991 400 assays V6992 UDP-Glo™ Glycosyltransferase Assay + UDP-Galactose 200 assays V7051 400 assays V7052 UDP-Glo™ Glycosyltransferase Assay + UDP-Glucuronic Acid (UDP-GA) 200 assays V7061 400 assays V7062 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The UDP-Glo™ Glycosyltransferase Assay is a bioluminescent assay for detecting the activity of glycosyltransferases that use UDP-sugars as donor substrates and release UDP as a product. Glycosylation reactions catalyzed by glycosyltransferases are central to many biological processes, including cell:cell interactions, cell signaling and bacterial cell wall biosynthesis. Glycosyltransferases transfer sugar from a nucleotide-glycosyl donor (e.g., UDP-Galactose, UDP-Glucose, UDP-GlcNAc, UDP-GalNAc and UDP-Glucuronic Acid) to an acceptor molecule. In a glycosyltransferase reaction, the UDP moiety is released as a product; therefore, an assay that detects UDP would be suitable for monitoring the activity of the majority of glycosyltransferases. The UDP-Glo™ Glycosyltransferase Assay is a homogeneous, singlereagent-addition method to rapidly detect UDP formation in glycosyltransferase reactions. After the glycosyltransferase reaction, an equal volume of UDP Detection Reagent is added to simultaneously convert the UDP product to ATP and generate light in a luciferase reaction. The light generated is detected using a luminometer. Luminescence can be correlated to UDP concentration by using an UDP standard curve. This assay is intended for use with purified glycosyltransferases that use UDP-sugar as a donor substrate and cannot be used with whole cells or cell extract. However, glycosyltransferases can be purified from cell extract using immunoprecipitation or affinity tag pull down then used in the UDP-Glo™ Glycosyltransferase Assay. Note: The UDP-Glo™ Glycosyltransferase Assay kits have changed from their original component configuration. The UDP-Glo™ Solution, a component of the original kits, was replaced with 1) UDP-Glo™ Enzyme and 2) Enzyme Dilution Buffer. The technical manual (#TM413) has instructions for preparing the UDP Detection Reagent. Also, note the change in the kit storage temperature from –20°C to less than –65°C. Features: • Universal Assay: Use any UDP-sugar-utilizing glycosyltransferase and glycosyltransferase:substrate combination, including peptide, protein, lipid and sugar substrates. • High Dynamic Range: High signal-to-background ratios at lower concentrations of UDP means using less enzyme during the glycosyltransferase reaction. • High Sensitivity: Detect 0.1–0.5pmol of UDP with a more than twofold difference over background. • Linear Response in the Nanomolar to Micromolar Range: Use low concentrations of UDP-sugar, decreasing feedback glycosyltransferase inhibition issues. • Reliable, Reproducible Data: Routinely obtain Z′ factor values >0.7 even with low UDP production rates. • Luminescence-Based UDP Detection: Experience less overall assay interference from chemical compounds. • Batch Plate Processing: Highly stable luminescent signal with >80% signal remaining after 3 hours. Storage Conditions: Store the UDP-Glo™ Glycosyltransferase Assay at less than –65°C or store UDP-Glo™ Enzyme at less than –65°C and the other components at –20°C. Before use, completely thaw all components at room temperature except the UDP-Glo™ Enzyme, which should be thawed only prior to use, returning any remaining volume to less than –65°C. Once thawed, all components should be thoroughly mixed before use. Any remaining Nucleotide Detection Reagent (Nucleotide Detection Buffer + ATP Detection Substrate) should be dispensed into aliquots and stored at less than –65°C. For best results, prepare only the amount of UDP Detection Reagent (Nucleotide Detection Reagent + UDP-Glo™ working solution) needed. If smaller amounts of UDP Detection Reagent are needed for each use, the UDP-Glo™ Solution should be dispensed into single-use aliquots and stored at less than –65°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 51 4Cell Signaling For complete and up-to-date product information visit: www.promega.com Ultra Pure UDP Sugar Substrates Product Size Cat.# Ultra Pure UDP-GlcNAc, 100 mM 50 μl V7071 5 × 50 μl V7072 Ultra Pure UDP-GalNAc, 100 mM 50 μl V7081 5 × 50 μl V7082 Ultra Pure UDP-Glucose, 100 mM 50 μl V7091 5 × 50 μl V7092 Ultra Pure UDP-Galactose, 100 mM 50 μl V7171 5 × 50 μl V7172 Ultra Pure UDP-Glucuronic Acid (UDP-GA), 100 mM 50 μl V7321 5 × 50 μl V7322 For Research Use Only. Not for Use in Diagnostic Procedures. Description: UDP-GlcNAc, UDP-GalNAc, UDP-Glucose, UDP-Galactose and UDP-Glucuronic Acid are ultra-pure UDP-sugar substrates designed for use with the UDP-Glo™ Glycosyltransferase Assay—a bioluminescent assay for detecting the activity of glycosyltransferases that use UDP-sugars as donor substrates. Glycosylation reactions catalyzed by glycosyltransferases are central to many biological processes, including cell:cell interactions, cell signaling and bacterial cell wall biosynthesis. Glycosyltransferases transfer sugar from a nucleotideglycosyl donor (e.g., UDP-Galactose, UDP-Glucose, UDP-GlcNAc, UDP-GalNAc and UDP-Glucuronic Acid) to an acceptor molecule. In a glycosyltransferase reaction, the UDP moiety is released as a product; therefore, an assay that detects UDP can be used to monitor the activity of the majority of glycosyltransferases. Storage Conditions: Store at less than –65°C. AMP-Glo™ Assay Product Size Cat.# AMP-Glo™ Assay 1,000 assays V5011 10,000 assays V5012 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The AMP-Glo™ Assay is a homogeneous assay that generates a luminescent signal from any biochemical reaction that produces AMP as a reaction product. This versatile system can measure the activity of a broad range of enzymes, such as cyclic AMP-specific phosphodiesterases, aminoacyl-tRNA synthetases, DNA ligases and ubiquitin ligases or enzymes modulated by AMP. The AMP-Glo™ Assay is designed to quantitatively monitor the concentration of AMP in a biochemical reaction in a wide range of plate formats, including high-throughput formats. The stable luminescent signal of the assay eliminates the need for an injector-equipped luminometer and enables batch-mode processing of multiple plates. The assay can be used to determine the AMP produced either in the presence or absence of ATP as a substrate. The assay contains two reagents: one to terminate the AMP-generating enzymatic reaction and simultaneously remove ATP and convert AMP produced into ADP, and a second reagent that converts the ADP to ATP followed by conversion of the ATP into a luminescent signal using the luciferin/luciferase reaction. The assay also is well suited for monitoring AMP produced in biochemical reactions catalyzed by enzymes that do not use ATP as a substrate, such as cAMP-dependent phosphodiesterases (PDE) and bacterial DNA ligases. The AMP-Glo™ Assay has a high dynamic range and produces a strong signal at low substrate conversion, making it well suited for screening low activity enzymes. The assay produces minimal false hits and Z´ values greater than 0.7. Features: • High Signal Strength at Low Substrate Conversion: Measure enzyme activity that more closely mimics physiological conditions—very well suited for low-activity enzymes. • Sensitive to Low Concentrations of AMP: Requires less enzyme than other assays; cost savings. • Universal: Use the assay with virtually with any AMP-producing enzyme— enables screening of a wider range of enzymes using a single platform. • Accurately Measures AMP Levels at a Wide Range of Starting Substrate Concentrations: Activity measured truly reflects enzyme activity and is well suited for measuring the effects of inhibitor on enzyme activity. • Luminescent Readout: Much less susceptible to interference from library compounds than fluorescent-based methods. Storage Conditions: Store the system at –30 to –10°C. Before use, thaw all components completely at room temperature, except for the AMP-Glo™ Reagent II, which should be kept on ice after thawing. Once thawed, mix all components thoroughly before use. Once prepared, the Kinase-Glo® One Solution should be dispensed into aliquots and stored at –20°C. See the product label for expiration date. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 52 For complete and up-to-date product information visit: www.promega.com ADP-Glo™ Max Assay Product Size Cat.# ADP-Glo™ Max Assay 1,000 assays V7001 10,000 assays V7002 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ADP-Glo™ Max Assay is a luminescent ADP detection assay that provides a universal, homogeneous, high-throughput screening method to measure ATPase or kinase activity by quantifying the amount of ADP produced in a reaction. The assay can be used to monitor the activity of virtually any ADP-generating enzyme (e.g., kinase or ATPase) when higher ATP concentration is required (up to 5mM). The ADP-Glo™ Max Assay produces a strong signal that positively correlates with enzyme activity and can be adapted to a multitude of plate formats. The assay is performed in two steps: first, after the completion of the ADP-producing reaction, an equal volume of ADP-Glo™ Reagent is added to terminate the reaction and deplete the remaining ATP. Second, the ADP-Glo™ Max Detection Reagent is added to simultaneously convert ADP to ATP, and the latter is converted to light in a coupled reaction with luciferase/luciferin. The ADP-Glo™ Max Assay has a high dynamic range and produces a strong signal at low ATP to ADP conversion, making it well suited for screening lowactivity ATPases such as drug membrane transporters and heat shock proteins. The assay produces minimal false hits and Z´ values of greater than 0.7. Features: • High Signal Strength at Low ATP Conversion: Users can measure enzyme activity that more closely mimics physiological conditions. This makes the assay very well suited for low-activity ATPases/kinases. • Sensitive: The assay is sensitive to low concentrations of ADP, thus requiring less enzyme than other assays; cost savings. • Universal: The assay can be used with virtually with any ADP-producing enzyme—enables researchers to screen a wider range of enzymes using a single platform. • Accommodate Wide Range of ATP Levels: The assay can be used at ATP concentrations up to 5mM, important for enzymes with high Km values for ATP and for mode of action studies. • Accurate: Accurately measures ADP levels at a wide range of starting ATP concentrations; users assured that activity measured truly reflects enzyme activity and produces accurate IC50s comparable to radioactivity-based assays. Storage Conditions: Store the system at –20°C. Before use, thaw all components completely at room temperature. Once thawed, mix all components thoroughly before use. Because ATP is naturally prone to hydrolysis after freeze-thaw cycles dispense into single-use aliquots and store at –20°C. Once prepared, dispense, ADP-Glo™ Max Detection Reagent (ADP-Glo™ Max Detection Buffer + Substrate) into aliquots and store at –20°C. ADP-Glo™ Max Detection Buffer may form a precipitate when thawed. See Section 3.A of the Technical Manual for a protocol to dissolve any precipitate. For convenience, ADP-Glo™ Reagent and ADP-Glo™ Max Detection Reagent may be kept at room temperature (22°C) for 24 hours without loss of signal. Non-Radioactive Phosphatase Assay Systems Product Size Cat.# Serine/Threonine Phosphatase Assay System 96 reactions V2460 Tyrosine Phosphatase Assay System 96 reactions V2471 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Non-Radioactive Phosphatase Assay Systems provide a fast, convenient and flexible alternative for measuring protein phosphatase activity. These systems determine the amount of free phosphate generated in a reaction by measuring the absorbance of a molybdate:malachite green:phosphate complex. These systems allow the use of a variety of buffer conditions and substrates, including naturally phosphorylated proteins or synthetic phosphopeptides. The Serine/Threonine Phosphatase Assay System contains the chemically synthesized phosphopetide, RRA(pT)VA, a peptide substrate that is compatible with several serine/threonine phosphatases such as the Protein Phosphatases 2A, 2B, and 2C. However the supplied phosphopeptide is a poor substrate for Protein Phosphatase 1 because of its more stringent structural requirements. The Tyrosine Phosphatase Assay System contains two chemically synthesized phosphopeptides, END(pY)INASL and DADE(pY)LIPQQG, that serve as substrates for many protein tyrosine phosphatases. The effective range for the detection of phosphate released during an assay using the Phosphatase Assay Systems is 100–4,000pmol of phosphate. In addition to measuring phosphatase activity in partially fractionated and purified samples, the Phosphatase Assay Systems can also measure phosphatase activity in crude cell or tissue extracts. For this application, the high concentration of phosphate in these preparations is eliminated prior to performing the assay using the supplied Spin Columns, which rapidly and effectively remove free phosphate and other low-molecular-weight inhibitors from the sample. In addition, a unique Molybdate Dye Additive that is combined with the Molybdate Dye Solution aids in the solubilization of proteins exposed to the acid conditions of the Molybdate Dye Solution, which alone could potentially cause precipitation of the proteins. Storage Conditions: Store the entire kit at 4°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 53 4Cell Signaling For complete and up-to-date product information visit: www.promega.com rhTNF-α Product Size Cat.# rhTNFα 10 μg G5241 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Tumor Necrosis Factor-α, Human, Recombinant (rhTNF-α), is a pleiotropic cytokine produced predominantly by activated monocytes/ macrophages. Biological effects of this molecule include induction of apoptosis, cytolysis or cytostasis of tumor cells, activation of polymorphonuclear leukocytes, antiviral activity and induction of IL-1 or colony-stimulating factor expression. rhTNF-α is a 17kDa protein containing 157 amino acid residues that is produced from a recombinant DNA expressed in E. coli. Nerve Growth Factor, 2.5S, Murine Product Size Cat.# mNGF, 2.5S 100 μg G5141 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Murine 2.5S Nerve Growth Factor (2.5S mNGF) mediates phosphorylation of specific intracellular proteins. Target cells of this molecule include sympathetic and sensory neurons and derivatives of nerve cells such as adrenal medulla pheochromocytoma (PC12) cells. 2.5S mNGF is a 26kDa protein composed of two identical 118 amino acid chains. Murine 2.5S Nerve Growth Factor is purified from male mouse submaxillary glands by the method of Bocchini and Angeletii. Activity: 2.5S mNGF exhibits an ED50 value below 2ng/ml using a PC-12 serum-free survival assay. Storage Conditions: Store lyophilized Murine 2.5S NGF desiccated at –20°C, where it is stable for at least six months from the date of purchase. Store reconstituted Murine 2.5S NGF in working aliquots at –20°C, where it is stable for up to 6 months. Avoid multiple freeze-thaw cycles. rhFGF, Basic Product Size Cat.# rhFGF, Basic 25 μg G5071 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Fibroblast Growth Factor, Basic, Human, Recombinant (rhFGF, Basic), is a 17.5kDa polypeptide containing 154 amino acids. It induces proliferation of multiple types of cells in vitro and demonstrates potent angiogenic activity in vivo. rhFGF, Basic, is produced from recombinant DNA expressed in E. coli. Epidermal Growth Factor, Human, Recombinant Product Size Cat.# rhEGF 100 μg G5021 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Epidermal Growth Factor, Human, Recombinant (rhEGF) is a 6.2kDa protein that is mitogenic for a variety of mammalian cell types. rhEGF is produced from recominbant DNA expressed in E. coli. Activity: rhEGF exhibits an ED50 value below 0.2ng/ml in the serum-free BALB/3T3 bioassay using the CellTiter 96® Non-Radioactive Cell Proliferation Assay. Storage Conditions: Store lyophilized product at –20°C. Rehydrated rhEGF is stable for 3 months at –20°C. Avoid repeated freeze-thaw cycles. When stored and handled properly, lyophilized rhEGF is stable for at least 6 months from the date of purchase. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 54 For complete and up-to-date product information visit: www.promega.com Nuclear Receptor Analysis Luciferase Vectors Product Size Cat.# pGL4.36[luc2P/MMTV/Hygro] Vector 20 μg E1360 pFN26A (BIND) hRluc-neo Flexi® Vector 20 μg E1380 pBIND-ERα Vector 20 μg E1390 pBIND-GR Vector 20 μg E1581 pGL4.35[luc2P/9XGAL4UAS/Hygro] Vector 20 μg E1370 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Nuclear receptor analysis can be performed with traditional means, using a minimal promoter vector with nuclear receptor response elements upstream. Alternatively, you can use viral elements like the mouse mammary tumor virus long terminal repeat promoter to judge androgen or glucocorticoid responses (e.g., pGL4.36). In many cases, use of these methods requires a cell line with the appropriate endogenous nuclear receptors, meaning you may need different cell lines for each nuclear receptor study. A method using the principles of the yeast two-hybrid system was adapted for nuclear receptor work. The nuclear receptor ligand binding domain is fused to the GAL4 DNA binding domain and transfected with a firefly luciferase vector containing repeats of the GAL4 upstream activation sequence upstream of a minimal promoter. The ligand binding domain is responsible for ligand binding, homo- or heterodimerization and interactions with co-activator or co-repressors. The one-hybrid method allows you work with any cell line and nuclear receptor you desire. Features: • Robust: GAL4-based system removes background signals from endogenous receptors. • More Sensitive: Optimized 9X Gal4 gives improved responses, better signal:noise ratio. • Adaptable: Combination Renilla/Neomycin marker allows normalization with Dual-Luciferase® Assay or selectable markers for generating stable cell lines, all with one vector. • Consistent: Compare or profile all nuclear receptors with a single experimental system. • Faster Results: Destabilized and optimized luc2P luciferase gene allows greater sensitivity and shorter induction times. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 55 5 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Energy Metabolism Metabolite Detection Assays 56 Oxidative Stress Assays 57 Nucleotide and Co-Factor Detection Assays 61 Energy Metabolism Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 56 For complete and up-to-date product information visit: www.promega.com Energy Metabolism Cloning and DNA Markers Metabolite Detection Assays Glucose-Glo™ Assay Product Size Cat.# Glucose-Glo™ Assay 5 ml J6021 50 ml J6022 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Glucose-Glo™ Assay is a bioluminescent assay for rapid and sensitive measurement of glucose from a variety of sample types. The bioluminescent signal eliminates signal interference that colorimetric and fluorescent glucose assays suffer, and there is no need for deproteinization sample preparation steps. The Glucose-Glo™ Assay is suitable for detecting altered glucose consumption due to changes in glycolysis or glucose production during gluconeogenesis. Features: • Measure glucose in a variety of sample types. • Limit of detection down to nM range. • Signal to background >1,000. Storage Conditions: Store complete kits at less than –65°C. Alternatively, store the Reductase Substrate at less than –65°C protected from light, and all other components at –30°C to –10°C. Do not freeze-thaw the kit components more than three times. Lactate-Glo™ Assay Product Size Cat.# Lactate-Glo™ Assay 5 ml J5021 50 ml J5022 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Lactate-Glo™ Assay is a bioluminescent assay for rapid, selective and sensitive detection of l-lactate in biological samples. Lactate is produced by glycolysis, a major metabolic pathway responsible for glucose homeostasis and energy production. Once considered merely a byproduct of glycolysis, lactate is now considered an important regulatory molecule of intermediate metabolism involved in cancer development, diabetes and other diseases. Features: • Perform in high-throughput workflows. • Multiplex with other metabolite or viability assays. • Linear range up to 200µM. Storage Conditions: Store complete kits at less than –65°C. Alternatively, store the Reductase Substrate at less than –65°C protected from light, and all other components at –30°C to –10°C. Do not freeze-thaw the kit components more than three times. Glutamate-Glo™ Assay Product Size Cat.# Glutamate-Glo™ Assay 5 ml J7021 50 ml J7022 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Glutamate is an important metabolite, serving as a precursor for the synthesis of nucleic acids, nucleotides and proteins. Glutamate is also a key neurotransmitter in nerve cells. Upregulated glutamate production is used as a marker of increased cancer cell dependence on glutaminolysis to support high proliferation rates. The Glutamate-Glo™ Assay is a suitable assay for measuring changes in glutamate levels in a variety of samples, and the assay is sensitive enough to detect even intracellular amounts of glutamate. Features: • Amenable to high-throughput formats. • Detect even intracellular levels of glutamate. • Limit of detection in the nM range. Storage Conditions: Store complete kits at less than –65°C. Alternatively, store the Reductase Substrate at less than –65°C protected from light, and all other components at –30°C to –10°C. Do not freeze-thaw the kit components more than three times. Glutamine/Glutamate-Glo™ Assay Product Size Cat.# Glutamine/Glutamate-Glo™ Assay 5 ml J8021 50 ml J8022 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Glutamine/Glutamate-Glo™ Assay is a bioluminescent assay for the rapid and sensitive measurement of glutamine and glutamate from a variety of sample types. The bioluminescent signal eliminates signal interference that colorimetric and fluorescent assays suffer. Both glutamine and glutamate are measured from the sample; no separate assay is needed. Features: • Detect even small changes in metabolites. • Multiplex with other metabolite or viability assays. • Perform on a variety of sample types. Storage Conditions: Store complete kits at less than –65°C. Alternatively, store the Reductase Substrate at less than –65°C protected from light, and all other components at –30°C to –10°C. Do not freeze-thaw the kit components more than three times. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 57 5Energy Metabolism For complete and up-to-date product information visit: www.promega.com Glucose Uptake-Glo™ Assay Product Size Cat.# Glucose Uptake-Glo™ Assay 5 ml J1341 10 ml J1342 50 ml J1343 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Glucose Uptake-Glo™ Assay is a non-radioactive, platebased, homogeneous bioluminescent method for measuring glucose uptake in mammalian cells based on the detection of 2-deoxyglucose-6-phosphate (2DG6P). When 2-deoxyglucose (2DG) is added to cells, it is transported across the membrane and rapidly phosphorylated in the same manner as glucose. However, enzymes that further modify glucose-6-phosphate (G6P) cannot modify 2DG6P, and thus this membrane-impermeable analyte accumulates in the cell. After a brief period of incubation, an acid detergent solution (Stop Buffer) is added to lyse cells, terminate uptake and destroy any NADPH within the cells. A high-pH buffer solution (Neutralization Buffer) is then added to neutralize the acid. A Detection Reagent containing glucose-6-phosphate dehydrogenase (G6PDH), NADP+, Reductase, Ultra-Glo™ Recombinant Luciferase and proluciferin substrate is added to the sample wells. G6PDH oxidizes 2DG6P to 6-phosphodeoxygluconate and simultaneously reduces NADP+ to NADPH. The Reductase uses NADPH to convert the proluciferin to luciferin, which is then used by Ultra-Glo™ Recombinant Luciferase to produce a luminescent signal that is proportional to the concentration of 2DG6P. Features: • Use a Non-Radioactive Assay: The assay is based on the same principal as the radioactive approach, but no radioactivity is required. • Follow a Simple and Homogeneous Protocol: After addition of 2DG, there are no wash steps—all steps are additions. • Achieve Sensitivity with Broad Linearity: The Glucose Uptake-Glo™ Assay can detect 0.5 to 30µM 2DG6P and generates a signal-tobackground ratio >3 with as few as 5,000 cells. • Automate your Workflow: The add-and-read format is compatible with automated and high-throughput workflow; reactions are scalable for use in 96- and 384-well plates. • Get Reliable and Reproducible Results: The Glucose Uptake-Glo™ Assay yields Z′ factors >0.5. Storage Conditions: Store at –30°C to –10°C. Oxidative Stress Assays ROS-Glo™ H2 O2 Assay Product Size Cat.# ROS-Glo™ H2 O2 Assay 10 ml G8820 50 ml G8821 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ROS-Glo™ H2 O2 Assay is a homogeneous, fast and sensitive bioluminescent assay that measures the level of hydrogen peroxide (H2 O2 ), a reactive oxygen species (ROS), directly in cell culture or in defined enzyme reactions. A derivatized luciferin substrate is incubated with sample and reacts directly with H2 O2 to generate a luciferin precursor. Addition of ROS-Glo™ Detection Solution converts the precursor to luciferin and provides Ultra-Glo™ Recombinant Luciferase to produce light signal that is proportional to the level of H2 O2 present in the sample. Features: • Direct Cell-Based Detection: The assay can be performed in various cell culture media with or without serum, eliminating the need to remove the media from cultured cells before performing the assay. • Simple and Fast Assay: The homogeneous assay is performed following a simple two-reagent-addition protocol that does not require sample manipulation. The assay can be completed in less than 2 hours after reagent addition. • Non-HRP-Based Detection: The ROS-Glo™ H2 O2 Substrate reacts directly with H2 O2 , obviating the need for horseradish peroxidase (HRP) as a coupling enzyme and thus eliminating false hits associated with HRP inhibition. • Automation-Compatible Format: Easily scale from 96- to 384-well plate formats. • Flexible Assay: The assay can be used to screen compounds in both cell-based and enzyme-based formats. • Multiplex-Compatible System: Get more informative data per well and reduce cell culture expenses by multiplexing with a real-time cytotoxicity assay (CellTox™ Green Cytotoxicity Assay) in the same well or with a viability assay. Storage Conditions: Store all components at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 58 For complete and up-to-date product information visit: www.promega.com GSH/GSSG-Glo™ Assay Product Size Cat.# GSH/GSSG-Glo™ Assay 10 ml V6611 50 ml V6612 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GSH/GSSG-Glo™ Assay is a luminescence-based system for the detection and quantification of total glutathione (GSH +GSSG), GSSG and GSH/GSSG ratios in cultured cells. A change in GSH levels is important in the assessment of toxicological responses and is an indicator of oxidative stress, potentially leading to apoptosis or cell death. The assay provides a simple, rapid multiwell-plate format where stable luminescent signals are correlated with either the total GSH or the GSSG concentration of a sample directly in culture wells. Both total glutathione and GSSG determinations are based on the reaction where GSH-dependent conversion of a GSH probe, Luciferin-NT, to luciferin by a glutathione-S-transferase enzyme is coupled to a firefly luciferase reaction. Light from luciferase is dependent on the amount of luciferin formed, which is in turn dependent on the amount of GSH present. This makes the luminescent signal proportional to the amount of GSH. Determination of total glutathione and GSSG are performed in parallel reactions. In one configuration the assay reagents measure total glutathione using a reducing agent that converts all the glutathione, GSH and GSSG in a cell lysate to the reduced form, GSH. In a second configuration the assay reagents are used to measure only the oxidized form, GSSG. In this case, a reagent is added that blocks all the GSH while leaving the GSSG intact. This blocking step is followed by a reducing step that converts the GSSG to GSH for quantification in the luminescent reaction. Because the assays are performed directly on cells in culture wells, loss of GSH or GSSG is minimized, reducing variability. Features: • Physiologically Relevant GSH/GSSG Ratios: Actual levels of total glutathione and GSSG are measured directly in cell-culture wells, minimizing the loss of GSH and GSSG, compared to conventional assays that require upfront sample preparation and indirect GSSG calculation. • More Robust Performance: Bioluminescent technology and a simple protocol minimize sample handling, reducing variability. • Simplified Protocol: Assay reagents are added directly to cells cultured in multiwell plates. The homogeneous add-mix-read format eliminates time-consuming sample deproteination and centrifugation steps required of conventional assays. • Greater Sensitivity: Fewer cells are required in these assays than in conventional assays because of the enhanced sensitivity. • Faster Results: The homogeneous add-mix-read protocol minimizes handson time, and the bioluminescence technology minimizes incubation time. • Adaptable to Automation: The glow-type signal is stable, with a half-life greater than two hours, and the protocol is adaptable to automation in 96- and 384-well plates. • No Fluorescence Interference: Using luminescence readout eliminates the fluorescent interference between reagents and test compounds sometimes seen in fluorescence assays. Such overlap can confound analysis and present misleading or irrelevant data. Storage Conditions: Store at –20°C protected from light. GSH-Glo™ Glutathione Assay Product Size Cat.# GSH-Glo™ Glutathione Assay 10 ml V6911 50 ml V6912 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GSH-Glo™ Assay is a luminescent-based assay for the detection and quantification of glutathione (GSH) in cells or in various biological samples. A change in GSH levels is important in assessment of toxicological responses and is an indicator of oxidative stress, potentially leading to apoptosis or cell death. The assay is based on the conversion of a luciferin derivative into luciferin in the presence of GSH. The reaction is catalyzed by a glutathione S-transferase (GST) enzyme supplied in the kit. The luciferin formed is detected in a coupled reaction using Ultra-Glo™ Recombinant Luciferase that generates a glow type luminescence that is proportional to the amount of glutathione present in cells. The assay provides a simple, fast and sensitive alternative to colorimetric and fluorescent methods and can be adapted easily to high-throughput applications. Features: • Fast: Results in as little as 30 minutes. • Simplified Method: The simple two-reagent-addition assay minimizes the number of assay steps compared to conventional GSH assays and is adapted easily to higher throughput applications. No deproteination step required! • Greater Sensitivity: The luminescent method avoids inherent background fluorescence associated with other methods thereby providing excellent signal-to-background ratios. • Stable Signal: Half-life greater than 5 hours. Storage Conditions: Store at –20°C protected from light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 59 5Energy Metabolism For complete and up-to-date product information visit: www.promega.com Signaling Pathway Analysis (Minimal PromoterDriven) Firefly Luciferase Vectors Product Size Cat.# pGL4.37[luc2P/ARE/Hygro] Vector 20 μg E3641 pGL4.38[luc2P/p53 RE/Hygro] Vector 20 μg E3651 pGL4.39[luc2P/ATF6 RE/Hygro] Vector 20 μg E3661 pGL4.40[luc2P/MRE/Hygro] Vector 20 μg E4131 pGL4.41[luc2P/HSE/Hygro] Vector 20 μg E3751 pGL4.42[luc2P/HRE/Hygro] Vector 20 μg E4001 pGL4.43[luc2P/XRE/Hygro] Vector 20 μg E4121 pGL4.44[luc2P/AP1 RE/Hygro] Vector 20 μg E4111 pGL4.45[luc2P/ISRE/Hygro] Vector 20 μg E4141 pGL4.47[luc2P/SIE/Hygro] Vector 20 μg E4041 pGL4.48[luc2P/SBE/Hygro] Vector 20 μg E3671 pGL4.49[luc2P/TCF-LEF RE/Hygro] Vector 20 μg E4611 pGL4.52[luc2P/STAT5RE/Hygro] Vector 20 μg E4651 pGL4.29[luc2P/CRE/Hygro] Vector 20 μg E8471 pGL4.30[luc2P/NFAT-RE/Hygro] Vector 20 μg E8481 pGL4.32[luc2P/NF-κB-RE/Hygro] Vector 20 μg E8491 pGL4.33[luc2P/SRE/Hygro] Vector 20 μg E1340 pGL4.34[luc2P/SRF-RE/Hygro] Vector 20 μg E1350 Available Separately pGL4.23[luc2/minP] Vector 20 μg E8411 pGL4.24[luc2P/minP] Vector 20 μg E8421 GloResponse™ NFAT-RE-luc2P HEK293 Cell Line 2 vials E8510 GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line 2 vials E8520 pGL4.25[luc2CP/minP] Vector 20 μg E8431 pGL4.26[luc2/minP/Hygro] Vector 20 μg E8441 pGL4.27[luc2P/minP/Hygro] Vector 20 μg E8451 pGL4.28[luc2CP/minP/Hygro] Vector 20 μg E8461 GloResponse™ CRE-luc2P HEK293 Cell Line 2 vials E8500 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Creating a cell line with an indicator of a functional signaling pathway is useful for deciphering the components in a signaling pathway. These tools are made by insertion of multiple repeats of a response element upstream of a minimal promoter (minP). Promega has designed vectors that report the activity of a variety of pathways using the optimized luc2 firefly luciferase gene in the pGL4 backbone. These vectors also have a hygromycin resistance selectable marker, allowing use either in transient transfection experiments or for selection of a stable cell line. Also available for construction of pathway reporters are minimal promoter (minP) vectors with three varieties of engineered firefly luciferase genes: luc2, luc2P or luc2CP. The luc2 gene is engineered to remove most cryptic transcription factor binding sites and improve mammalian expression through codon optimization. The luc2P and luc2CP and RapidResponse™ genes are luc2 genes appended with degradation sequences to influence the cellular half-life of the luc2 gene. The RapidResponse™ genes respond more rapidly to stimuli but at the expense of signal intensity. The luc2P (1-hour half-life) gene responds more rapidly than luc2 (3-hour half-life) with moderate signal intensity, and the luc2CP (0.4-hour half-life) responds more quickly with the lowest signal intensity. The minP vectors are available with or without selectable markers (hygromycin). To speed research, several pre-designed response element vectors are available already assembled in the pGL4.27 Vector. Some of these also are available stable cell lines (GloResponse™ Cell Lines). Features: • Pre-designed vectors remove the need to clone and validate an assay. • Increased Reporter Gene Expression: Codon optimization of synthetic genes for mammalian expression. • Reduced Background and Risk of Expression Artifacts: Removal of cryptic DNA regulatory elements and transcription factor binding sites. • Improved Temporal Response: Rapid Response™ technology using destabilized luciferase genes. • Easy Transition from Transient to Stable Cells: Choice of mammalian selectable markers. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 60 For complete and up-to-date product information visit: www.promega.com Mitochondrial Toxicity Assay Product Size Cat.# Mitochondrial ToxGlo™ Assay 10 ml G8000 100 ml G8001 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Mitochondrial ToxGlo™ Assay is a cell-based assay method that employs a sequential addition, multiplexed assay chemistry for predicting potential mitochondrial dysfunction as a result of xenobiotic exposure. The assay is based on the differential measurement of biomarkers associated with changes in cell membrane integrity and cellular ATP levels relative to vehicle-treated control cells during short exposure periods. Cell membrane integrity is first assessed by measuring the presence or absence of a distinct protease activity associated with necrosis using a fluorogenic peptide substrate (bis-AAF-R110) to measure “dead cell protease activity”. The bis-AAF-R110 Substrate cannot cross the intact membrane of live cells and therefore gives no signal with viable cells. Next, ATP is measured by adding an ATP detection reagent, resulting in cell lysis and generation of a luminescent signal proportional to the amount of ATP present. The two sets of data can be combined to produce profiles representative of mitochondrial dysfunction or non-mitochondrial related cytotoxic mechanisms. Mammalian cells generate ATP by mitochondrial (oxidative phosphorylation) and non-mitochondrial (glycolysis) methods. To achieve optimal mitochondrial responsiveness, it may be necessary to refine cell culture conditions. Replacing glucose-supplemented medium with galactose-containing medium may increase cellular oxygen consumption and augment mitochondrial susceptibility to mitotoxicants. Features: • Distinguish Primary Mitochondrial Dysfunction from Secondary Cytotoxic Events: Cell-based, multiplexed method measures ATP (a proximal measure of mitochondrial function) in conjunction with a membrane integrity biomarker to distinguish primary mitochondrial dysfunction from secondary cytotoxic events directly in the same sample well. • Predictive for Mitochondrial Toxicities: Produces profiles that are consistent with mitochondrial toxicity and discernible from other non-mitotoxic mechanisms of cell death. • Easy to Implement: The assay uses a simple sequential “add-mix-read” format. • Fast: Quickly assess potential mitochondrial liabilities in under an hour. • Cost-Effective: Assays are performed directly in cell culture plates using standard multimode detection instrumentation. • Flexible and Easily Automated: The volume of reagent addition can be scaled to meet throughput needs; the assay is amenable to automation in 96- and 384-well plates. Storage Conditions: Store the Mitochondrial ToxGlo™ Assay components at –20°C. Griess Reagent System Product Size Cat.# Griess Reagent System 1,000 assays G2930 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Griess Reagent System measures nitrite (NO2 – ), which is one of two primary stable and nonvolatile breakdown products of nitric oxide (NO). Nitric oxide is an important physiological messenger and effector molecule in many biological systems, including immunological, neuronal and cardiovascular tissues. This assay relies on a diazotization reaction that was originally described by Griess in 1879. Through the years, many modifications to the original reaction have been described. The Griess Reagent System is based on a chemical reaction that uses sulfanilamide and N-1-naphthylethylenediamine dihydrochloride (NED) under acidic (phosphoric acid) conditions. This system detects NO2 – in a variety of biological and experimental liquid matrices such as plasma, serum, urine and tissue culture medium. The nitrite sensitivity is dependent on the matrix. The limit of detection is 2.5μM (125pmol) nitrite (in ultrapure, deionized, distilled water) using the protocol described in Technical Bulletin #TB229. Storage Conditions: Store at 4°C. Keep all solutions in their original light-protective plastic bottles. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 61 5Energy Metabolism For complete and up-to-date product information visit: www.promega.com Nucleotide and Co-Factor Detection Assays CellTiter-Glo® 2.0 Assay Product Size Cat.# CellTiter-Glo® 2.0 Assay 10 ml G9241 100 ml G9242 500 ml G9243 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CellTiter-Glo® 2.0 Assay provides a homogeneous method for determining the number of viable cells in culture by measuring the amount of ATP present, which indicates the presence of metabolically active cells. The CellTiter-Glo® 2.0 Assay is based on the original CellTiter-Glo® Assay chemistry but with improved storage convenience for easy implementation. The CellTiter-Glo® 2.0 Assay is provided as a single, ready-to-use reagent that can be stored at 4°C for up to 5 months with >90% activity remaining or at room temperature for 1 week with >85% activity remaining. The CellTiter-Glo® 2.0 Assay is designed for use with multiwell plate formats, making it ideal for automated high-throughput screening (HTS), cell proliferation and cytotoxicity assays. The homogeneous assay procedure involves adding the single reagent (CellTiter-Glo® 2.0 Reagent) directly to cells cultured in serum-supplemented medium. Cell washing, removal of medium and multiple pipetting steps are not required. The system detects as few as 15 cells/well in a 384-well format in 10 minutes after adding reagent. The homogeneous “add-mix-measure” format results in cell lysis and generation of a luminescent signal proportional to the amount of ATP present. The amount of ATP is directly proportional to the number of cells present in culture. The CellTiter-Glo® 2.0 Assay generates a “glow-type” luminescent signal, which has a half-life generally greater than three hours, depending on cell type and medium used. The extended half-life eliminates the need to use reagent injectors and provides flexibility for continuous or batch-mode processing of multiple plates. Features: • Ready-to-Use Reagent: The single, ready-to-use reagent and convenient storage stability at 4°C or 22°C eliminate reagent thawing and preparation, freeing up resources and time, and allow fast and easy implementation. • Improved Storage Stability: Storage stability at 4°C or room temperature allows the same kit to be used multiple times over several days or weeks while maintaining performance. • Robust: Stable luminescent signal with a half-life >3 hours, depending on cell type and culture medium used, allowing batch processing; delivers excellent Z´-factor values for screening applications. • Flexible: The assay can be used with various multiwell formats (96-well, regular or low-volume 384-well and 1,536-well plates. Reagents are offered in volumes to accommodate low-throughput to high-throughput applications. Data can be recorded by luminometer or CCD camera or other imaging device capable of reading luminescence in multiwell plates. • Able to Multiplex: Can be used with other nonlytic-compatible cell-based assay chemistries from Promega. • Simple Protocol: Uses a simple add-mix-read protocol with just a 10-minute incubation. Storage Conditions: The CellTiter-Glo® 2.0 Assay is shipped frozen and can be stored at –30°C to –10°C through the expiration date of the reagent. The CellTiter-Glo® 2.0 Reagent can maintain >90% activity upon storage at 4°C for 5 months or >85% activity upon storage at 22–25°C for 7 days. The CellTiter-Glo® 2.0 Reagent can withstand four additional freeze-thaw cycles after the first thaw with no loss of activity when the reagent is stored at –30°C to –10°C. NAD/NADH-Glo™ Assay Product Size Cat.# NAD/NADH-Glo™ Assay 10 ml G9071 50 ml G9072 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The NAD/NADH-Glo™ Assay is a bioluminescent, homogeneous single-reagent-addition assay for detecting total oxidized and reduced nicotinamide adenine dinucleotides (NAD+ and NADH, respectively) and determining their ratio in biological samples or in defined enzyme reactions. An NAD Cycling Enzyme is used to convert NAD+ to NADH. In the presence of NADH, the provided reductase enzyme reduces a proluciferin reductase substrate to form luciferin. Luciferin then is quantified using Ultra-Glo™ Recombinant Luciferase, and the light signal produced is proportional to the amount of NAD+ and NADH in the sample. Cycling between NAD+ and NADH by the NAD Cycling Enzyme and Reductase increases assay sensitivity and provides selectivity for the nonphosphorylated NAD+ and NADH compared to the phosphorylated forms NADP+ and NADPH. The NAD Cycling Enzyme, Reductase and luciferase reactions are initiated by adding an equal volume of NAD/NADH-Glo™ Detection Reagent, which contains NAD Cycling Enzyme and Substrate, Reductase, Reductase Substrate and Ultra-Glo™ Recombinant Luciferase, to an NAD+- or NADH-containing sample. Detergent present in the reagent lyses cells, allowing detection of total cellular NAD+ and NADH in a multiwell format with addition of a single reagent. An accessory protocol is provided to allow separate measurements of NAD+ and NADH, and calculation of the NAD+ to NADH ratio. The simple add-mixread protocol and scalable assay chemistry make the NAD/NADH-Glo™ Assay well suited to monitor effects of small molecule compounds on NAD and NADH levels in high-throughput formats. Features: • High Sensitivity: High sensitivity of the assay enables detection of total NAD+ and NADH directly in the wells. Fewer cells are required, with no sample preparation. • Homogeneous, One-Step Protocol: Total NAD+ and NADH is measured directly in wells of a 96- or 384-well cell culture plate with one reagent addition. A simple in-plate protocol is provided for individual NAD+ and NADH measurements. • Large Assay Window: The NAD/NADH-Glo™ Assay detects 10nM to 400nM NAD+ or NADH. The assay detects 100nM with a signal higher than fivefold over background and an assay window (maximum signal-tobackground ratio) of ≥100. • Automation Compatible: The assay is compatible with automated and high-throughput protocols. Reactions are scalable and can be performed at low volumes in 96-, 384- and 1536-well plates. • Reliability and Reproducibility: The NAD/NADH-Glo™ Assay routinely yields Z´ factors >0.7. • Luminescence-Based NAD+ and NADH Detection: The luminescent format avoids fluorescent interference due to reagents and test compounds sometimes seen in fluorescent assays. Storage Conditions: Store all components at –20°C (–30°C to –10°C). Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 62 For complete and up-to-date product information visit: www.promega.com NADP/NADPH-Glo™ Assay Product Size Cat.# NADP/NADPH-Glo™ Assay 10 ml G9081 50 ml G9082 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The NADP/NADPH-Glo™ Assay is a bioluminescent, homogeneous, single-reagent-addition method for rapid detection of total oxidized and reduced nicotinamide adenine dinucleotide phosphates (NADP+ and NADPH, respectively) and determining their ratio in biological samples and defined enzyme reactions. An NADP cycling enzyme is used to convert NADP+ to NADPH. In the presence of NADPH, a reductase enzyme reduces a proluciferin reductase substrate to form luciferin. Luciferin then is quantified using Ultra-Glo™ Recombinant Luciferase, and the light signal produced is proportional to the amount of NADP+ and NADPH in the sample. Cycling between NADP+ and NADPH by the NADP cycling enzyme and reductase increases assay sensitivity and provides selectivity for the phosphorylated NADP+ and NADPH compared to the nonphosphorylated forms NAD+ and NADH. The NADP Cycling Enzyme, Reductase and luciferase reactions are initiated by adding an equal volume of NADP/NADPH-Glo™ Detection Reagent, which contains NADP cycling enzyme and substrate, reductase, proluciferin reductase substrate and Ultra-Glo™ Recombinant Luciferase, to an NADP+- or NADPHcontaining sample. Detergent present in the reagent lyses cells, allowing detection of total cellular NADP+ and NADPH in a multiwell format with addition of a single reagent. The one-step protocol is useful for screening changes in total NADP+ and NADPH levels. An accessory protocol is provided to allow separate measurements of NADP+ and NADPH and calculation of the NADP+ to NADPH ratio. The simple add-mix-read protocol and scalable assay chemistry make the NADP/NADPH-Glo™ Assay well suited to monitor effects of smallmolecule compounds on NADP and NADPH levels in high-throughput formats. Features: • High Sensitivity: High sensitivity of the assay enables detection of total NADP+ and NADPH directly in the wells. Fewer cells are required, with no sample preparation. • Homogeneous, One-Step Protocol: Total NADP+ and NADPH is measured directly in wells of a 96- or 384-well cell culture plate with one reagent addition. A simple in-plate protocol is provided for individual NADP+ and NADPH measurements. • Large Assay Window: The NADP/NADPH-Glo™ Assay detects 10nM to 400nM NADP+ or NADPH. The assay detects 100nM with a signal higher than fivefold over background and an assay window (maximum signal-tobackground ratio) of ≥100. • Automation Compatible: The assay is compatible with automated and high-throughput protocols. Reactions are scalable and can be performed at low volumes in 96-, 384- and 1536-well plates. • Reliability and Reproducibility: The NADP/NADPH-Glo™ Assay routinely yields Z´ factors >0.7. • Luminescence-Based NADP+ and NADPH Detection: The luminescent format avoids fluorescent interference due to reagents and test compounds sometimes seen in fluorescent assays. Storage Conditions: Store all components at –20°C (–30°C to –10°C). NAD(P)H-Glo™ Detection System Product Size Cat.# NAD(P)H-Glo™ Detection System 10 ml G9061 50 ml G9062 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The in vitro enzyme-based NAD(P)H-Glo™ Detection System is a homogeneous, bioluminescent assay that quantitatively monitors the concentration of the reduced forms of nicotinamide adenine dinucleotides, NADH and NADPH, and does not discriminate between them. The oxidized forms, NAD+ and NADP+, are not detected and do not interfere with quantitation. In the presence of NAD(P)H, a reductase enzyme reduces a proluciferin reductase substrate to form luciferin. Luciferin then is quantified using Ultra-Glo™ Recombinant Luciferase, and the light signal produced is proportional to the amount of NAD(P)H in the sample. The reductase and luciferase reactions are initiated by adding an equal volume of a single reagent, which contains reductase, proluciferin Reductase Substrate and Ultra-Glo™ Recombinant Luciferase, to a NAD(P)H-containing sample. The assay is rapid, requiring only a 40- to 60-minute incubation, has a broad linear range and high signal-to background ratio. The assay is well suited to measuring NAD(P)H production or consumption in high-throughput formats. Features: • Broad Linear Range: The NAD(P)H-Glo™ Detection System detects 0.1μM to 25μM NAD(P)H. • High Sensitivity: The limit of detection is ≤0.1μM NADH, with a maximum assay window (i.e., signal-to-background ratio) of 250. The system detects 1μM with a signal higher than fivefold over background. • Automation Compatible: The add-and-read format is compatible with automated and high-throughput protocols. Reactions are scalable and can be performed at low volumes in 96-, 384- and 1536-well plates. • Reliability and Reproducibility: The NAD(P)H-Glo™ Detection System routinely yields Z´ factors >0.7. • Stable Signal: The glow-type signal is stable, with a half-life greater than two hours, allowing batch plate processing. • Luminescence-Based NAD(P)H Detection: The luminescent format avoids fluorescent interference due to reagents and test compounds sometimes seen in fluorescent assays. Storage Conditions: Store all components at –20°C (–30°C to –10°C). Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 63 6 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Imaging and Immunological Detection Cell and Whole Animal Imaging 64 Antibodies 69 Imaging and Immunological Detection Table of Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 64 For complete and up-to-date product information visit: www.promega.com Cell and Whole Animal Imaging HaloTag® Fluorescent Ligands Product Size Conc. Cat.# HaloTag® TMR Ligand 30 μl 5 mM G8251 15 μl 5 mM G8252 HaloTag® Oregon Green® Ligand 30 μl 1 mM G2801 15 μl 1 mM G2802 HaloTag® diAcFAM Ligand 30 μl 1 mM G8272 15 μl 1 mM G8273 HaloTag® Coumarin Ligand 30 μl 10 mM G8581 15 μl 10 mM G8582 HaloTag® Alexa Fluor® 488 Ligand 30 μl 1 mM G1001 15 μl 1 mM G1002 HaloTag® Alexa Fluor® 660 Ligand 30 μl 3.5 mM G8471 15 μl 3.5 mM G8472 HaloTag® TMRDirect™ Ligand 30 μl 0.1 mM G2991 HaloTag® R110Direct™ Ligand 30 μl 0.1 mM G3221 HaloTag® Biotin Ligand 30 μl 5 mM G8281 15 μl 5 mM G8282 HaloTag® PEG-Biotin Ligand 30 μl 5 mM G8591 15 μl 5 mM G8592 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Fluorescent Ligands can carry a variety of functionalities, including fluorescent labels, affinity tags and attachments to a solid phase. The covalent bond forms rapidly under general physiological conditions, is highly specific and essentially irreversible. The HaloTag® Fluorescent Ligands allow researchers to apply the chloroalkane group that HaloTag® protein reacts with to any compound or surface with a compatible chemical group, creating endless possible applications. HaloTag® Fluorescent Ligands for Cellular Imaging Cell-permeant fluorescent ligands (rapid labeling protocol): • HaloTag® TMR Ligand (555Ex/585Em) • HaloTag® Oregon Green® Ligand (496Ex/516Em) • HaloTag® diAcFAM Ligand (494Ex/526Em) • HaloTag® Coumarin Ligand (353Ex/434Em) Cell-impermeant fluorescent ligands for cell-surface labeling (rapid labeling protocol): • HaloTag® Alexa Fluor® 488 Ligand (494Ex/517Em) • HaloTag® Alexa Fluor® 660 Ligand (663Ex/690Em) Cell-permeant fluorescent ligands (“no wash” protocol): • HaloTag® TMRDirect™ Ligand (555Ex/585Em) • HaloTag® R110Direct™ Ligand (502Ex/527Em) The Alexa Fluor® 488 Ligand is impermeable to cell membranes and, therefore, used to label cell surface proteins. The TMR Ligand, Oregon Green® Ligand, diAcFAM Ligand and Coumarin Ligand readily cross the cell membrane and, therefore, can be used to label intracellular proteins. HaloTag® Ligands for Protein Detection The HaloTag® Biotin Ligand consists of a 12-atom linker arm to biotin and is used as an affinity tag to capture the HaloTag® protein-based fusion construct using the strong biotin-streptavidin interaction. The HaloTag® PEG-Biotin Ligand contains a spacer not found in the HaloTag® Biotin Ligand. This provides a significantly longer and more flexible linker between streptavidin and the HaloTag® protein, which may be advantageous in preserving the activity of a HaloTag® fusion partner protein upon immobilization or derivatization. Features: • Label in Solution or on a Solid Support: The HaloTag® Ligands bind to the HaloTag® protein or protein fusions with high specificity and affinity. • Label Your HaloTag® Protein in Live Cells: The HaloTag® TMR, diAcFAM, Coumarin and Biotin Ligands readily cross the cell membrane. • Pull Down Protein Complexes: The spacer and reactive linker of the HaloTag® PEG-Biotin Ligand provide ideal pull-down capabilities. Alternatively, pull down directly with the HaloLink™ Resin. • Image Fixed Cells: The covalent bond is stable, allowing imaging of fixed cells and analysis of the labeled protein under stringent conditions. • Introduce Novel Functionalities or Perform Sequential Labeling: The open architecture of the technology enables the use of different ligands for multiple applications. • Design Only One Genetic Construct for Multiple Experiments: Obtain new functionality by using a different HaloTag® Ligand without having to design and clone a new expression construct. • Analyze Labeled Fusion Proteins Using SDS-PAGE, Mass Spectrometry, etc.: The bound ligand is stable under denaturing conditions. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 65 6Imaging and Immunological Detection For complete and up-to-date product information visit: www.promega.com HaloTag® Fusion (C-Terminal) Mammalian Expression Vectors Product Size Cat.# pHTC HaloTag® CMV-neo Vector 20 μg G7711 pFC27A HaloTag® CMV-neo Flexi® Vector 20 μg G8421 pFC27K HaloTag® CMV-neo Flexi® Vector 20 μg G8431 pFC14A HaloTag® CMV Flexi® Vector 20 μg G9651 pFC14K HaloTag® CMV Flexi® Vector 20 μg G9661 pFC15A HaloTag® CMVd1 Flexi® Vector 20 μg G1611 pFC15K HaloTag® CMVd1 Flexi® Vector 20 μg G1601 pFC16A HaloTag® CMVd2 Flexi® Vector 20 μg G1591 pFC16K HaloTag® CMVd2 Flexi® Vector 20 μg G1571 pFC17A HaloTag® CMVd3 Flexi® Vector 20 μg G1551 pFC17K HaloTag® CMVd3 Flexi® Vector 20 μg G1321 Available Separately HaloTag® Cloning Starter System 1 each G6050 HaloTag® Flexi® Vectors—CMV Deletion Series Sample Pack 9 × 2 μg G3780 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These vectors are designed for expression of C-terminaltagged HaloTag® fusion proteins in mammalian cells. Once expressed, the HaloTag® fusion protein may be used for cell imaging of protein localization or trafficking in conjunction with the fluorescent HaloTag® Ligands. In addition, the HaloTag® fusion protein can be purified or pulled down as a complex with its protein partners. We offer two types of HaloTag® fusion vectors to accommodate your cloning preferences: • pHT Vector Series: Simple Multiple Cloning Site (MCS) plasmids for traditional cloning. • pF Vector Series: Flexi® Vector Cloning System—a directional cloning method for protein-coding sequences. It is based on two rare-cutting restriction enzymes, SgfI and PmeI, and provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Versatility: You can choose between a variety of initial applications (e.g., bacterial protein, mammalian, or cell-free protein expression) and then transfer to others as required. • Time Savings: Efficient transfer allows direct use of recombinant clones, minimizing time wasted screening background colonies. • Enhanced Productivity: Adaptable to high-throughput formats for large screening projects. • Easy Access: No licensing fees or complicated transfer restrictions. Storage Conditions: Store vectors at –20°C. HaloTag® Fusion (N-Terminal) Mammalian Expression Vectors Product Size Cat.# pHTN HaloTag® CMV-neo Vector 20 μg G7721 pFN28A HaloTag® CMV-neo Flexi® Vector 20 μg G8441 pFN28K HaloTag® CMV-neo Flexi® Vector 20 μg G8451 pFN21A HaloTag® CMV Flexi® Vector 20 μg G2821 pFN21K HaloTag® CMV Flexi® Vector 20 μg G2831 pFN22A HaloTag® CMVd1 Flexi® Vector 20 μg G2841 pFN22K HaloTag® CMVd1 Flexi® Vector 20 μg G2851 pFN23A HaloTag® CMVd2 Flexi® Vector 20 μg G2861 pFN23K HaloTag® CMVd2 Flexi® Vector 20 μg G2871 pFN24A HaloTag® CMVd3 Flexi® Vector 20 μg G2881 pFN24K HaloTag® CMVd3 Flexi® Vector 20 μg G2981 Available Separately HaloTag® Cloning Starter System 1 each G6050 HaloTag® Flexi® Vectors—CMV Deletion Series Sample Pack 9 × 2 μg G3780 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These vectors are designed for expression of N-terminaltagged HaloTag® fusion proteins in mammalian cells. Once expressed, the HaloTag® fusion protein may be used for cell imaging of protein localization or trafficking in conjunction with the fluorescent HaloTag® Ligands. In addition, the HaloTag® fusion protein can be purified or pulled down as a complex with its protein partners. We offer two types of HaloTag® fusion vectors to accommodate your cloning preferences: • pHT Vector Series: Simple Multiple Cloning Site (MCS) plasmids for traditional cloning. • pF Vector Series: Flexi® Vector Cloning System—a directional cloning method for protein-coding sequences. It is based on two rare-cutting restriction enzymes, SgfI and PmeI, and provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Versatility: You can choose between a variety of initial applications (e.g., bacterial protein, mammalian, or cell-free protein expression) and then transfer to others as required. • Time Savings: Efficient transfer allows direct use of recombinant clones, minimizing time wasted screening background colonies. • Enhanced Productivity: Adaptable to high-throughput formats for large screening projects. • Easy Access: No licensing fees or complicated transfer restrictions. Storage Conditions: Store vectors at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 66 For complete and up-to-date product information visit: www.promega.com VivoGlo™ Caspase 3/7 Substrate (Z-DEVD-Aminoluciferin Sodium Salt) Product Size Cat.# VivoGlo™ Caspase-3/7 Substrate (Z-DEVD-Aminoluciferin, Sodium Salt) 50 mg P1781 5 × 50 mg P1782 For Research Use Only. Not for Use in Diagnostic Procedures. Description: VivoGlo™ Caspase-3/7 Substrate (Z-DEVD-Aminoluciferin, Sodium Salt) is a firefly luciferase prosubstrate containing the DEVD tetrapeptide sequence recognized by caspase-3 and -7. Upon activation of caspase-3 or -7, the DEVD peptide is cleaved, and the liberated aminoluciferin reacts with luciferase to generate measurable light. Cleavage has been shown in in cellulo and in vivo systems. For mice, activity of a related salt was demonstrated when 10mg of the substrate in 150μl of saline was injected intraperitoneally. Other references suggest that doses as low as 1.5mg per mouse (50mg/kg) can be used. We recommend conducting a preliminary dose-response study using no more than 500mg/kg. VivoGlo™ Caspase-3/7 Substrate (Z-DEVD-Aminoluciferin, Sodium Salt) has a minimum solubility of 500mg/ml in PBS, and the resulting solution is stable for at least 3 days at room temperature. Injection is usually done via the intraperitoneal route, and imaging is generally started 10 minutes after injection. Features: • Highest Quality Substrates: Eliminate potential interference in assays due to the presence of endotoxins. • Assured Product Integrity: Most products are packaged in amber vials with septa to ensure product integrity as well as offer ease of dilution and use for imaging experiments. Product is packaged with fine tolerances to minimize the need to weigh substrates. • Flexibility and Convenience: Available in multiple sizes to accommodate a variety of experimental settings. Storage Conditions: Store at –20°C. HaloTag® Ligand Building Blocks Product Size Cat.# HaloTag® Amine (O4) Ligand 5 mg P6741 HaloTag® Amine (O2) Ligand 5 mg P6711 HaloTag® Iodoacetamide (O4) Ligand 5 mg P6771 HaloTag® Succinimidyl Ester (O4) Ligand 5 mg P6751 HaloTag® Succinimidyl Ester (O2) Ligand 5 mg P1691 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Ligand Building Blocks can carry a variety of functionalities, including fluorescent labels, affinity tags and attachments to a solid phase. The covalent bond forms rapidly under general physiological conditions, is highly specific and essentially irreversible. The HaloTag® Ligand Building Blocks allow researchers to apply the chloroalkane group that HaloTag® protein reacts with to any compound or surface with a compatible chemical group, creating endless possible applications. The HaloTag® Succinimidyl Ester (04) Ligand contains a reactive succinimidyl ester (SE) group connected to an alkyl chloride separated by three ethylene glycol repeats (04). The HaloTag® Succinimidyl Ester (04) Ligand can be successfully conjugated to any reporter group, protein, or nucleic acid derivative containing an amine, forming stable amide bond linkages. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. The HaloTag® Succinimidyl Ester (O2) Ligand contains a reactive succinimidyl ester (SE) group connected to an alkylchloride separated by an ethylene glycol repeat (O2). The HaloTag® Succinimidyl Ester (O2) Ligand can be successfully conjugated to any reporter group, protein, or nucleic acid derivative containing an amine, forming stable amide bond linkages. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. The HaloTag® Amine (04) Ligand contains a reactive amine group connected to an alkyl chloride, separated by an ethylene glycol repeat (04). The HaloTag® Amine (04) Ligand can be successfully conjugated to any reporter group, protein, or nucleic acid derivative containing an activated carboxylic acid, sulfonyl halide or isocyanate. Examples of activated carboxylic acids are succinimidyl esters, STP esters, acid halides, and TFP esters. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. The HaloTag® Amine (O2) Ligand contains a reactive amine group connected to an alkylchloride, separated by an ethylene glycol repeat (O2). The HaloTag® Amine (O2) Ligand can be successfully conjugated to any reporter group, protein, or nucleic acid derivative containing an activated carboxylic acid, sulfonyl halide or isocyanate. Examples of activated carboxylic acids are succinimidyl esters, STP esters, acid halides and TFP esters. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. The HaloTag® Iodoacetamide (04) Ligand contains a reactive iodoacetamide group connected an alkyl chloride separated by an ethylene glycol repeat (04). The HaloTag® Iodoacetamide (04) Ligand has been designed to rapidly react with sulfhydryl-containing molecules, whether small organic compounds, peptides or proteins. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. Storage Conditions: Store Cat.# P1691 and P6751 at or below –70°C under inert atmosphere. Store Cat.# P6711 and P6741 at or below –20°C in an air-tight container in the absence of light. Store Cat.# P6771 at or below –20°C under inert atmosphere in the absence of light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 67 6Imaging and Immunological Detection For complete and up-to-date product information visit: www.promega.com ViviRen™ In Vivo Renilla Luciferase Substrate Product Size Cat.# ViviRen™ In Vivo Renilla Luciferase Substrate 0.37 mg P1231 3.7 mg P1232 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ViviRen™ in vivo Renilla Luciferase Substrate is a uniquely engineered coelenterazine-based compound with protected oxidation sites. These modifications are designed to minimize substrate degradation and autoluminescence. It is reported that the ViviRen™ Substrate demonstrates brighter output when compared to the native coelenterazine substrate when used in an in vivo imaging application in a mouse model. Cat.# P1231 is supplied as a liquid, 60mM in DMSO. Cat.# P1232 is supplied as a lyophilized solid. Features: • Highest Quality Substrates: Eliminate potential interference in assays due to the presence of endotoxins. • Assured Product Integrity: Most products are packaged in amber vials with septa to ensure product integrity as well as offer ease of dilution and use for imaging experiments. Product is packaged with fine tolerances to minimize the need to weigh substrates. • Flexibility and Convenience: Available in multiple sizes to accommodate a variety of experimental settings. Storage Conditions: Store at –20°C. EnduRen™ In Vivo Renilla Luciferase Substrate Product Size Cat.# EnduRen™ In Vivo Renilla Luciferase Substrate 0.34 mg P1111 3.4 mg P1112 For Research Use Only. Not for Use in Diagnostic Procedures. Description: EnduRen™ in vivo Renilla Luciferase Substrate is a uniquely engineered coelenterazine-based compound with protected oxidation sites. These modifications are designed to minimize substrate degradation and autoluminescence. It is reported that EnduRen™ Substrate may have a longer kinetic output when compared to the native coelenterazine substrate when used in an in vivo imaging application in a mouse model. Features: • Highest Quality Substrates: Eliminate potential interference in assays due to the presence of endotoxins. • Assured Product Integrity: Most products are packaged in amber vials with septa to ensure product integrity as well as offer ease of dilution and use for imaging experiments. Product is packaged with fine tolerances to minimize the need to weigh substrates. • Flexibility and Convenience: Available in multiple sizes to accommodate a variety of experimental settings. Storage Conditions: Store at –20°C. VivoGlo™ Luciferin-β-Galactosidase Substrate (6-O-β-galactopyranosyl luciferin) Product Size Cat.# VivoGlo™ Luciferin-β-Galactoside Substrate (6-O-β-galactopyranosyl luciferin) 50 mg P1061 250 mg P1062 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferin-β-galactoside is a substrate for the commonly used reporter enzyme β-galactosidase. The substrate is cleaved by β-galactosidase to form luciferin and galactose. When used in a model system expressing firefly luciferase, the luciferin is then utilized in a firefly luciferase reaction to generate light. Features: • Highest Quality Substrates: Eliminate potential interference in assays due to the presence of endotoxins. • Assured Product Integrity: Most products are packaged in amber vials with septa to ensure product integrity as well as offer ease of dilution and use for imaging experiments. Product is packaged with fine tolerances to minimize the need to weigh substrates. • Flexibility and Convenience: Available in multiple sizes to accommodate a variety of experimental settings. Storage Conditions: Store at –20°C. VivoGlo™ Luciferin, In Vivo Grade Product Size Cat.# VivoGlo™ Luciferin, In Vivo Grade 50 mg P1041 250 mg P1042 1 g P1043 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferase genes from the North American firefly (Photinus pyralis) and from other beetles are commonly used as light-emitting reporters in cellular and animal models. VivoGlo™ Luciferin is the potassium salt of d-luciferin, the firefly luciferase substrate capable of generating light when a suitable model is used. Features: • Highest Quality Substrates: Eliminate potential interference in assays due to the presence of endotoxins. • Assured Product Integrity: Most products are packaged in amber vials with septa to ensure product integrity as well as offer ease of dilution and use for imaging experiments. Product is packaged with fine tolerances to minimize the need to weigh substrates. • Flexibility and Convenience: Available in multiple sizes to accommodate a variety of experimental settings. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 68 For complete and up-to-date product information visit: www.promega.com HaloTag® Fusion (C-Terminal) Mammalian Expression Vectors Product Size Cat.# pHTC HaloTag® CMV-neo Vector 20 μg G7711 pFC27A HaloTag® CMV-neo Flexi® Vector 20 μg G8421 pFC27K HaloTag® CMV-neo Flexi® Vector 20 μg G8431 pFC14A HaloTag® CMV Flexi® Vector 20 μg G9651 pFC14K HaloTag® CMV Flexi® Vector 20 μg G9661 pFC15A HaloTag® CMVd1 Flexi® Vector 20 μg G1611 pFC15K HaloTag® CMVd1 Flexi® Vector 20 μg G1601 pFC16A HaloTag® CMVd2 Flexi® Vector 20 μg G1591 pFC16K HaloTag® CMVd2 Flexi® Vector 20 μg G1571 pFC17A HaloTag® CMVd3 Flexi® Vector 20 μg G1551 pFC17K HaloTag® CMVd3 Flexi® Vector 20 μg G1321 For Research Use Only. Not for Use in Diagnostic Procedures. HaloTag® Fusion (N-Terminal) Mammalian Expression Vectors Product Size Cat.# pHTN HaloTag® CMV-neo Vector 20 μg G7721 pFN28A HaloTag® CMV-neo Flexi® Vector 20 μg G8441 pFN28K HaloTag® CMV-neo Flexi® Vector 20 μg G8451 pFN21A HaloTag® CMV Flexi® Vector 20 μg G2821 pFN21K HaloTag® CMV Flexi® Vector 20 μg G2831 pFN22A HaloTag® CMVd1 Flexi® Vector 20 μg G2841 pFN22K HaloTag® CMVd1 Flexi® Vector 20 μg G2851 pFN23A HaloTag® CMVd2 Flexi® Vector 20 μg G2861 pFN23K HaloTag® CMVd2 Flexi® Vector 20 μg G2871 pFN24A HaloTag® CMVd3 Flexi® Vector 20 μg G2881 pFN24K HaloTag® CMVd3 Flexi® Vector 20 μg G2981 For Research Use Only. Not for Use in Diagnostic Procedures. pGL4 in vivo Imaging Vectors Product Size Cat.# pGL4.50[luc2/CMV/Hygro] Vector 20 μg E1310 pGL4.51[luc2/CMV/Neo] Vector 20 μg E1320 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGL4 Luciferase Reporter Vectors are the next generation of reporter gene vectors optimized for expression in mammalian cells. Numerous configurations of pGL4 Vectors are available. The pGL4.50 and pGL4.51 Vectors offer the synthetic firefly luciferase luc2 gene under the control of the strong constitutive CMV (cytomegalovirus) promoter. These vectors have demonstrated high expression levels in a variety of cell lines tested. The addition of a selectable marker, either hygromycin or neomycin, also allows the creation of stable cell lines. Cell lines with constant expression of luciferase can be used in animal models to study in vivo changes in cell physiology. Features: • Pre-built luciferase expression vector. • Luc2 luciferase gene provides highest expression. • Selectable markers for generating stable cell lines. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 69 6Imaging and Immunological Detection For complete and up-to-date product information visit: www.promega.com Antibodies Anti-ACTIVE® JNK pAb, Rabbit, (pTPpY) Product Size Cat.# Anti-ACTIVE® JNK pAb, Rabbit, (pTPpY) 40 μl V7931 120 μl V7932 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Anti-ACTIVE® JNK pAb is a polyclonal antibody from rabbit serum. The antibody is affinity purified using a dually phosphorylated peptide that corresponds to the active form of the JNK enzymes. Features: • Specificity: Preferentially detects the dually phosphorylated, active form of the stress-activated protein kinase (SAPK), also known as c-Jun N-terminal kinase, JNK. • Immunogen: Dually phosphorylated Thr/Pro/Tyr region (pTPpY) derived from the catalytic core of the active form of JNK kinase, which corresponds to Thr183 and Tyr185 of the mammalian JNK2 enzyme. • Antibody Form: Affinity-purified rabbit IgG; supplied in 10mM sodium phosphate (pH 7.4), 20mM NaCl. • Value: Anti-ACTIVE® JNK pAb is available in two convenient sizes. Cat.# V7931 will generate up to 200ml of blotting solution, sufficient for 20 Western blots of 10ml each. The larger size, Cat.# V7932, will generate up to 600ml of blotting solution, sufficient for 60 Western blots of 10ml each. Storage Conditions: Store at –20°C. Anti-ACTIVE® MAPK pAb, Rabbit, (pTEpY) Product Size Cat.# Anti-ACTIVE® MAPK pAb, Rabbit, (pTEpY) 40 μl V8031 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Anti-ACTIVE® MAPK pAb is a polyclonal rabbit antibody. The antibody is affinity purified using a dually phosphorylated peptide that corresponds to the active form of the mitogen-activated protein (MAP) kinase enzymes. Features: • Specificity: Preferentially detects the dually phosphorylated, active form of the mitogen-activated protein kinase (MAPK) enzymes (ERK1 and ERK2). • Immunogen: Dually phosphorylated Thr/Glu/Tyr region (pTEpY) derived from the catalytic core of the active form of the mitogen-activated protein kinase (MAPK) enzymes, ERK1 and ERK2, which corresponds to Thr183 and Tyr185 of the mammalian ERK2 enzyme. • Antibody Form: Affinity-purified rabbit IgG; supplied in PBS (pH 7.4). • Value: When used at the recommended 1:5,000 dilution, this product will generate 200ml of blotting solution, sufficient for 20 Western blots of 10ml each. Storage Conditions: Store at –20°C. Anti-ACTIVE® Caspase-3 pAb Product Size Cat.# Anti-ACTIVE® Caspase-3 pAb 50 μl G7481 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Anti-ACTIVE® Caspase-3 pAb is intended for use as a marker of apoptosis; it specifically stains apoptotic cells without staining nonapoptotic cells. Includes sufficient antibody to perform 125 immunocytochemical assays (100μl/assay) at a 1:250 dilution. Features: • Immunogen: Peptide derived from the p17 fragment of caspase-3 and having sequence homology in human, mouse, rat and hamster. • Antibody Form: Affinity-purified rabbit IgG; supplied in Dulbecco’s PBS. • Specificity: Specifically recognizes the cleaved active form of caspase-3 in human, rat and mouse. Storage Conditions: Store at –20°C. Anti-β-Galactosidase mAb Product Size Conc. Cat.# Anti-β-Galactosidase, Purified Monoclonal Antibody 100 μg 2.0–2.5 mg/ml Z3781 2 mg 2.0–2.5 mg/ml Z3783 For Research Use Only. Not for Use in Diagnostic Procedures. Description: This antibody [subclass IgG2a(κ)] was purified from ascites of a mouse hybridoma and recognizes E. coli β-galactosidase. Features: • Immunogen: β-galactosidase. • Antibody Form: 2.0–2.5mg/ml in 10mM Tris-HCl (pH 8.0), 150mM NaCl, 0.02% sodium azide. • Specificity: E. coli β-galactosidase near the C-terminal end. Storage Conditions: Store undiluted at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 70 For complete and up-to-date product information visit: www.promega.com Anti-HaloTag® Monoclonal Antibody Product Size Conc. Cat.# Anti-HaloTag® Monoclonal Antibody 200 μg 1 mg/ml G9211 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Anti-HaloTag® Monoclonal Antibody is a mouse monoclonal antibody raised against the HaloTag® protein, which can be used to detect HaloTag® fusion proteins by Western blotting. The HaloTag® platform addresses the need for flexibility in functional protein analysis for cell imaging, protein purification and protein pull-down applications. Features: • Specific to HaloTag® Protein: Little to no cross-reactivity with other non-HaloTag proteins. • More Sensitive Detection Over the Existing Anti-HaloTag® pAb: Detect as low as 0.5–1ng of HaloTag® fusion protein by Western blot. Storage Conditions: Store at –30°C to –10°C. Anti-Luciferase pAb Product Size Cat.# Anti-Luciferase pAb 200 μg G7451 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Anti-Luciferase pAb is a goat polyclonal antibody designed for use in immunocytochemistry and Western blot applications. Anti-Luciferase pAb can detect luciferase enzyme expression in situ. Features: • Immunogen: 61kDa recombinant luciferase from North American firefly (Photinus pyralis). • Antibody Form: Goat polyclonal IgG at 1mg/ml in PBS containing 50μg/ml gentamicin. • Specificity: Anti-Luciferase pAb is specific for firefly luciferase (Photinus pyralis) and does not cross-react with sea pansy (Renilla reniformis) luciferase. Storage Conditions: Store at 4°C. Anti-PARP p85 Fragment pAb Product Size Cat.# Anti-PARP p85 Fragment pAb 50 μl G7341 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Poly (ADP-ribose) polymerase (PARP), a nuclear enzyme involved in DNA repair, is a well known substrate for caspase-3 cleavage during apoptosis. Anti-PARP p85 Fragment pAb is a rabbit polyclonal antibody specific for the p85 fragment of PARP that results from caspase cleavage of the 116kDa intact molecule and thus provides an in situ marker for apoptosis. The antibody is affinity-purified using a peptide that corresponds to a region of the p85 fragment of PARP. The PARP immunogen is a synthetic peptide, gly-val-asp-glu-val-ala-lys (GVDEVAK), representing the N terminus of the large C-terminal fragment of human PARP that results from caspase-3 cleavage. Each batch of antibody is quality assurance tested for use in immunostaining applications and contains sufficient antibody for 50 immunocytochemical reactions at the suggested working dilution of 1:100. Features: • Immunogen: N-terminal peptide from p85 fragment. • Antibody Form: Affinity-purified rabbit polyclonal antibody provided in Dulbecco’s PBS. • Specificity: Specifically detects PARP p85 fragment in human, rat and bovine cells and tissues. Does not recognize the 116kDa intact PARP protein. Storage Conditions: Store at –20°C. Anti-Human p75 pAb Product Size Cat.# Anti-Human p75 pAb 200 μg G3231 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The p75 neurotrophin receptor (p75NTR), also known as low-affinity NGF receptor (LNGFR) and p75LNGFR, binds nerve growth factor, brain-derived neurotrophic factor, neurotrophin-3 and neurotrophin-4 with varying specificities. p75NTR plays an important role in neurotrophic factor signaling including neuronal apoptosis. Anti-Human p75 pAb provides a valuable tool for understanding the role of p75NTR in neuronal death. Features: • Immunogen: Cytoplasmic domain of the human p75 neurotrophin receptor. • Antibody Form: Purified rabbit IgG; 1mg/ml in PBS containing 50μg/ml gentamicin. • Specificity: Human, rat, mouse and chicken p75. Storage Conditions: Store at 4°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 71 6Imaging and Immunological Detection For complete and up-to-date product information visit: www.promega.com Anti-βIII Tubulin mAb Product Size Cat.# Anti-βIII Tubulin mAb 100 μg G7121 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Anti-βIII Tubulin mAb is a protein G-purified IgG1 monoclonal antibody (from clone 5G8) raised in mice against a peptide (EAQGPK) corresponding to the C terminus of βIII tubulin. It is directed against βIII tubulin, a specific marker for neurons. The major use of this antibody is for labeling neurons in tissue sections and cell culture. The antibody has been tested to perform in frozen and paraffin-embedded sections of rat brain, cerebellum and spinal cord, human and rat fetal CNS progenitor cell cultures and adult human paraffin-embedded brain. Features: • Immunogen: Peptide corresponding to the C terminus (EAQGPK) of βIII tubulin. • Antibody Form: Mouse monoclonal IgG1 (clone 5G8), 1mg/ml in PBS containing no preservatives. • Specificity: Cross-reacts with most mammalian species. Does not label nonneuronal cells (e.g., astrocytes). Storage Conditions: Store at 4°C. Alkaline Phosphatase-Conjugated Antibodies Product Size Cat.# Anti-Mouse IgG (H+L), AP Conjugate 100 μl S3721 Anti-Rabbit IgG (Fc), AP Conjugate 100 μl S3731 Anti-Human IgG (H+L), AP Conjugate 100 μl S3821 Donkey Anti-Goat IgG, AP 60 μl V1151 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Polyclonal secondary antibodies raised in goat or donkey, immunoaffinity-purified using corresponding immobilized antigens and conjugated to alkaline phosphatase (AP) enzyme. The products (unless otherwise noted) are supplied as 1mg/ml solutions. The Anti-Mouse IgG (H+L), AP Conjugate antibody binds to both heavy and light chains for all IgG subclasses. The Anti-Rabbit IgG (Fc), AP Conjugate antibody reacts with the heavy chains of rabbit IgG but not with the light chains. The Anti-Human IgG (H+L), AP Conjugate antibody reacts with heavy and light chains of all subclasses of human IgG as well as with light chains on other human immunoglobulins; it displays minimal cross-reactivity to horse or bovine serum proteins. As with all antibodies, in certain applications some species-dependent antigen-dependent crossreactivity may be observed. A starting working dilution of 1:2,500 is suggested for most Western blot, dot blot and ELISA applications. The optimum concentration of secondary antibody depends on the application and will need to be empirically determined. Donkey Anti-Goat IgG, AP Conjugate is a secondary antibody developed in donkeys against goat IgG; it has been affinity-purified and conjugated to alkaline phosphatase. Features: • Extensive Validation: Use with confidence, as supported by numerous publications. • Ready-to-Use Formulation: No need to dissolve the antibody. • Flexible Dispensing: We can readily accommodate large-scale custom orders. Please inquire at: www.promega.com/custom/ Storage Conditions: Store the Anti-Mouse IgG (H+L), AP Conjugate, Anti-Rabbit IgG (Fc), AP Conjugate, and Anti-Human IgG (H+L), AP Conjugate, at +2 to +10°C. Store the Donkey Anti-Goat IgG, AP at –30 to –10°C. Horseradish Peroxidase-Conjugated Antibodies Product Size Cat.# Anti-Rabbit IgG (H+L), HRP Conjugate 300 μl W4011 Anti-Mouse IgG (H+L), HRP Conjugate 300 μl W4021 Anti-Human IgG (H+L), HRP Conjugate 300 μl W4031 Donkey Anti-Goat IgG, HRP 60 μl V8051 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Polyclonal secondary antibodies raised in goat, rabbit or donkey, immunoaffinity-purified using corresponding immobilized antigens and conjugated to horseradish peroxidase (HRP) enzyme. The Anti-Human IgG (H+L), HRP Conjugate, Anti-Mouse IgG (H+L), HRP Conjugate and Anti-Rabbit IgG (H+L), HRP Conjugate antibodies bind to both heavy and light chains for all IgG subclasses. As with all antibodies, in certain applications some species-dependent antigen-dependent cross-reactivity may be observed. The products (unless otherwise noted) are supplied as 1mg/ml solutions. A starting working dilution of 1:2,500 is suggested for most Western blot, dot blot and ELISA applications. The optimum concentration of secondary antibody depends on the application and will need to be empirically determined. Donkey Anti-Goat IgG, HRP Conjugate is a secondary antibody developed in donkeys against goat IgG. Donkey Anti-Goat IgG, HRP Conjugate shows reactivity to goat and sheep IgG but minimal cross-reactivity to rabbit and mouse IgG. For Western blot applications with chromogenic detection use at a starting dilution of 1:10,000. Features: • Extensive Validation: Use with confidence, as supported by numerous publications. • Ready-to-Use Formulation: No need to dissolve the antibody. • Flexible Dispensing: We can readily accommodate large-scale custom orders. Please inquire at: www.promega.com/custom/ Storage Conditions: Store the unopened product at –20°C. Store opened Anti-Human IgG (H+L), HRP Conjugate, Anti-Mouse IgG (H+L), HRP Conjugate and Anti-Rabbit IgG (H+L), HRP Conjugate at 4°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 72 For complete and up-to-date product information visit: www.promega.com TMB One Solution Product Size Cat.# TMB One Solution 100 ml G7431 For Research Use Only. Not for Use in Diagnostic Procedures. Description: TMB One Solution is a chromagen substrate, 3,3´,5,5´-tetramethylbenzidine (TMB) provided in a mildly acidic, nonhazardous buffer for horseradish peroxidase detection in an ELISA format. The substrate is provided as a single solution at a ready-to-use working dilution. The substrate develops a blue reaction product when oxidized by peroxidase and a yellow reaction product in an endpoint multiwell assay after the addition of an acid solution provided by the end user. Features: • Convenient: Single solution provided ready-to-use; just add, incubate, stop and read. This homogeneous reagent improves assay variation. • Stable: Stable for 12 months at 4°C, providing extended shelf life; the assay end product is stable for at least one hour after stopping the assay. • Safe: Provided in a slightly acidic, nonhazardous proprietary buffer without aprotic solvents; noncaustic to plastics used in automated systems. • Sensitive: Low background provides greater assay sensitivity. Storage Conditions: Store at 4°C protected from light. Anti-HaloTag® pAb Product Size Conc. Cat.# Anti-HaloTag® pAb 200 μg 1 mg/ml G9281 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Anti-HaloTag® pAb is a purified rabbit polyclonal antibody raised against the HaloTag® protein. The antibody is purified using Protein G affinity resin and supplied at 1mg/ml in PBS. The antibody detects HaloTag® fusion proteins in Western blot hybridization and immunocytochemistry applications with high sensitivity and specificity. The HaloTag® protein is not endogenous to mammalian, plant and E. coli cells. E. coli and mammalian cell extracts demonstrate low cross-reactivity with the Anti-HaloTag® pAb. Features: • Specificity: The Anti-HaloTag® pAb is specific for HaloTag® protein and exhibits low cross-reactivity with E. coli and mammalian cell extracts. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 73 7 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Luciferase Assays Reporter Assays 74 Genetic Reporter Vectors and Cell Lines 84 Transfection Reagents 95 Luciferase Assays Table of Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 74 For complete and up-to-date product information visit: www.promega.com Reporter Assays Nano-Glo® In-Gel Detection System Product Size Cat.# Nano-Glo® In-Gel Detection System 10ml N3020 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Nano-Glo® In-Gel Detection System eliminates the need for immunoblotting to detect NanoLuc® fusion proteins separated by polyacrylamide gel electrophoresis, allowing direct imaging of proteins within gels. For native PAGE, the gels can be incubated with detection reagent and imaged in less than 15 minutes. For denaturing SDS-PAGE, two washes with 25% isopropanol followed by two washes in water are needed to remove the SDS and allow the NanoLuc® luciferase to refold before detection. The sensitivity of NanoLuc® luciferase means proteins do not need to be overexpressed to be visualized by the Nano-Glo® In-Gel Detection System. Easily detect NanoLuc® protein fusions to: • Verify expression levels • Confirm correct molecular weight • Multiplex measurements of multiple luminescent species Features: • Simply incubate native or SDS denaturing gels with reagent and image • No transfer to membranes required for detection • Eliminates the need for blocking or antibodies Storage Conditions: Store at –30°C to –10°C. HiBiT Control Protein Product Size Cat.# HiBiT Control Protein 100µl N3010 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HiBiT Control Protein is a 20μM solution of purified recombinant 36kDa HaloTag® protein fused at its carboxy terminus to the 11-amino-acid HiBiT tag. The HiBiT Control Protein can be used as a positive control of known concentration when using the Nano-Glo® HiBiT Lytic Detection System (Cat.# N3030, N3040, N3050), Nano-Glo® HiBiT Extracellular Detection System (Cat.# N2420, N2421, N2422) or Nano-Glo® HiBiT Blotting System (Cat.# N2410). Features: • A 20µM control protein • Use as a positive control with the Nano-Glo® HiBiT Detection and Blotting Systems Storage Conditions: Store at –30°C to –10°C. Nano-Glo® Live Cell Assay System Product Size Cat.# Nano-Glo® Live Cell Assay System 100 assays N2011 1,000 assays N2012 10,000 assays N2013 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Nano-Glo® Live Cell Assay System is a single-addition, nonlytic detection reagent used to measure NanoBiT® or NanoLuc® luminescence from living cells. The reagent is prepared by diluting the Nano-Glo® Live Cell Substrate with the Nano-Glo® LCS Dilution Buffer to make the Nano-Glo® Live Cell Reagent, a 5X stock that is added directly to cell culture medium. Both substrate and buffer solutions are optimized to provide enhanced stability. The Nano-Glo® Live Cell Reagent is designed to reduce autoluminescence in the presence or absence of serum, increasing the sensitivity for detection of low levels of NanoBiT® or NanoLuc® luminescence. The Nano-Glo® Live Cell Assay System can be used to monitor luminescence at a user-defined time point or continuously for up to 2 hours without compromising cell viability. Storage Conditions: Nano-Glo® LCS Dilution Buffer may be thawed and stored at room temperature. Store all other components at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 75 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com Nano-Glo® Luciferase Assay System Product Size Cat.# Nano-Glo® Luciferase Assay 10 ml N1110 100 ml N1120 10 × 10 ml N1130 10 × 100 ml N1150 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Nano-Glo® Luciferase Assay System provides a simple, single-addition reagent that generates a glow-type signal in the presence of NanoLuc® luciferase. The signal half-life is approximately 120 minutes in commonly used tissue culture media. The reagent, which contains an integral lysis buffer, is prepared by mixing Nano-Glo® Luciferase Assay Substrate and Nano-Glo® Luciferase Assay Buffer. The lysis buffer allows use of the reagent either directly on cells expressing NanoLuc® luciferase or the culture media when luciferase is secreted. Nano-Glo® Luciferase Assay Reagent is a dedicated product for the detection of NanoLuc® Luciferase. Features: • Advanced Reporter System: Bright NanoLuc® reporter enables use in challenging applications where sensitivity is limited. • Simplified Assay Optimization: Add-and-read simplicity enables scaling from bench to HTS. • Improved Assay Precision: No need for separate lysis and reagent injection steps. • Brighter, Longer-Lasting Signal: Extended bright light output is optimized for batch and continuous-process handling. • Greater Sensitivity: Low background formulation offers increased sensitivity. Nano-Glo® Endurazine™ and Vivazine™ Live Cell Substrates Product Size Cat.# Nano-Glo® Endurazine™ Live Cell Substrate 0.1ml N2570 1ml N2571 10ml N2572 Nano-Glo® Vivazine™ Live Cell Substrate 0.1ml N2580 1ml N2581 10ml N2582 Nano-Glo® Extended Live Cell Substrate Trial Pack 0.2ml N2590 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Live-cell, nonlytic assays using the Nano-Glo® Live Cell Assay System are limited to ≤2 hours because of signal decay. The Nano-Glo® Endurazine™ and Vivazine™ Live Cell Substrates provide alternative live-celldetection methods for NanoLuc® and NanoBiT® luciferases that enable nonlytic assays for periods lasting several hours to days. For both substrates, a slow rate of ester hydrolysis leads to the steady release of furimazine throughout the experiment, a process catalyzed by cellular esterases. Once formed, furimazine serves as a substrate for NanoLuc® and NanoBiT® luciferases. The Vivazine™ substrate typically shows increased brightness but also an increased rate of signal decay compared to the Endurazine™ substrate. The Endurazine™ substrate will provide the maximum signal stability but lower initial signal intensity compared to the other Nano-Glo® Live Cell Substrates. Evaluate both substrates to determine which combination of signal intensity and stability is most suitable for your experiment [e.g., Nano-Glo® Extended Live Cell Substrate Trial Pack (Cat.# N2590)]. Features: • Increased signal stability for extended real-time kinetic analysis of reporter activity • Simplify time course studies by measuring response in the same sample over time • Sensitivity to measure protein at endogenous levels—no overexpression required Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 76 For complete and up-to-date product information visit: www.promega.com Nano-Glo® Dual-Luciferase® Reporter Assay System Product Size Cat.# Nano-Glo® Dual-Luciferase® Reporter Assay System 10 ml N1610 10 × 100 ml N1650 100 ml N1620 10 × 10 ml N1630 Available Separately Nano-Glo® Dual-Luciferase® Reporter Assay/pNL1.1.TK Bundle 1 each N1521 Nano-Glo® Dual-Luciferase® Reporter Assay/pNL1.1.PGK Bundle 1 each N1531 Nano-Glo® Dual-Luciferase® Reporter Assay/pGL4.54[luc2/TK] Bundle 1 each N1541 Nano-Glo® Dual-Luciferase® Reporter Assay/pGL4.53[luc2/PGK] Bundle 1 each N1551 NanoDLR/pNL1.1.TK Helix® Bundle 1 each N1561 Passive Lysis 5X Buffer 30 ml E1941 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Nano-Glo® Dual-Luciferase® Reporter (NanoDLR™) Assay System is a homogeneous reagent system that enables you to sequentially detect the activities of firefly (Photinus pyralis) luciferase and NanoLuc® luciferase (Nluc) from a single sample. The firefly luciferase (Fluc) activity is measured first using ONE-Glo™ EX Luciferase Assay Reagent. NanoDLR™ Stop & Glo® Reagent is added to quench the firefly signal and provide the furimazine substrate needed to measure Nluc activity. This convenient “addread-add-read” format generates stable glow-type luminescent signals for both reporters directly from cells with no lysis or cell preconditioning steps required. Potent Fluc inhibition coupled with the high-intensity Nluc luminescence create a dual assay in which both reporters have maximum sensitivity in an assay format that is easy-to-use and flexible. The NanoDLR™ workflow is compatible with assays or screens in any plate size, supports batch processing, and is ideal for any luminometer with no specific filter or injector requirements. Excellent signal separation allows use of Nluc, Fluc or both as the dynamic experimental reporter. Co-reporter control vectors expressing either Nluc or Fluc from a variety of promoters are available individually or can be obtained in reagent/vector bundles that provide the NanoDLR™ reagent with the TK or PGK control vector of choice for simple adoption of the NanoDLR™ Assay. The ONE-Glo™ EX Luciferase Assay Reagent is also available individually, allowing use of the same firefly luciferase reagent in both single and dual assays. The reconstituted reagent has increased stability at room temperature and 4°C, simplifying repeat use over long experiments and reducing waste. Features: • Experience Improved Assay Performance: Better quenching of the Fluc signal and the bright Nluc co-reporter in a homogeneous assay format with stable signal kinetics for convenient “add-read-add-read” processing. • Achieve Greater Sensitivity: An Nluc signal up to 1,000 times brighter than Renilla luciferase and efficient separation of the Nluc and Fluc signals allow greater sensitivity, improved signal:background ratios and two independent reporters at full dynamic range. • Choose Your Assay Configuration: Use either Fluc or Nluc as the experimental reporter with the other as an internal normalization control, or multiplex with two experimental reporters for maximum data or expanded applications. • Notice Improved Ease-of-Use: Optimized reagents have greater stability, reducing requirements to aliquot and freeze, offer reduced reagent odor, and demonstrate decreased sensitivity to culture components. • Take Advantage of Workflow Flexibility: Designed as an “add-readadd-read” assay that can be used directly on cells; also compatible with injection-based protocols and cell lysates allowing use with any plate size up to 1,536-well format with minimal instrument limitations. Storage Conditions: Store the Nano-Glo® Dual-Luciferase® Reporter Assay System components at –30°C to –10°C. Please refer to the Technical Manual for other short-term storage options. Dual-Glo® Luciferase Assay System Product Size Cat.# Dual-Glo® Luciferase Assay System 10 ml E2920 100 ml E2940 10 × 100 ml E2980 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Dual-Glo® Luciferase Assay System is a homogeneous reagent system that enables fast and simple quantitation of a stable luminescent signal from two reporter genes in a single sample. This convenient “add-and-read” system generates both firefly and Renilla luciferase luminescence signals from cells that have not been preconditioned or prelysed. The Dual-Glo® Luciferase Assay System provides high Z´-factors for cellbased, high-throughput screening applications. With the Dual-Glo® System, internal controls can be established to minimize sample variability by reducing false-positive and false-negative readings caused by nonspecific factors such as cytotoxicity. In the Dual-Glo® Luciferase Assay, the activity of the primary reporter is correlated with the effect of specific stimuli, and the activity of the co-transfected control reporter provides an internal control to normalize results. The system is optimized for batch processing both 96- and 384-well plates and is compatible with a wide variety of mammalian cell culture media. Features: • Increased Precision and Accuracy: Normalize primary reporter results with an internal control, a co-reporter that minimizes effects of cell number and health, transfection efficiency and nonspecific cellular responses. • Homogeneous Format: Perform fewer steps. Assay cells directly in growth medium for both reporters. No centrifugation or lysis steps required. • Stable Signal: Obtain flexibility for either batch or continuous processing of 96- and 384-well plates. Each luminescent signal can be measured for up to 2 hours after reagent addition. • Convenience: Screen efficiently with simple, two-step assay ideal for any luminometer. On-board injectors not required. • Wide Dynamic Range: Analyze high and low reporter activity without sample dilution. Linear over at least 6 logs of enzyme concentration for each reporter. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store Dual-Glo® Substrates at –20°C. Store Dual-Glo® Buffers below 25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 77 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com Dual-Luciferase® Reporter Assay System Product Size Cat.# Dual-Luciferase® Reporter Assay System 100 assays E1910 Dual-Luciferase® Reporter Assay System 10-Pack 1,000 assays E1960 Dual-Luciferase® Reporter 1000 Assay System 1,000 assays E1980 Available Separately Passive Lysis 5X Buffer 30 ml E1941 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Dual-Luciferase® Reporter (DLR™) Assay System provides an efficient means of performing two reporter assays. In the DLR™ Assay, the activities of firefly (Photinus pyralis) and Renilla (Renilla reniformis or sea pansy) luciferases are measured sequentially from a single sample. The firefly luciferase reporter is measured first by adding Luciferase Assay Reagent II (LAR II) to generate a luminescent signal lasting at least one minute. After quantifying the firefly luminescence, this reaction is quenched, and the Renilla luciferase reaction is initiated simultaneously by adding Stop & Glo® Reagent to the same sample. Both assays can be completed in about 4 seconds using a luminometer with reagent auto-injectors. In the DLR™ Assay System, both reporters yield linear assays with attomole (<10–18) sensitivities and no endogenous activity in the experimental host cells. Furthermore, the integrated format of the DLR™ Assay provides rapid quantitation of both reporters either in transfected cells or in cell-free transcription/translation reactions. For best results with the Dual-Luciferase® Assay, we recommend using a luminometer that has been validated for use with the assay. These luminometers are qualified as DLReady™. For a listing of qualified instruments, please visit the DLReady™ Validated Luminometers page. The pGL4 Luciferase Reporter Vectors are designed for use with the DLR™ Assay Systems. A Renilla luciferase vector with constitutive expression may be used in combination with any experimental firefly luciferase vector to cotransfect mammalian cells. Notice for Cat.# E1960 and E1980: Sufficient Passive Lysis Buffer is provided to perform 1,000 assays with cells grown in 96-well plates (typically 20μl of 1X PLB per well). For applications requiring more lysis reagent (e.g., >100μl/well), additional Passive Lysis Buffer may be purchased separately. Features: • Greater Accuracy: Renilla luciferase internal control allows more accurate results. • Convenience: Samples don’t have to be split; saves plates and time. • Sensitivity: Allows study of weak promoters, low-level expression/ regulation and expression in cells that transfect poorly. • Linearity: Range extends 7 logs; very active samples typically do not need dilution. Storage Conditions: Store at –20°C. ADCC Bioassays Product Size Cat.# ADCC Reporter Bioassay, Complete (Raji) 1 each G7015 ADCC Reporter Bioassay, Complete (WIL2-S) 1 each G7014 ADCC Reporter Bioassay, Core Kit 1 each G7010 ADCC Reporter Bioassay, Target (Raji) 1 each G7016 ADCC Reporter Bioassay, Target (WIL2-S) 1 each G7013 ADCC Reporter Bioassay, Core Kit 5X 1 each G7018 ADCC Bioassay Effector Cells, Propagation Model 1 each G7102 ADCC Reporter Bioassay, F Variant, Core Kit 1 each G9790 ADCC Reporter Bioassay, F Variant, Core Kit 5X 1 each G9798 ADCC Bioassay Effector Cells, F Variant, Propagation Model 1 each G9302 G7015, G7014, G7010, G7016, G7013, G7018 For Research Use Only. Not for Use in Diagnostic Procedures. G7102, G9790, G9798, G9302 Not For Medical Diagnostic Use. For additional information see page 236. Bio-Glo™ Luciferase Assay System Product Size Cat.# Bio-Glo™ Luciferase Assay System 100 ml G7940 10 ml G7941 Not For Medical Diagnostic Use. For additional information see page 233. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 78 For complete and up-to-date product information visit: www.promega.com ONE-Glo™ EX Luciferase Assay System Product Size Cat.# ONE-Glo™ EX Luciferase Assay System 10 ml E8110 100 ml E8120 10 × 10 ml E8130 10 × 100 ml E8150 For Research Use Only. Not for Use in Diagnostic Procedures. Description: High- or ultrahigh-throughput quantitation of firefly luciferase expression in mammalian cells is commonly performed by measuring luminescence from 96-, 384- or 1,536-well plates. The ONE-Glo™ EX Luciferase Assay System provides both the high sensitivity and long-lived luminescence required to batch-process multiple plates in these assay formats. The ONE-Glo™ EX Assay retains many of the beneficial aspects of the ONE-Glo™ Assay, using 5´-fluoroluciferin substrate with an add-mix-read, or homogeneous, protocol. Extending the properties of ONE-Glo™ Reagent, ONE-Glo™ EX Reagent employs a new assay chemistry to increase the stability of both the luminescence signal and the reconstituted reagent. The approximately 2-hour signal half-life provides greater flexibility in assay design. A reconstituted reagent that can be stored at room temperature for longer periods means less variability in reagent performance during long experiments or screens and less sample waste. ONE-Glo™ EX Reagent is the firefly luciferase detection reagent used in the Nano-Glo® Dual-Luciferase® Reporter (NanoDLR™) Assay System, allowing the same reagent to be used for singleor dual-luciferase assays. Features: • Experience Improved Handling: Increased stability of reconstituted reagent at room temperature or 4°C simplifies repeat use over long experiments and reduces waste; no odor-causing compounds in the reagent. • Achieve More Consistent Data: Bright and stable signal that can be measured for hours enables more constant luminescence readings; ideal for screening and batch processing. • Take Advantage of Workflow Flexibility: The homogenous firefly luciferase detection reagent can be used in both single- or dual-luciferase assays; compatible with any plate size up to 1,536-well format. • Notice Fewer Unwanted Effects from Sample Components: Reduced sensitivity to culture media, phenol red and luciferase inhibitors compared to other luciferase assays. Storage Conditions: Store the ONE-Glo™ EX Luciferase Assay reagents at –10°C to –30°C. Please refer to the Technical Manual for other short-term storage options. ONE-Glo™ Luciferase Assay System Product Size Cat.# ONE-Glo™ Luciferase Assay System 10 ml E6110 100 ml E6120 1 L E6130 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ONE-Glo™ Luciferase Assay System provides a highly sensitive, robust, homogeneous assay for detection of firefly luciferase reporter gene expression in mammalian cells. Ideally suited for high- and ultrahighthroughput applications, the ONE-Glo™ Assay contains a new luciferase substrate, resulting in a reagent that is more stable, more tolerant to sample components, and has less odor than standard luciferase assay reagents. These features ensure that the ONE-Glo™ Assay provides robust performance and also eliminates many of the handling inconveniences experienced using other reporter assays in a high-throughput setting. Features: • Simplified Assay Optimization: Robust performance, reduced odor, improved storage and larger available sizes. • Room Temperature or 4°C Storage: Extended stability of the ONEGlo™ Reagent makes it more convenient for everyday use. • Improved Assay Precision: The ONE-Glo™ Reagent is less sensitive to mixing and dispensing conditions, enhancing reproducibility. Ideal for use in high-density (384- and 1536-well) microplates. • Brighter, Longer-Lasting Signal: Optimized for batch and continuousprocess handling, the extended bright light output allows high sensitivity, especially for extended incubations. • Reduced Unwanted Effects from Sample Components: The ONEGlo™ Assay is less sensitive to culture media, phenol red and luciferase inhibitors than other luciferase assays. Storage Conditions: Store the ONE-Glo™ Luciferase Assay System components at –20°C. Please refer to the Technical Manual for other storage options, including room-temperature storage. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 79 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com ONE-Glo™ + Tox Luciferase Reporter and Cell Viability Assay Product Size Cat.# ONE-Glo™ + Tox Luciferase Reporter and Cell Viability Assay 1 plate E7110 10 plates E7120 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ONE-Glo™ + Tox Assay combines luciferase assay chemistry with a cell viability marker to better understand reporter gene expression in the context of cell health. The assay uses a two-step, additiononly process to make these measurements in a single well of a plate, negating the need to run parallel assays. The first part of the assay is a nonlytic fluorescence assay (CellTiter-Fluor™ Cell Viability Assay) that measures the relative number of live cells in a culture population after experimental manipulation. The CellTiter-Fluor™ Assay measures a conserved and constitutive protease activity within live cells and therefore serves as a marker of cell viability. The live-cell protease activity is restricted to intact viable cells and is measured using a fluorogenic, cellpermeant peptide substrate (glycylphenylalanyl-aminofluorocoumarin; GF-AFC). The substrate enters intact cells where it is cleaved by the live-cell protease to generate a fluorescent signal proportional to the number of living cells. This live-cell protease becomes inactive upon loss of cell membrane integrity and leakage into the surrounding culture medium. Fluorescence of the free AFC fluorophore is measured with a microplate reader or CCD imager using an excitation wavelength of 380–400nm and emission wavelength of 505nm. The second part of the assay uses the ONE-Glo™ Luciferase Assay System to quantify firefly luciferase reporter gene expression from cells made to express this reporter enzyme. The ONE-Glo™ Luciferase Assay Buffer and ONE-Glo™ Luciferase Assay Substrate, provided with this system, are combined to form the ONE-Glo™ Reagent. Ideally suited for high- and ultrahigh-throughput applications, the ONE-Glo™ Assay contains a new fluoroluciferin substrate, resulting in a more stable reagent, that is more tolerant to sample components, and has less odor than standard luciferase assay reagents. Luminescence is measured with a microplate reader or CCD imager. Features: • Acquire More Data: Measure cell viability and firefly luciferase expression in the same assay well. • Better Biology: Understand reporter gene expression in the context of cell viability. • Easy to Perform: The assay uses a simple sequential “add-mix-read” format. • Flexible and Automation-Friendly: The volumes of each assay component can be scaled to meet throughput needs, up to 1,536-well format. Storage Conditions: Store the ONE-Glo™ + Tox Luciferase Reporter and Cell Viability Assay components at –20°C. Please refer to the Technical Manual for other storage options. Steady-Glo® Luciferase Assay System Product Size Cat.# Steady-Glo® Luciferase Assay System 10 ml E2510 100 ml E2520 10 × 100 ml E2550 Available Separately Steady-Glo® 1X Solution 550 ml E3691 For Research Use Only. Not for Use in Diagnostic Procedures. Description: High-throughput quantitation of firefly (Photinus pyralis) luciferase expression in mammalian cells is commonly performed by batch processing of 96- and 384-well plates. Steady-Glo® Luciferase Assay System is designed for this purpose by providing long-lived luminescence when added to cultured cells. The homogeneous assay provides signal half-lives of over 5 hours in commonly used cell culture media without prior sample processing. Throughput rates of several thousand samples per hour may be achieved with high reproducibility under standard laboratory conditions. Features: • Greater Light Output: Greater assay sensitivity than other extendedlifetime firefly luciferase assay reagents. • Improved Assay Precision and Reproducibility: Less sensitive to mixing conditions in multiwell plates. Particularly useful in 384-well plates. • Convenience: Simply mix buffer with lyophilized substrate and add to cells in culture medium; no need to thaw or measure before use. • No Sample Preprocessing: No need to remove culture medium or wash cells prior to adding assay reagent. Grow cells and assay them directly within the same multiwell plate. • Easy to Use: Simply add reagent, which contains a cell lysis component, wait 5 minutes and measure luminescence. • Robust: Compatible with many tissue culture media, including those containing up to 10% serum. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store Steady-Glo® Luciferase Assay Substrate at –20°C. Store Steady-Glo® Luciferase Assay Buffer below 25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 80 For complete and up-to-date product information visit: www.promega.com Bright-Glo™ Luciferase Assay System Product Size Cat.# Bright-Glo™ Luciferase Assay System 10 ml E2610 100 ml E2620 10 × 100 ml E2650 For Research Use Only. Not for Use in Diagnostic Procedures. Description: High-throughput quantitation of firefly (Photinus pyralis) luciferase expression in mammalian cells requires highly sensitive reagents that can adapt to continuous-process robotic systems. Bright-Glo™ Luciferase Assay System is designed specifically to meet the needs of continuous-process systems by providing robust, homogeneous assay chemistry that achieves high assay sensitivity and approximately 30-minute signal half-life without prior sample processing. These attributes also benefit those of you who are using fewer samples but still require high sensitivity and ease of use. Features: • No Sample Preprocessing: No need to remove culture medium or wash cells prior to adding assay reagent. Grow and assay cells directly in the same multiwell plate. • Increased Sensitivity: Up to tenfold more light intensity than other homogeneous luciferase assay reagents. • Improved Assay Precision and Reproducibility: Less sensitive to mixing conditions, sample evaporation and pipetting errors. • Convenience: Simply mix buffer with lyophilized substrate and add to cells in culture medium; no need to thaw or measure before use. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store Bright-Glo™ Luciferase Assay Substrate at –20°C. Store Bright-Glo™ Luciferase Assay Buffer below 25°C. Glo Lysis Buffer, 1X Product Size Cat.# Glo Lysis Buffer, 1X 100 ml E2661 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Glo Lysis Buffer (GLB), 1X, is a proprietary formulation developed to promote rapid lysis (within 5 minutes) of cultured mammalian cells without scraping or performing freeze-thaw cycles. It is fully compatible with Bright-Glo™, Steady-Glo®, ONE-Glo™ and Renilla-Glo® Luciferase Assay Reagents and the Luciferase Assay Reagent for analysis of firefly luciferase expression. The half-life of these reagents remains the same with or without use of GLB, >5 hours for Steady-Glo® Reagent and >24 minutes for Bright-Glo™ Reagent. Features: • Convenient: No need for cell scraping or freeze-thaw cycles. • Fast: Cell lysis within 5 minutes. • Versatile: Use with Bright-Glo™, Steady-Glo®, ONE-Glo™ and Renilla-Glo® Luciferase Assay Reagents to provide nonhomogeneous assay formats or with other reporter applications. • Robust: Firefly luciferase enzyme in Glo Lysis Buffer is stable at room temperature for at least 48 hours. Storage Conditions: Store Glo Lysis Buffer at 4°C. For long-term storage, freeze Glo Lysis Buffer at –20°C or –70°C. Luciferase Assay System Product Size Cat.# Luciferase Assay System 100 assays E1500 Luciferase Assay System with Reporter Lysis Buffer 100 assays E4030 Luciferase Assay System, 10-Pack 1,000 assays E1501 Luciferase Assay System Freezer Pack 1,000 assays E4530 Luciferase 1000 Assay System 1,000 assays E4550 Luciferase Assay Reagent 100 ml E1483 Available Separately Luciferase Cell Culture Lysis 5X Reagent 30 ml E1531 Reporter Lysis 5X Buffer 30 ml E3971 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Luciferase Assay System is an extremely sensitive and rapid reagent for quantitation of firefly luciferase. Linear results are seen over at least eight orders of magnitude of enzyme concentration, and patented technology incorporated in the formulation enables less than 10–20 moles of luciferase to be measured under optimal conditions. Generally, 100-fold greater sensitivity can be achieved over the chloramphenicol acetyltransferase (CAT) assay. The Luciferase Assay Reagent generates light that is nearly constant for at least 1 minute and so is compatible with measuring firefly luciferase in a single-tube luminometer or in a multiwell plate luminometer with an auto-injector. The Luciferase Assay System is a nonhomogeneous assay system; the cells containing the luciferase must be lysed before reagent addition. Glo Lysis Buffer (Cat.# E2661), Cell Culture Lysis Reagent (Cat.# E1531), Passive Lysis Buffer (Cat.# E1941) and Reporter Lysis Buffer (Cat.# E3971) can be used with the Luciferase Assay System for reporter quantitation in mammalian cells. The Luciferase Assay System can also be used for quantitation in plant and bacterial cells, but only Cell Culture Lysis Reagent is suitable for these applications. Reporter Lysis Buffer enables firefly luciferase, CAT and β-galactosidase assays to be performed from the same cell extract. In some kits the lysis buffer is included, and in others it must be purchased separately. Features: • Linear: Eight or more orders of magnitude of enzyme concentration. • Sensitive: To 10–20 moles of luciferase. • Fast: Perform cell lysis, sample preparation and assays in as little as 5 minutes. • Convenient: Reporter Lysis Buffer enables luciferase, CAT and β-galactosidase assays to be performed from the same cell extract. • Simple Assay Procedure: Eliminates the need for autoinjection devices and rapid mixing protocols when using single-tube luminometers. • Versatile: Luminometer preferred, but not required; adaptable to scintillation counters. • Safe: Non-radioactive. • Superior: High performance compared to competitors’ luciferase assays. Storage Conditions: Store system at –20°C. Store Cat.# E1483 at –70°C. Reporter Lysis Buffer (Cat.# E3971) may be stored at room temperature. Store Cat.# E2661 at 4°C. For long-term storage, freeze Cat.# E2661 at –20°C or –70°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 81 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com Beetle Luciferin, Potassium Salt Product Size Cat.# Beetle Luciferin, Potassium Salt 5 mg E1601 50 mg E1602 250 mg E1603 1 g E1605 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferase genes from the North American firefly (Photinus pyralis) and from other beetles are commonly used as reporter genes for studying transcription regulation in transient assay systems and as markers for stably transformed eukaryotic cells. Beetle luciferin (also known as d-luciferin) is synthesized as the monopotassium salt and is a substrate for the beetle luciferase reporter systems. d-luciferin is provided for those researchers who prefer to formulate their own assay reagents for monitoring in vitro or in vivo luciferase activity. Formula: C11H7 N2 O3 S2 •K. Formula Weight: 318.4 (anhydrous). Features: • Formulation: Supplied as a potassium salt for easy preparation in aqueous buffer. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –70°C. Luciferin-EF™ Endotoxin-Free Luciferin Na Product Size Cat.# Luciferin-EF™ 25 mg E6551 250 mg E6552 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferin-EF™ is an endotoxin-free beetle luciferin that can be used for cell-based imaging applications in living systems, where endotoxin may create problems. Luciferin-EF™ is tested to ensure endotoxin is below detectable levels and packaged in amber vials with septa to facilitate easy dilution and use. Features: • Achieve Endotoxin Levels Below Detection Limits: No potential interference in assay due to the presence of endotoxins. • Be Assured of Product Integrity: Luciferin-EF™ is packaged in amber vials with septa to ensure product integrity as well as offer ease of dilution and use for imaging experiments. • Appreciate Flexibility and Convenience: Luciferin-EF™ is available in two sizes, depending on the number of experiments to be performed. Storage Conditions: Store at –70°C. Renilla-Glo® Luciferase Assay System Product Size Cat.# Renilla-Glo® Luciferase Assay System 10 ml E2710 100 ml E2720 10 × 100 ml E2750 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Renilla-Glo® Luciferase Assay System is a single-addition reagent that generates a glow-type signal with Renilla luciferase. When reconstituted, it has the capacity to lyse cells, reduce the autoluminescence of the coelenterazine substrate, and produce a stable signal (i.e., half-life greater than 60 minutes at 22°C). Features: • Simplify Your Assay Optimization: Add-and-read simplicity for a Renilla luciferase reporter system. • Improve Assay Precision: No need for separate lysis and reagent injection steps. • Get a Brighter, Longer-Lasting Signal: Extended bright light output is optimized for batch and continuous-process handling. • Reduced Autoluminescence: Low background formulation offers increased sensitivity. Storage Conditions: Store at –20°C. Renilla Luciferase Assay System Product Size Cat.# Renilla Luciferase Assay System 100 assays E2810 1,000 assays E2820 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Renilla Luciferase Assay System is designed to provide a fast and sensitive method of detecting luciferase from sea pansy (Renilla reniformis). The system is a convenient alternative to firefly (Photinus pyralis) reporter systems and is designed to yield reliable, linear results for a concentration range over 7 orders of magnitude. The Renilla Luciferase Assay System has been formulated with a proprietary composition that significantly reduces the effect of coelenterazine autoluminescence when compared to other reagents, making the reagent orders of magnitude more sensitive than published methods. This system enables measurements with wildtype and synthetic hRluc genes for primary expression or internal normalization measurements of gene expression. Features: • Reduced Autoluminescence: Low background, increased sensitivity. • Sensitive: Can detect 10–19 moles of Renilla luciferase. • Linear: Linear range extending 7 logs. • Unique: The first independent assay system for Renilla luciferase. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store the Renilla Luciferase Assay System at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 82 For complete and up-to-date product information visit: www.promega.com EnduRen™ Live Cell Substrate Product Size Cat.# EnduRen™ Live Cell Substrate 0.34 mg E6481 3.4 mg E6482 34 mg E6485 For Research Use Only. Not for Use in Diagnostic Procedures. Description: EnduRen™ Live Cell Substrate enables live cell kinetic measurements, streamlining assay development and multiplexing with other lytic assays. EnduRen™ Live Cell Substrate provides the ability to measure Renilla luciferase luminescence for at least 24 hours after substrate addition, with up to tenfold higher signal-to-background ratios than wildtype coelenterazines. EnduRen™ Live Cell Substrate is a uniquely engineered coelenterazine with protected oxidation sites, which minimizes substrate degradation and autoluminescence (background) in cell culture, while it extends the luminescent signal to accommodate microplates without the need for auto-injectors. The result is that EnduRen™ Live Cell Substrate overcomes the key limitations of wildtype coelenterazines by providing an automation-friendly, highly sensitive substrate for Renilla luciferase-based gene reporter and BRET applications. Features: • Live Cell Assay: Generate kinetic profiles for reporter gene, BRET and RNAi applications. • Kinetic Reporter Gene Analysis: Conserve test compounds as you create response profiles in real time to generate more data-rich results. • Streamlined Assay Development and Screening: Rapidly obtain optimal assay parameters through repeat measurements using only a single cell population. Increase your sample throughput using microplates without time-consuming per-sample reagent injection steps. • Designed for Multiplexing: Perform more dynamic experiments using the same sample set by pairing with any lytic assay. • High Signal-to-Background Ratios: Reliably quantitate low levels of expression for reporter gene detection and BRET. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. ViviRen™ Live Cell Substrate Product Size Cat.# ViviRen™ Live Cell Substrate 0.37 mg E6491 3.7 mg E6492 37 mg E6495 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ViviRen™ Live Cell Substrate is a uniquely engineered coelenterazine that generates three- to fivefold brighter Renilla luciferase luminescence than wildtype coelenterazine. Using live cells, achieve up to 100-fold higher signal-to-noise ratios for super-sensitive quantitation of reporter gene, BRET and RNAi activity. Cat.# E6491 is supplied as a liquid, 60mM in DMSO. Cat.# E6492 and E6495 are supplied as a lyophilized solid. Features: • Three- to Fivefold Brighter Renilla Luminescence than Coelenterazine: Quantitate with confidence using miniaturized formats, low-level expression and CCD imagers. • Low Autoluminescence: Achieve unparalleled sensitivity with up to 100-fold higher signal-to-noise ratios than coelenterazine. • Live Cell Assay: Generate kinetic profiles for reporter gene, BRET and RNAi applications. • Multiplex Options: Improve accuracy and precision by combining with CellTiter-Glo® and other lytic assays. Storage Conditions: Store Cat.# E6491 at –70°C. Store Cat.# E6492 and E6495 at –20°C. Coelenterazines Product Size Cat.# Coelenterazine 250 μg S2001 Coelenterazine-h 250 μg S2011 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferases from Renilla, Aequorea and other marine organisms are commonly used as indicators or reporters for studying cellular phenomena in expression assays in eukaryotic cells. Renilla luciferase is often used as a reporter of transcription regulation, whereas apoaequorin is often used as a calcium indicator. Other uses of coelenterazines include chemiluminescent detection of Reactive Oxygen Species (ROS) in cells or tissues. We offer the following coelenterazine analogs. Coelenterazine (native) is the luminescent substrate for Renilla luciferase and apoaequorin. Formula: C26H21N3 O3 . Formula Weight: 423.5. Form: Film. Coelenterazine-h imparts a luminescent intensity with its aequorin complex that is reported to be 10–20 times higher than that of native coelenterazine, making this derivative a useful tool for measuring small changes in Ca2+ concentrations. Formula: C26H21N3 O2 . Formula Weight: 407.5. Form: Film. Features: • Highly Pure: 95%. • Custom Capabilities: Custom packaging and sizes available. • Easy to Prepare: Supplied as a dried substrate for easy preparation in methanol or ethanol. • Choose Your Configuration: Learn more about custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 83 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer Product Size Cat.# β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer 10 ml E2000 Available Separately Reporter Lysis 5X Buffer 30 ml E3971 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer is a convenient method for assaying β-galactosidase activity in lysates prepared from cells transfected with β-galactosidase reporter vectors such as the pSV-β-Galactosidase Control Vector. The standard assay is performed by adding a dilute sample to an equal volume of Assay 2X Buffer that contains the substrate ONPG (o-nitrophenyl-β-dgalactopyranoside). Samples are incubated for at least 30 minutes, during which time the β-Galactosidase hydrolyzes the colorless substrate to o-nitrophenyl, which is yellow. The reaction can be terminated by addition of sodium carbonate, and the absorbance at 420nm is measured by spectrophotometry. Features: • Safe: Non-isotopic assay. • Versatile: The assay can be used in a 96-well plate format. • Flexible: Reporter Lysis Buffer allows firefly luciferase, CAT and β-galactosidase assays to be performed from the same cell extract. Storage Conditions: Reporter Lysis Buffer can be stored at room temperature. Store other system components at –20°C. QuantiLum® Recombinant Luciferase Product Size Conc. Cat.# QuantiLum® Recombinant Luciferase 1 mg 10–15 mg/ml E1701 5 mg 10–15 mg/ml E1702 For Research Use Only. Not for Use in Diagnostic Procedures. Description: QuantiLum® Recombinant Luciferase is a luciferase expressed from a cloned gene from the North American firefly (Photinus pyralis) that provides the reliability and dependability needed for performing research or producing kits using bioluminescence reagents to detect ATP or luciferin substrates. A recombinant source eliminates the possibility of seasonal and regional variability that may be found in luciferase purified from natural sources. Features: • Value: Product available in bulk for large orders to suit individual needs and requirements. • Reliable: Long-term supply assurance. • Consistent: Excellent lot-to-lot consistency. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –70°C. Avoid multiple freeze-thaw cycles. Beta-Glo® Assay System Product Size Cat.# Beta-Glo® Assay System 10 ml E4720 100 ml E4740 10 × 100 ml E4780 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Beta-Glo® Assay System is a homogeneous method of quantitating β-galactosidase expression in mammalian cells. The system provides a bright luminescent signal that is stable over several hours in commonly used cell culture medium without prior sample processing. The homogeneous assay procedure involves the addition of a single reagent directly to cells cultured in serum-supplemented medium. Throughput rates of several thousand samples per hour can be achieved with high reproducibility under standard laboratory conditions. Features: • Bright Luminescent Signal: Quantitate with confidence using low-volume formats or in samples with low-level expression. • Homogeneous Format: Perform fewer steps. Add a single reagent directly to cells in growth medium. • Stable Signal: Obtain flexibility and convenience when processing multiple plates. • Convenient: Achieve optimal assay performance at room temperature. • Flexible: Read the luminescent signal using any luminometer. Injectors are not required. • Choose Your Configuration: Learn more about custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 84 For complete and up-to-date product information visit: www.promega.com Genetic Reporter Vectors and Cell Lines NanoLuc® Genetic Reporter Vectors Product Size Conc. Cat.# pNL1.1[Nluc] Vector 20 μg N1001 pNL1.2[NlucP] Vector 20 μg N1011 pNL1.3[secNluc] Vector 20 μg N1021 pNL3.1[Nluc/minP] Vector 20 μg N1031 pNL3.2[NlucP/minP] Vector 20 μg N1041 pNL3.3[secNluc/minP] Vector 20 μg N1051 pNL2.1[Nluc/Hygro] Vector 20 μg N1061 pNL2.2[NlucP/Hygro] Vector 20 μg N1071 pNL2.3[secNluc/Hygro] Vector 20 μg N1081 pNL1.1.CMV[Nluc/CMV] Vector 20 μg N1091 pNL1.3.CMV[secNluc/CMV] Vector 20 μg N1101 pNL3.2.NF-κB-RE[NlucP/NF-κB-RE/Hygro] Vector 20 μg N1111 pNL3.2.CMV Vector 20 μg 1 µg/µl N1411 pNL1.1.PGK[Nluc/PGK] Vector 20 μg N1441 pNL1.1.TK[Nluc/TK] Vector 20 μg N1501 For Research Use Only. Not for Use in Diagnostic Procedures. Description: NanoLuc® (Nluc) luciferase is a small enzyme (19.1kDa) engineered for optimal performance as a luminescent reporter. The enzyme is about 100-fold brighter than either firefly (Photinus pyralis) or Renilla reniformis luciferase using a novel substrate, furimazine, to produce high intensity, glowtype luminescence. The luminescent reaction is ATP-independent and designed to suppress background luminescence for maximal assay sensitivity. For use as a genetic reporter, multiple forms of NanoLuc® luciferase have been configured to meet differing experimental objectives. Unfused Nluc offers maximal light output and sensitivity, NanoLuc®-PEST (NlucP) closely couples protein expression to changes in transcriptional activity and increased signal-to background ratios, and NanoLuc® luciferase fused to an N-terminal secretion signal (secNluc) is suitable when a secreted reporter is preferred. Luminescence is linearly proportional to the amount of NanoLuc® protein over a 1,000,000-fold concentration range, with a signal half-life ≥2 hours when detected with Nano-Glo® Luciferase Assay Reagent. NanoLuc® luciferase has a number of physical properties that make it an excellent reporter protein: • very small, monomeric enzyme (171 amino acids; 513bp) • high thermal stability (Tm = 60°C) • active over a broad pH range (pH 6–8) • no post-translational modifications or disulfide bonds • uniform distribution in cells • emission spectrum well suited for bioluminescence resonance energy transfer (BRET; λmax = 465nM). NanoLuc® luciferase is made available in a variety of plasmids designed for use in reporter gene assays of transcriptional control and with each of the NanoLuc® forms (unfused Nluc, PEST destabilized NlucP, and secreted secNluc). The different pNL variations are designed for the following: • pNL1: cloning of a known or putative promoter region • pNL2: cloning of a known or putative promoter region and establishment of a stable cell line through Hygromycin selection • pNL3: cloning of a binding site or response element not in need of a basic promoter (such as are present in the pNL3.2.NF-κB-RE vector) • Control plasmids for the unfused, PEST-destabilized and secreted Nluc forms also are available. The pNL vector series use a pGL4-based backbone for easy sequence transfer from existing plasmids. This backbone design also reduces anomalous results by removing many transcription factor binding sites and other potential regulatory elements. The Nluc gene variations are codon optimized and have had many potential regulatory elements or other undesirable features removed (such as common restriction enzyme sites). Storage Conditions: Store at –20°C. 10321MA pNL1.1[Nluc] Vector (3110bp) Ampr ori BglI/SfiI Acc65I KpnI EcoICRI SacI NheI BmtI XhoI EcoRV BglII BglI/SfiI HindIII 9 15 19 24 26 28 32 34 42 47 60 66 SV40 late poly(A) signal Synthetic poly(A) signal/transcriptional pause site (for background reduction) Nluc 894 888 SalI BamHI Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 85 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com NanoLuc® Protein Fusion Vectors Product Size Conc. Cat.# pFN31A Nluc CMV-Hygro Flexi® Vector 20 μg 1 µg/µl N1311 pFN31K Nluc CMV-neo Flexi® Vector 20 μg 1 µg/µl N1321 pFC32A Nluc CMV-Hygro Flexi® Vector 20 μg 1 µg/µl N1331 pFC32K Nluc CMV-neo Flexi® Vector 20 μg 1 µg/µl N1341 pNLF1-N [CMV/Hygro] Vector 20 μg 1 µg/µl N1351 pNLF1-C [CMV/Hygro] Vector 20 μg 1 µg/µl N1361 pNLF1-secN [CMV/Hygro] Vector 20 μg 1 µg/µl N1371 Transfection Carrier DNA 5 × 20 μg 1 µg/µl E4881 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The small size (19.1kDa) and extreme brightness (about 100-fold brighter than either firefly [Photinus pyralis] or Renilla reniformis) of NanoLuc® luciferase (Nluc) make it an ideal protein fusion partner. NanoLuc® fusion proteins can be used in a variety of applications including: reporters of protein stability, probes for bioluminescent cell imaging (BLI) or as the donor signal in bioluminescent resonance energy transfer (BRET) applications for protein:protein or protein:small-molecule interaction studies. The NanoLuc® protein fusion vectors enable simple generation of N or C terminal fusions of NanoLuc® luciferase with your protein of interest and are available in two formats to accommodate your cloning preferences: • pNLF Vector series: Generate N or C terminal fusions to the full-length Nluc protein or attach secreted Nluc to the N terminus of the protein of interest using traditional cloning with a multiple cloning site (MCS). • pF Vector series: Generate N or C terminal Nluc fusion proteins using the Flexi® Vector Cloning System—a directional cloning method based on two rare-cutting restriction enzymes, SgfI and PmeI, that provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence. Features: • Easily Quantify Changes in Protein Abundance: Use the singleaddition Nano-Glo® Luciferase Assay System to quantify the signal from NanoLuc® fusion proteins to measure intracellular protein levels. • Obtain Improved Biological Relevance: Bright NanoLuc® reporter enables endogenous expression levels of NanoLuc® fusion proteins to avoid overexpression artifacts. • Visualize Intracellular Protein Dynamics: Bright NanoLuc® reporter enables reduced imaging exposure times without the need for repeated sample excitation, which can result in cytotoxic artifacts. • Improve BRET Studies: The brighter signal and blue-shifted emission spectrum from NanoLuc® luciferase result in less spectral overlap with fluorescent acceptors, resulting in better signal:background and dynamic range for BRET applications. • Flexible Cloning Options: Easily attach NanoLuc® luciferase to the N or C terminus of your protein of interest using either traditional or Flexi® cloning systems. • Easily Transition from Transient to Stable Cells: All vectors contain a mammalian selectable marker to create a stable line. Storage Conditions: Store at –20°C. NanoLuc® Stability Sensors for Cell Signaling Product Size Conc. Cat.# pNLF1-HIF1A [CMV/neo] Vector 1 each 1 µg/µl N1381 pNLF1-NRF2 [CMV/neo] Vector 1 each 1 µg/µl N1391 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The rate of protein turnover is tightly regulated for many signaling proteins involved in oncogenesis and response to cellular stress. Protein stabilization and subsequent accumulation occurs in response to changing cellular conditions resulting in activation of downstream transcriptional events. The NanoLuc® Stability Sensors are ready-to-use vector systems that utilize the advantages of the NanoLuc® luciferase reporter to enable stability studies of two key signaling proteins, HIF1A and NRF2, providing a method to directly measure this primary signaling event. HIF1A Vector System: The HIF1A Vector System enables simple quantification of intracellular HIF1A protein levels to study the dynamics of this signaling protein in mediating cellular response to hypoxia. It contains a vector encoding NanoLuc® fused to the C terminus of the HIF1A protein under control of the CMV promoter plus Transfection Carrier DNA to allow titratable intracellular fusion protein expression. NRF2 Vector System: The NRF2 Vector System enables simple quantification of intracellular NRF2 protein levels to study the dynamics of this signaling protein in mediating cellular response to oxidative stress. It contains a vector encoding NanoLuc® fused to the C terminus of the NRF2 protein under the control of the CMV promoter, a pKEAP1-expressing vector for proper regulation of intracellular NRF2 levels and Transfection Carrier DNA for titratable intracellular fusion protein expression. Features: • Ready to Use: Constructs are predesigned, optimized and tested for low endotoxin levels. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 86 For complete and up-to-date product information visit: www.promega.com Coincidence Reporter Vectors Product Size Cat.# pNLCoI1[luc2-P2A-NlucP/Hygro] Vector 20 μg N1461 pNLCoI2[luc2-P2A-NlucP/minP/Hygro] Vector 20 μg N1471 pNLCoI3[luc2-P2A-NlucP/CMV/Hygro] Vector 20 μg N1481 pNLCoI4[luc2-P2A-NlucP/PGK/Hygro] Vector 20 μg N1491 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferase-based reporter-gene assays remain a useful and powerful method of high-throughput compound screening. However, false hits that result from direct interaction of compounds with the luciferase reporter can result in unnecessary follow-up efforts. The pNLCoI Vectors comprise a secondgeneration coincidence reporter vector system that allow expression of both firefly luciferase (luc2) and NanoLuc® Luciferase fused to a PEST destabilization domain (NlucP) from the same mRNA transcript. The stoichiometric expression of both luciferases is achieved by use of the P2A sequence from porcine teschovirus-1, which promotes a ribosomal skip and expression of the two unfused enzymes with distinct compound interaction profiles. When used in high-throughput compound screening, false hits caused by direct interaction with one or the other luciferases can be distinguished from true hits that show a similar response for both, reducing workload associated with follow-up screens. The pNLCoI Vectors are designed for use with the Nano-Glo® Dual-Luciferase® Reporter (NanoDLR™) Assay System, which allows sequential detection of firefly and NanoLuc® Luciferase in activity in the same sample. Both reagents provide stable glow-type luminescence signals with half-lives of approximately two hours allowing batch processing of samples and amenable to assays or screens in 96-, 384- or 1,536-well plate formats. Potent inhibition of firefly luciferase coupled with the high-intensity luminescence of NanoLuc® luciferase maximizes sensitivity for detection of both reporters. Features: • Improve Confidence and Save Time: Use of two different transcriptional reporters reduces false hit rates, increases the identification of true biological hits and eliminates time wasted on false-positive follow-up. • Employ Robust and Sensitive Reporter Pair: luc2 and NlucP provide a bright reporter combination compatible with low-copy-number and plate scale-up, and provide greater signal-to-background compared to other reporters. • Efficiently Identify False Hits: Firefly and NanoLuc® luciferase have dissimilar profiles of compound interference, enabling the identification of more false-positives than when either reporter is used alone. • Use Simple Detection Format: Convenient “add-read-add-read” homogeneous format of NanoDLR™ assay is ideal for automation and HTS approaches. Storage Conditions: Store at –20°C. Promoter-Driven Control Firefly and NanoLuc® Luciferase Vectors Product Size Cat.# pGL4.53[luc2/PGK] Vector 20 μg E5011 pGL4.54[luc2/TK] Vector 20 μg E5061 pGL4.50[luc2/CMV/Hygro] Vector 20 μg E1310 pGL4.51[luc2/CMV/Neo] Vector 20 μg E1320 pGL4.13[luc2/SV40] Vector 20 μg E6681 pNL1.1.PGK[Nluc/PGK] Vector 20 μg N1441 pNL1.1.TK[Nluc/TK] Vector 20 μg N1501 pNL1.1.CMV[Nluc/CMV] Vector 20 μg N1091 Available Separately Nano-Glo® Dual-Luciferase® Reporter Assay/pNL1.1.TK Bundle 1 each N1521 Nano-Glo® Dual-Luciferase® Reporter Assay/pNL1.1.PGK Bundle 1 each N1531 Nano-Glo® Dual-Luciferase® Reporter Assay/pGL4.54[luc2/TK] Bundle 1 each N1541 Nano-Glo® Dual-Luciferase® Reporter Assay/pGL4.53[luc2/PGK] Bundle 1 each N1551 NanoDLR/pNL1.1.TK Helix® Bundle 1 each N1561 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The promoter-driven firefly (Fluc) and NanoLuc® (Nluc) control vectors can be used to co-transfect with experimental luciferase vectors when using the Nano-Glo® Dual-Luciferase® Reporter (NanoDLR™) Assay System. NanoLuc® luciferase is a small (19.1kDa), stable reporter enzyme that can be up to 100-fold more sensitive than the flash-type Renilla signal in the DLR™ Assay and more than 3,000-fold more sensitive than the Renilla signal in the Dual-Glo® Assay. The increased brightness of the NanoLuc® Luciferase allows you to use less control DNA, minimizing assay artifacts and providing a stable control signal for normalization of the experimental Fluc reporter. Firefly luciferase, which is derived from Photinus pyralis, can be used be used as the control when NanoLuc® Luciferase is the experimental reporter. The luc2 gene that encodes Fluc is optimized for mammalian expression. The vectors are engineered with minimal consensus transcription factor-binding sites to reduce anomalous expression. Learn more information about the Nano-Glo® Dual-Luciferase® Reporter (NanoDLR™) Assay System. Features: • Experience Assay Design Flexibility: The NanoDLR™ Assay is compatible with multiple experimental configurations. Use either Fluc or Nluc as the experimental reporter and normalize with either the Nluc or Fluc control, respectively. • Minimize Assay Artifacts: Increased brightness of Fluc and Nluc reporters requires less control DNA to be transfected. • Achieve Appropriate Expression Level: Multiple promoter options are available to obtain appropriate levels of the control reporter in your experimental system. • Transition Easily: The NanoDLR™ Assay uses the same protocol as the popular Dual-Glo® Luciferase Assay, with improved sensitivity, performance and convenience. Control vectors are ready to substitute into your assay. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 87 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com Promoter-Driven Control Firefly and Renilla Luciferase Vectors Product Size Cat.# pGL4.50[luc2/CMV/Hygro] Vector 20 μg E1310 pGL4.51[luc2/CMV/Neo] Vector 20 μg E1320 pGL4.13[luc2/SV40] Vector 20 μg E6681 pGL4.53[luc2/PGK] Vector 20 μg E5011 pGL4.54[luc2/TK] Vector 20 μg E5061 pGL4.73[hRluc/SV40] Vector 20 μg E6911 pGL4.74[hRluc/TK] Vector 20 μg E6921 pGL4.75[hRluc/CMV] Vector 20 μg E6931 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Promoter-driven Renilla control vectors are commonly co-transfected with experimental firefly luciferase vectors for use in the Dual-Luciferase® or Dual-Glo® Reporter Assay Systems. The control Renilla vectors should give an almost invariant level of activity, while the experimental firefly vector varies with treatment. The promoter-driven pGL4.13 firefly vector can be used in situations where the experimental vector is designed in a Renilla vector. The pGL4.50 and pGL4.51 are useful for tagging a cell line and offer a selectable marker for creating stable transfectants. The pGL4.50 and pGL4.51 vectors are ideal for tagging cell lines for use in in vivo bioluminescent imaging applications. Features: Improved Sensitivity and Biological Relevance Due to: • Increased Reporter Gene Expression: Codon optimization of synthetic genes for mammalian expression. • Reduced Background and Risk of Expression Artifacts: Removal of cryptic DNA regulatory elements and transcription factor binding sites. • Improved Temporal Response: Rapid Response™ technology available using destabilized luciferase genes. Additional Advantages Include: • Flexible Detection Options: Choice of either synthetic luc2 (Photinus pyralis) or hRluc (Renilla reniformis) reporter genes. • Easy Transition from Transient to Stable Cells: Choice of mammalian selectable markers. • Easy Transfer from Vector to Vector: Common multiple cloning site and a unique SfiI transfer scheme. Storage Conditions: Store at –20°C. Promoterless Firefly Luciferase Vectors Product Size Cat.# pGL4.10[luc2] Vector 20 μg E6651 pGL4.11[luc2P] Vector 20 μg E6661 pGL4.12[luc2CP] Vector 20 μg E6671 pGL4.14[luc2/Hygro] Vector 20 μg E6691 pGL4.15[luc2P/Hygro] Vector 20 μg E6701 pGL4.16[luc2CP/Hygro] Vector 20 μg E6711 pGL4.17[luc2/Neo] Vector 20 μg E6721 pGL4.18[luc2P/Neo] Vector 20 μg E6731 pGL4.19[luc2CP/Neo] Vector 20 μg E6741 pGL4.20[luc2/Puro] Vector 20 μg E6751 pGL4.21[luc2P/Puro] Vector 20 μg E6761 pGL4.22[luc2CP/Puro] Vector 20 μg E6771 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Promoterless firefly luciferase vectors are designed primarily to accept a putative promoter element for investigation of important regions controlling gene transcription. The promoterless vectors are available with three varieties of engineered firefly luciferase genes: luc2, luc2P or luc2CP. The luc2 gene is engineered to remove most cryptic transcription factor binding sites and improve mammalian expression through codon optimization. The luc2P and luc2CP and RapidResponse™ genes are luc2 genes appended with degradation sequences to influence the cellular half-life of the luc2 gene. The RapidResponse™ genes respond more rapidly to stimuli but at the expense of signal intensity. The luc2P (1-hour half-life) gene responds more rapidly than luc2 (3-hour half-life) with moderate signal intensity, and the luc2CP (0.4-hour half-life) responds more quickly with the lowest signal intensity. The promoterless vectors are available with or without selectable markers (hygromycin, neomycin or puromycin). Features: Improved Sensitivity and Biological Relevance Due to: • Increased Reporter Gene Expression: Codon optimization of synthetic genes for mammalian expression. • Reduced Background and Risk of Expression Artifacts: Removal of cryptic DNA regulatory elements and transcription factor binding sites. • Improved Temporal Response: Rapid Response™ technology available using destabilized luciferase genes. Additional Advantages Include: • Flexible Detection Options: Choice of either synthetic luc2 (Photinus pyralis) or hRluc (Renilla reniformis) reporter genes. • Easy Transition from Transient to Stable Cells: Choice of mammalian selectable markers. • Easy Transfer from Vector to Vector: Common multiple cloning site and a unique SfiI transfer scheme. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 88 For complete and up-to-date product information visit: www.promega.com Promoterless Renilla Luciferase Vectors Product Size Cat.# pGL4.70[hRluc] Vector 20 μg E6881 pGL4.71[hRlucP] Vector 20 μg E6891 pGL4.72[hRlucCP] Vector 20 μg E6901 pGL4.76[hRluc/Hygro] Vector 20 μg E6941 pGL4.77[hRlucP/Hygro] Vector 20 μg E6951 pGL4.78[hRlucCP/Hygro] Vector 20 μg E6961 pGL4.79[hRluc/Neo] Vector 20 μg E6971 pGL4.80[hRlucP/Neo] Vector 20 μg E6981 pGL4.81[hRlucCP/Neo] Vector 20 μg E6991 pGL4.82[hRluc/Puro] Vector 20 μg E7501 pGL4.83[hRlucP/Puro] Vector 20 μg E7511 pGL4.84[hRlucCP/Puro] Vector 20 μg E7521 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Promoterless Renilla luciferase vectors are designed primarily to accept a putative promoter element for investigation of important regions controlling gene transcription. Alternatively, they may be used as promoterless control vectors in a dual-reporter system with a firefly luciferase vector serving as the experimental vector. The promoterless vectors are available with three varieties of engineered Renilla luciferase genes: hRluc, hRlucP or hRlucCP. The hRluc gene is engineered to remove most cryptic transcription factor binding sites and improve mammalian expression through codon optimization. The hRlucP and hRlucCP and RapidResponse™ genes are hRluc genes appended with degradation sequences to influence the cellular half-life of the hRluc gene. The RapidResponse™ genes respond more rapidly to stimuli but at the expense of signal intensity. The hRlucP gene responds more rapidly than hRluc2 with moderate signal intensity, and the hRlucCP responds more quickly with the lowest signal intensity. The promoterless vectors are available with or without selectable markers (hygromycin, neomycin or puromycin). Features: Improved Sensitivity and Biological Relevance Due to: • Increased Reporter Gene Expression: Codon optimization of synthetic genes for mammalian expression. • Reduced Background and Risk of Expression Artifacts: Removal of cryptic DNA regulatory elements and transcription factor binding sites. • Improved Temporal Response: Rapid Response™ technology available using destabilized luciferase genes. Additional Advantages Include: • Flexible Detection Options: Choice of either synthetic luc2 (Photinus pyralis) or hRluc (Renilla reniformis) reporter genes. • Easy Transition from Transient to Stable Cells: Choice of mammalian selectable markers. • Easy Transfer from Vector to Vector: Common multiple cloning site and a unique SfiI transfer scheme. Storage Conditions: Store at –20°C. Signaling Pathway Analysis (Minimal Promoter-Driven) Firefly Luciferase Vectors Product Size Cat.# pGL4.37[luc2P/ARE/Hygro] Vector 20 μg E3641 pGL4.38[luc2P/p53 RE/Hygro] Vector 20 μg E3651 pGL4.39[luc2P/ATF6 RE/Hygro] Vector 20 μg E3661 pGL4.40[luc2P/MRE/Hygro] Vector 20 μg E4131 pGL4.41[luc2P/HSE/Hygro] Vector 20 μg E3751 pGL4.42[luc2P/HRE/Hygro] Vector 20 μg E4001 pGL4.43[luc2P/XRE/Hygro] Vector 20 μg E4121 pGL4.44[luc2P/AP1 RE/Hygro] Vector 20 μg E4111 pGL4.45[luc2P/ISRE/Hygro] Vector 20 μg E4141 pGL4.47[luc2P/SIE/Hygro] Vector 20 μg E4041 pGL4.48[luc2P/SBE/Hygro] Vector 20 μg E3671 pGL4.49[luc2P/TCF-LEF RE/Hygro] Vector 20 μg E4611 pGL4.52[luc2P/STAT5RE/Hygro] Vector 20 μg E4651 pGL4.29[luc2P/CRE/Hygro] Vector 20 μg E8471 pGL4.30[luc2P/NFAT-RE/Hygro] Vector 20 μg E8481 pGL4.32[luc2P/NF-κB-RE/Hygro] Vector 20 μg E8491 pGL4.33[luc2P/SRE/Hygro] Vector 20 μg E1340 pGL4.34[luc2P/SRF-RE/Hygro] Vector 20 μg E1350 Available Separately pGL4.23[luc2/minP] Vector 20 μg E8411 pGL4.24[luc2P/minP] Vector 20 μg E8421 GloResponse™ NFAT-RE-luc2P HEK293 Cell Line 2 vials E8510 GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line 2 vials E8520 pGL4.25[luc2CP/minP] Vector 20 μg E8431 pGL4.26[luc2/minP/Hygro] Vector 20 μg E8441 pGL4.27[luc2P/minP/Hygro] Vector 20 μg E8451 pGL4.28[luc2CP/minP/Hygro] Vector 20 μg E8461 GloResponse™ CRE-luc2P HEK293 Cell Line 2 vials E8500 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Creating a cell line with an indicator of a functional signaling pathway is useful for deciphering the components in a signaling pathway. These tools are made by insertion of multiple repeats of a response element upstream of a minimal promoter (minP). Promega has designed vectors that report the activity of a variety of pathways using the optimized luc2 firefly luciferase gene in the pGL4 backbone. These vectors also have a hygromycin resistance selectable marker, allowing use either in transient transfection experiments or for selection of a stable cell line. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 89 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com Available vectors and the pathways each can measure: Also available for construction of pathway reporters are minimal promoter (minP) vectors with three varieties of engineered firefly luciferase genes: luc2, luc2P or luc2CP. The luc2 gene is engineered to remove most cryptic transcription factor binding sites and improve mammalian expression through codon optimization. The luc2P and luc2CP and RapidResponse™ genes are luc2 genes appended with degradation sequences to influence the cellular half-life of the luc2 gene. The RapidResponse™ genes respond more rapidly to stimuli but at the expense of signal intensity. The luc2P (1-hour half-life) gene responds more rapidly than luc2 (3-hour half-life) with moderate signal intensity, and the luc2CP (0.4-hour half-life) responds more quickly with the lowest signal intensity. The minP vectors are available with or without selectable markers (hygromycin). To speed research, several pre-designed response element vectors based on the pGL4.27 Vector are available. Some of these also are available stable cell lines (GloResponse™ Cell Lines). Features: • Pre-designed vectors remove the need to clone and validate an assay. • Increased Reporter Gene Expression: Codon optimization of synthetic genes for mammalian expression. • Reduced Background and Risk of Expression Artifacts: Removal of cryptic DNA regulatory elements and transcription factor binding sites. • Improved Temporal Response: Rapid Response™ technology using destabilized luciferase genes. • Easy Transition from Transient to Stable Cells: Choice of mammalian selectable markers. Storage Conditions: Store at –20°C. Nuclear Receptor Analysis Luciferase Vectors Product Size Cat.# pGL4.36[luc2P/MMTV/Hygro] Vector 20 μg E1360 pFN26A (BIND) hRluc-neo Flexi® Vector 20 μg E1380 pBIND-ERα Vector 20 μg E1390 pBIND-GR Vector 20 μg E1581 pGL4.35[luc2P/9XGAL4UAS/Hygro] Vector 20 μg E1370 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Nuclear receptor analysis can be performed with traditional means, using a minimal promoter vector with nuclear receptor response elements upstream. Alternatively, you can use viral elements like the mouse mammary tumor virus long terminal repeat promoter to judge androgen or glucocorticoid responses (e.g., pGL4.36). In many cases, use of these methods requires a cell line with the appropriate endogenous nuclear receptors, meaning you may need different cell lines for each nuclear receptor study. A method using the principles of the yeast two-hybrid system was adapted for nuclear receptor work. The nuclear receptor ligand binding domain is fused to the GAL4 DNA binding domain and transfected with a firefly luciferase vector containing repeats of the GAL4 upstream activation sequence upstream of a minimal promoter. The ligand binding domain is responsible for ligand binding, homo- or heterodimerization and interactions with co-activator or co-repressors. The one-hybrid method allows you work with any cell line and nuclear receptor you desire. Features: • Robust: GAL4-based system removes background signals from endogenous receptors. • More Sensitive: Optimized 9X Gal4 gives improved responses, better signal:noise ratio. • Adaptable: Combination Renilla/Neomycin marker allows normalization with Dual-Luciferase® Assay or selectable markers for generating stable cell lines, all with one vector. • Consistent: Compare or profile all nuclear receptors with a single experimental system. • Faster Results: Destabilized and optimized luc2P luciferase gene allows greater sensitivity and shorter induction times. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 90 For complete and up-to-date product information visit: www.promega.com pmirGLO Dual-Luciferase miRNA Target Expression Vector Product Size Cat.# pmirGLO Dual-Luciferase miRNA Target Expression Vector 20 μg E1330 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pmirGLO Vector is designed to quantitatively evaluate microRNA (miRNA) activity by the insertion of miRNA target sites downstream or 3´ of the firefly luciferase gene (luc2). Firefly luciferase is the primary reporter gene; reduced firefly luciferase expression indicates the binding of endogenous or introduced miRNAs to the cloned miRNA target sequence. This vector is based on Promega dual-luciferase technology, with luc2 used as the primary reporter to monitor mRNA regulation and Renilla luciferase (hRluc-neo) acting as a control reporter for normalization and selection. Features: • Measure miRNA Function: Reporter activity correlates with miRNA activity. • Optimized Reporter Genes: luc2 gene provides highest expression. • Combination Renilla/Neomycin Marker: Normalize with DualLuciferase® Assay or for stable cell lines, all with one vector. • Biologically Relevant Results: The moderate-strength PGK promoter provides sensitive analysis not possible with strong promoters. Storage Conditions: Store at –20°C. pRL Renilla Luciferase Control Reporter Vectors Product Size Cat.# pRL-SV40 Vector 20 μg E2231 pRL-TK Vector 20 μg E2241 pRL-CMV Vector 20 μg E2261 pRL-null Vector 20 μg E2271 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pRL Vectors are wildtype Renilla luciferase (Rluc) control reporter vectors. The pRL Vectors, which provide constitutive expression of Renilla luciferase, can be used in combination with a firefly luciferase vector to cotransfect mammalian cells. Expression of Renilla luciferase provides an internal control value to which expression of the experimental firefly luciferase reporter gene may be normalized. The pRL Vectors contain the cDNA encoding Renilla luciferase (Rluc) cloned from the anthozoan coelenterate Renilla reniformis (sea pansy). Four different promoter configurations are available. The HSV-thymidine kinase promoter (pRL-TK) is relatively weak and may be particularly useful in providing neutral constitutive expression of the Renilla luciferase control reporter. The early SV40 enhancer/promoter region (pRLSV40) and the CMV immediate early enhancer/promoter region (pRL-CMV) typically provide high-level transcription and, therefore, may be less suitable for co-reporter applications involving experimental vectors with robust regulatory elements. In general, we recommend validating the performance of specific co-reporter combinations in the desired target cells. In addition to the modified Rluc reporter gene, all pRL Vectors are isolated from a dam–/dcm– E. coli K host strain, allowing digestion with restriction enzymes that are sensitive to dam and dcm methylation. Features: • A T7 promoter is located immediately upstream of Rluc, allowing in vitro synthesis of Renilla luciferase. • The SV40 late poly(A) signal sequence is positioned downstream of Rluc to provide efficient transcription termination and mRNA polyadenylation. • A prokaryotic origin of replication and β-lactamase gene allow selected propagation of the pRL vectors in E. coli host strains. • To avoid DNA methylation, all pRL Vectors are isolated from a dam–/dcm– E. coli K host strain. Storage Conditions: Store vectors at –20°C. T7 Promoter Rluc SV40 late poly(A) Ampr ori 1247 XbaI Csp45I 315 NheI 299 BamHI 1499 pRL-null Vector (3320bp) 1 5 12 10 15 24 30 32 34 41 47 51 58 65 67 77 BglII XhoI SacI EcoICR I HindIII NdeI NsiI SphI SpeI NarI SalI MluI EcoRI XmaI SmaI PstI 1352VA01_6A Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 91 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com pGL3 Luciferase Reporter Vectors Product Size Cat.# pGL3-Basic Vector 20 μg E1751 pGL3-Control Vector 20 μg E1741 pGL3-Enhancer Vector 20 μg E1771 pGL3-Promoter Vector 20 μg E1761 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGL3 Luciferase Reporter Vectors provide a basis for the quantitative analysis of factors that potentially regulate mammalian gene expression. These may be cis- or trans-acting factors. The backbone of the pGL2 Luciferase Reporter Vectors was redesigned for the pGL3 Vectors for increased expression, with a modified coding region for firefly (Photinus pyralis) luciferase that has been optimized for monitoring transcriptional activity in transfected eukaryotic cells. The assay of this genetic reporter is rapid, sensitive and quantitative. In addition, the Luciferase Reporter Vectors contain numerous features aiding in the structural characterization of the putative regulatory sequences under investigation. For the most advanced reporter vectors and widest selection of features, please see the pGL4 Luciferase Reporter Vectors. Features: • Easy to Use: NcoI site located at 5´ end of luc+ gene allows creation of fusions with reporter gene using a unique NcoI site. • Flexible: Placement of SmaI site in the MCS allows blunt-ended inserts to be ligated into the MCS and restricted on either side by other restriction endonucleases. • Versatile: XbaI site just downstream of luc+ gene facilitates insertions into the 3´ untranslated region of mRNA or subcloning of the luciferase gene. Storage Conditions: Store vectors at –20°C. SV40 Enhancer XbaI 1934 Ampr KpnI SacI MluI NheI SmaI XhoI BgIII 5 11 15 21 28 32 36 pGL3-Control Vector (5256bp) f1 ori ori SalI BamHI 2448 2442 NarI 313 NcoI 278 HindIII 245 luc+ SV40 Promoter SV40 late poly(A) signal (for luc+ reporter) HpaI 2094 Synthetic poly(A) signal / transcriptional pause site (for background reduction) 0747VA08_4A pGL2 Luciferase Reporter Vectors Product Size Cat.# pGL2-Basic Vector 20 μg E1641 pGL2-Control Vector 20 μg E1611 pGL2-Enhancer Vector 20 μg E1621 pGL2-Promoter Vector 20 μg E1631 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGL2 Luciferase Reporter Vectors provide a basis for the quantitative analysis of factors that potentially regulate mammalian gene expression. These factors may be cis-acting, such as promoters and enhancers, or trans-acting, such as various DNA-binding factors. The pGL2 Vectors carry the coding region for firefly (Photinus pyralis) luciferase, which is used to monitor transcriptional activity in transfected eukaryotic cells. The assay of this genetic reporter is rapid, sensitive and quantitative. In addition, the pGL2 Vectors contain numerous features that aid in the characterization and mutagenesis of the putative regulatory sequences. Features: • Versatile: Deletions and site-directed mutations can be made directly to inserted DNAs without subcloning. • Convenient: All vectors contain the firefly luciferase reporter gene, which enables sensitive and rapid quantitation of reporter activity. • Low Background: Upstream polyadenylation signal minimizes spurious transcription of the reporter gene. Storage Conditions: Store vector at –20°C. Store bacterial strain at –70°C. SalI BamHI 3194 3188 SV40 Enhancer poly(A) signal (for luc reporter) 2236 PflMI SV40 luc HindIII 239 SV40 Promoter SmaI KpnI SacI MluI NheI XhoI BglII 3 12 18 22 28 33 37 poly(A) signal (for background reduction) f1 ori Ampr pGL2-Control Vector (6047bp) 0317VA03_3A Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 92 For complete and up-to-date product information visit: www.promega.com pGEM®-luc DNA Product Size Cat.# pGEM®-luc DNA 20 μg E1541 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-luc Vector is a cassette vector designed to be a source of the luc gene encoding firefly luciferase, which is found in the pGL2 Vectors. The plasmid is not intended for the expression of luciferase in eukaryotic or prokaryotic cells. The pGEM®-luc Vector was constructed by positioning the luciferase gene (luc) in the center of the multiple cloning region of the pGEM®-11Zf(–) Vector, providing a number of unique restriction sites at both ends of the gene. Sites that are surrounded by parentheses are not unique, as additional sites for each also exist in the luciferase gene. Note also that using HindIII or NsiI to clone the luciferase gene will include upstream ATG codons, which may reduce the efficiency of expression in eukaryotes. The luciferase cassette does not contain the prokaryotic Shine-Delgarno sequence for bacterial expression. The pGEM®-luc Vector is supplied with a glycerol stock of bacterial strain JM109. Features: • Flexibility: Provides a luciferase cassette with several unique cloning sites at both ends for analysis of transcriptional activity, mRNA processing, protein structure/function, or labeling of cells and viruses. Storage Conditions: Store vector at –20°C. Store bacterial strain at –70°C. EcoNI 135 ori Ampr f1 ori SP6 ➞ SfiI SacI (EcoRI) SalI XhoI StuI T7 17 27 29 35 41 47 ➞ BspMI 351 ClaI 386 EcoRV 415 PpuMI 571 KasI/NarI BstEII 1141 1717/1718 lacZ′ ScaI 3552 XmnI 3671 AatII 3994 NdeI 4243 NaeI 4423 DraIII 4529 HindIII luc NsiI NotI (XbaI) ApaI BamHI start 1803 1790 1788 1777 1769 1767 1757 (EcoRI) 1162 (XbaI) 1702 1 start pGEM-luc Vector (4931bp) Bsu36I 1137 0392VA05_3A GloResponse™ Luciferase Reporter Cell Lines Product Size Cat.# GloResponse™ CRE-luc2P HEK293 Cell Line 2 vials E8500 GloResponse™ NFAT-RE-luc2P HEK293 Cell Line 2 vials E8510 GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line 2 vials E8520 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloResponse™ Luciferase Reporter Cell Lines contain optimized, state-of-the-art luciferase reporter technology integrated into a cell line. This allows the rapid development of a reporter assay based on the pathway of interest regulating the luciferase gene. Assays configured using the GloResponse™ Cell Lines are amenable for high-throughput screening. These assays typically have greater response dynamics (fold of induction) than other assay formats and good quality as indicated by the high Z´ values. GloResponse™ Cell Lines were developed to study a variety of signaling pathways. Activators of these pathways may be native to the HEK293 cell line. Activity of non-native activators can be studied after they have been introduced by transfection. GPCRs regulate a wide-range of biological functions and are one of the most important target classes for drug discovery. GPCR signaling pathways can be categorized into three classes based on the G protein α-subunit involved: Gs, Gi/o and Gq. The GloResponse™ CRE-luc2P HEK293 Cell Line can be used to study and configure screening assays for Gs- and Gi/o-coupled GPCRs, which signal through cAMP and the cAMP Response Element (CRE). For Gq-coupled GPCRs, which signal through calcium ion release and activate the Nuclear Factor of Activated T-Cells response element (NFAT-RE), the GloResponse™ NFAT-RE-luc2P HEK293 Cell Line should be used. NF-κB-REs are the DNA binding sequences for the NF-κB transcription factor complex, which is responsible for regulating inflammation, immune response, cell growth and apoptosis. The GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line is designed for rapid and convenient analysis of any cellular response that results in modulation of NF-κB activities. The GloResponse™ Cell Lines were generated by clonal selection of HEK293 cells stably transfected with pGL4-based vectors carrying specific response elements for the pathway of interest. These cell lines incorporate the improvements developed for the pGL4 family of reporter vectors for enhanced performance. The destabilized luc2P luciferase reporter is used for improved responsiveness to transcriptional dynamics. The luc2P gene is codon optimized for enhanced expression in mammalian cells, and the pGL4 plasmid backbone was engineered to reduce background reporter expression. The result is a cell line with very high induction levels when the pathway of interest is activated. Features: • Convenient: Prebuilt, optimized luciferase reporter cell lines. • Robust: Large assay window provided by high levels of induction and low background expression. • Faster Results: Improved responsiveness to transcriptional dynamics with destabilized luciferase. Storage Conditions: Place frozen cells in storage at less than or equal to –140°C (mechanical deep freeze or vapor phase liquid nitrogen) until you are ready to thaw and propagate them. We strongly recommend that the cells are propagated, using the provided procedure, as soon as possible. This will ensure the optimal cell viability and assay performance. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 93 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com Reporter Vector Sequencing Primers Product Size Cat.# RVprimer3 (clockwise) 2 μg E4481 RVprimer4 (counterclockwise) 2 μg E4491 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Reporter Vector (RV) Sequencing Primers are designed for use with the pGL3 and pGL4 Luciferase Vectors. RVprimer3 binds upstream of the luc+, luc2 or CAT gene, and sequencing runs clockwise across the multiple cloning region. RVprimer4 binds downstream of the luc+, luc2 or CAT polyadenylation region in the Promoter and Basic Vectors and downstream of the SV40 enhancer region of the Enhancer and Control Vectors. Both primers can be used for sequencing double-stranded templates, but only RVprimer4 can be used for sequencing single-stranded templates. Primer Sequences • RVprimer3: 5´-d(CTAGCAAAATAGGCTGTCCC)-3´ • RVprimer4: 5´-d(GACGATAGTCATGCCCCGCG)-3´ Storage Conditions: Store at –20°C. The primers are supplied dried. pSP-luc+NF Fusion Vector Product Size Cat.# pSP-luc+NF Fusion Vector 20 μg E4471 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pSP-luc+NF Fusion Vector is a luciferase cassette vector containing the engineered firefly luciferase gene, luc+NF. The luc+NF gene is related to the luc+ gene found in the pGL3 family of eukaryotic reporter vectors but has been further modified for maximum flexibility in constructing N-terminal fusions (NF) with luciferase. Subcloning luc+NF into expression vectors provides a useful genetic reporter with exceptional sensitivity. The pSPluc+NF Fusion Vector is not itself intended for the expression of luciferase in eukaryotic cells, because it does not contain eukaryotic promoters, enhancers or polyadenylation signals. A unique BstEII site has been inserted immediately downstream of the luciferase ATG translation codon, allowing cloned inserts to be positioned immediately downstream of the luc+NF initiation codon. This vector is recommended specifically for applications where N-terminal fusion proteins do not contain an internal ATG codon at the luciferase junction. The luc+NF gene is positioned downstream of an SP6 promoter and a ribosome binding site. An opposing T7 promoter is located immediately downstream of luc+NF. Thus, the pSP-luc+NF Fusion Vector provides a convenient template for the in vitro synthesis of both sense and antisense luciferase transcripts for studies involving in situ hybridization, RNA processing, RNA transfection or coupled in vitro transcription/translation and protein folding. Multiple cloning regions containing recognition sequences for commonly used restriction enzymes are positioned at the 5´ and 3´ ends of luc+NF to provide maximum flexibility in cloning. Luciferase enzymatic activity can be assayed most efficiently using one of the Luciferase Assay Systems. Features: • Flexibility: Multiple cloning regions are positioned at the 5´ and 3´ ends of luc to provide maximum flexibility in cloning. • N-Terminal Fusions with Luciferase: Unique BstEII site located immediately downstream of the luciferase ATG translation codon. Storage Conditions: Store at –20°C. ➞ BclI 628 BbuI 711 BanII 1072 HpaI 1777 AlwNI 2372 Csp45I 217 NarI 81 NdeI 4020 SspI 3653 AatII 3771 Ampr XhoI ClaI EcoRV EcoRI XbaI T7 SP6 1726 1721 1716 1708 1702 1700 15 17 24 30 36 43 45 luc+NF start 47 pSP-luc+NF Fusion Vector (4103bp) KpnI NheI BglII AvrII rbs HindIII NcoI BstEII 0752VA08_4A luc+ end ➞ Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 94 For complete and up-to-date product information visit: www.promega.com pSV-β-Galactosidase Control Vector Product Size Cat.# pSV-β-Galactosidase Control Vector 20 μg E1081 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pSV-β-Galactosidase Control Vector is a positive control vector for monitoring transfection efficiencies of mammalian cells. The SV40 early promoter and enhancer drive transcription of the lacZ gene, which encodes the β-galactosidase enzyme. The pSV-β-Galactosidase Control Vector can be transfected individually or co-transfected with your DNA of interest. β-galactosidase is an excellent reporter enzyme that can be assayed quickly and directly in cell extracts using spectrophotometric, fluorescent or chemiluminescent assays. This reporter enzyme is also widely used for in situ histochemical analysis using the substrate X-Gal. The pSV-β-Galactosidase Control Vector can be co-transfected with your DNA of interest. For example, co-transfection with firefly luciferase gene vectors (pGL3 Vectors) provide cell extracts that can be assayed for both luciferase and β-galactosidase activities. In this manner, the pSV-β-Galactosidase Vector acts as an internal control for transient expression assays. A negative control extract, prepared from mock-transfected cells, should also be assayed for the presence of endogenous β-galactosidase activity in cultured cells. In addition, co-transfection with chloramphenicol acetyltransferase reporter gene vectors permits assaying for both CAT and β-galactosidase activities. The pSV-β-Galactosidase Vector is a modification of pRSV-β-Gal with SV40 and pUC18 sequences substituted for RSV and pBR322 sequences. The pSV-βGalactosidase Vector will express β-galactosidase in E. coli due to the presence of the E. coli gpt promoter located upstream of the lacZ gene. Colonies of E. coli containing the pSV-β-Galactosidase Vector will appear blue when plated on media containing X-Gal. Storage Conditions: Store at –20°C. pSV-β-Galactosidase Vector (6820bp) Ampr ori lacZ EcoRI 3701 HindIII 414 BamHI 4151 SalI 4163 PstI 4173 EcoRI 6815 SV40 Promoter and Enhancer 0325VA03_3A Monster Green® Fluorescent Protein phMGFP Vector Product Size Cat.# Monster Green® Fluorescent Protein phMGFP Vector 20 μg E6421 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The phMGFP Vector contains the open reading frame for the Monster Green® Fluorescent Protein cloned into a mammalian expression vector. The Monster Green® Fluorescent Protein is encoded by an improved synthetic version of the green fluorescent protein gene originally cloned from Montastraea cavernosa (Great Star Coral). The synthetic gene (hMGFP) expresses a 26kDa protein that shows improved fluorescence intensity compared to the native gene. Furthermore, the hMGFP gene has been codon optimized and cleared of most consensus sequence transcription factor binding sites to ensure reliability and high levels of expression. The Monster Green® Fluorescent Protein encoded by the hMGFP gene is an ideal fluorescent reporter, providing high-level fluorescence and reducing cytotoxicity. Monster Green® Fluorescent Protein generally fluoresces at least 20% brighter than other commercially available green fluorescent proteins (GFPs) and also reduces cytotoxicity, offering flexibility when working with transient and stable expression assays. Features: • Brighter Fluorescence: Visualize low-level expression in situ using fluorescence microscopy, imagers or FACS®. • Reduced Cytotoxicity: Minimize cellular perturbations when working with transient or stable expression assays. • Flexible: Create fusion proteins for imaging and localization studies using standard FITC detection. • High Purity: Obtain high transfection efficiencies for precloning confirmation studies. Storage Conditions: Store at –20°C. ori Intron SV40 Late poly(A) phMGFP Vector (4707bp) EcoRV PstI Bst98I Bst98I Ampr BglII T7 NheI NotI XmaI/SmaI NcoI NcoI NaeI XbaI hMGFP CMV I. E. Enhancer/Promoter 3898MA11_2A Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 95 7Luciferase Assays For complete and up-to-date product information visit: www.promega.com Transfection Reagents ViaFect™ Transfection Reagent Product Size Cat.# ViaFect™ Transfection Reagent 0.75 ml E4981 2 × 0.75 ml E4982 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ViaFect™ Transfection Reagent is a novel formulation reagent designed to efficiently introduce DNA into a wide variety of cell lines. ViaFect™ Transfection Reagent has performed in commonly used adherent cell models and also in cells lines traditionally thought of as difficult to transfect such as suspension cells and stem cell-derived lines. This gentle, low-toxicity reagent allows cells to stay healthy and metabolically active during transfectionbased experiments and offers an easy-to-use protocol that does not require removal of serum or culture medium prior to use. After introducing the reagent:DNA complex no washing or medium changes are required. ViaFect™ Transfection Reagent provides robust performance with minimal optimization allowing simple design of more relevant assays. Features: • Use the Best Cell Model for Your Study: ViaFect™ Transfection Reagent is effective in a broad range of cell lines including adherent cell models, suspension cells and stem cell-derived lines. • Obtain Superior Transfection Efficiency: ViaFect™ Transfection Reagent improves the level of transfection in many cell lines. • Maintain Healthy Cells: The low-toxicity reagent maintains cellular biology and metabolism during transfection to more accurately represent the biology being modeled. • Simple Assay Design: An easy-to-use protocol that is robust across transfection conditions requiring minimal optimization. Storage Conditions: Product may arrive frozen. Upon arrival, thaw at +2°C to +10°C or room temperature and store at +2°C to +10°C. FuGENE® 6 Transfection Reagent Product Size Cat.# FuGENE® 6 Transfection Reagent 1 ml E2691 5 × 1 ml E2692 0.5 ml E2693 For Research Use Only. Not for Use in Diagnostic Procedures. Description: FuGENE® 6 Transfection Reagent is a nonliposomal formulation designed to transfect plasmid DNA into a wide variety of cell lines with high efficiency and low toxicity. The protocol does not require removal of serum or culture medium and does not require washing or changing of medium after introducing the reagent/DNA complex. Features: • More Biologically Relevant: Very low toxicity; less impact on biology. • Simple Protocol: No culture changes; less variability; compatible with serum. • Effective in Many Cell Types: Used in thousands of publications. • Ideal for Use with Luciferase Assays: More expression; sensitive results. Storage Conditions: Store FuGENE® 6 Transfection Reagent at 4°C.Do not freeze or store below 0°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 96 For complete and up-to-date product information visit: www.promega.com FuGENE® HD Transfection Reagent Product Size Cat.# FuGENE® HD Transfection Reagent 1 ml E2311 5 × 1 ml E2312 For Research Use Only. Not for Use in Diagnostic Procedures. Description: FuGENE® HD Transfection Reagent is a novel, nonliposomal formulation designed to transfect DNA into a wide variety of cell lines with high efficiency and low toxicity. The protocol does not require removal of serum or culture medium and does not require washing or changing of medium after introducing the reagent/DNA complex. Additionally, the FuGENE® HD Transfection Reagent has been shown to support transfection in chemically defined media and does not contain any animal-derived components. The cell lines listed in Table 1 have been transfected successfully by Promega Corporation or Fugent, L.L.C. For a list of conditions that were used in the transfection of these and other cell types, visit our FuGENE® HD Protocol Database. Features: • More Biologically Relevant: Low toxicity, less impact on biology. • Simple Protocol: No culture changes, less variability, compatible with serum. • Effective in Many Cell Types: Online database with over 40 cell types, including primary and stem cells. • Ideal for Use with Luciferase Assays: More expression, sensitive results. Storage Conditions: Store FuGENE® HD Transfection Reagent at 4°C.Do not freeze or store below 0°C. TransFast™ Transfection Reagent Product Size Cat.# TransFast™ Transfection Reagent 1.2 mg E2431 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The TransFast™ Transfection Reagent is composed of the synthetic cationic lipid, (+)-N,N [bis (2-hydroxyethyl)]-N-methyl-N-[2,3- di(tetradecanoyloxy)propyl] ammonium iodide and the neutral lipid, DOPE. The TransFast™ Reagent is supplied as a dried lipid film that forms multilamellar vesicles upon hydration with water. Cationic liposomes designed for transfection, such as the TransFast™ Reagent, are more versatile than many other traditional transfection methods. The advantages include flexibility in the macromolecules that are delivered, in vitro and in vivo applications, ability to more reproducibly transfect cells that are recalcitrant to other methods and suitability for transient and stable transfection. Several different types of macromolecules, including RNA and DNA in sizes ranging from oligonucleotides to plasmids and yeast artificial chromosomes, can be delivered to cells using liposomes. The TransFast™ Transfection Reagent is designed for nucleic acid delivery to eukaryotic cells in vitro and in vivo and performs well with many cell lines. We have found that TransFast™ Reagent performs particularly well for DNA delivery to NIH/3T3, CHO, 293, K562, PC12, Jurkat and insect Sf9 cells. Features: • Fast: Transfect in 1 hour. Transfection times can be decreased to as little as 30 minutes with certain cell lines. • Easy to Use: Resuspend the reagent in water, freeze, thaw, mix with DNA, and add to cells. • Efficient: High-efficiency transfection—transient and stable—in many cells. • Robust: Requires less optimization than other systems. Allows transfection of cell types such as primary cell cultures that require continuous exposure to serum. Storage Conditions: Store at –20°C. ProFection® Mammalian Transfection System Product Size Cat.# ProFection® Mammalian Transfection System—Calcium Phosphate 40 reactions E1200 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The introduction of DNA into mammalian cells is facilitated by the ProFection® Mammalian Transfection System. This system offers you a Calcium Phosphate-mediated transfection procedure. Each system contains sufficient reagents for 40 high-efficiency transfections of cells plated in 100mm tissue culture dishes. Calcium phosphate transfection is an effective method for the production of long-term stable transfectants. This method also works well for transient expression of transfected genes and can be used with most adherent cell lines. Features: • Efficient: Components optimized for high transfection efficiencies. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 97 8 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Cloning and DNA Markers Molecular Weight Markers 98 Restriction Enzymes 104 Alkaline Phosphatases 115 Polymerases 115 Ligases 118 Kinases and DNA Labeling Systems 119 Nucleases 120 Additional Enzymes 121 Ribonuclease Inhibitors 122 Subcloning Tools and Vectors 123 Bacterial Strains and Competent Cells 132 Cloning and DNA Markers Table of Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 98 For complete and up-to-date product information visit: www.promega.com Molecular Weight Markers BenchTop DNA Markers Product Size Cat.# BenchTop ΦX174 DNA/HaeIII Markers 250 μl G7511 BenchTop pGEM® DNA Markers 250 μl G7521 BenchTop PCR Markers 300 μl G7531 BenchTop 1kb DNA Ladder 600 μl G7541 BenchTop 100bp DNA Ladder 300 μl G8291 For Laboratory Use. Description: The BenchTop DNA Markers offer the convenience of storage at room temperature (22–25°C) as well as the capability of direct loading onto agarose gels. The BenchTop DNA Markers are supplied in a stabilizing solution of 1X Blue/Orange Loading Dye, which circumvents any requirements for further manipulation. BenchTop ΦX174 DNA/HaeIII Markers: Eleven phenol-extracted, ethanol-precipitated DNA fragments ranging in size from 72bp to 1,353bp. BenchTop pGEM® DNA Markers: Fifteen phenol-extracted, ethanol-precipitated DNA fragments ranging in size from 36bp to 2,645bp. These unique markers are generated from separate digests of pGEM®-3 Vector DNA with HinfI, RsaI and SinI later combined to form the markers. BenchTop PCR Markers: Six bands of equal intensity of 50, 150, 300, 500, 750, and 1,000bp. The BenchTop PCR Markers may be run on polyacrylamide gels with less loading volume; however, additional bands may be visible compared to those visible on agarose gels. BenchTop 1kb DNA Ladder: Thirteen blunt-ended fragments with sizes ranging from 250bp to 10,000bp. The 1,000bp and 3,000bp fragments have increased intensity relative to the other bands on ethidium bromide-stained agarose gels for easy identification. All other fragments are of equal intensity. The ladder is dephosphorylated and ready for 5´ end-labeling with radioisotopes using T4 Polynucleotide Kinase, allowing visualization by autoradiography. BenchTop 100bp DNA Ladder: Eleven fragments that range in size from 100bp to 1,000bp in 100bp increments with an additional band at 1,500bp. The 500bp fragment is present at increased intensity for easy identification. The ladder is dephosphorylated and ready for 5´ end-labeling with radioisotopes using T4 Polynucleotide Kinase, allowing visualization by autoradiography. Recommended Loading: Cat.# G7511, G7521: Load 5μl/lane. Cat.# G7531, G7541, G8291: Load 6μl/lane. Features: • Convenient: Storage at 22–25°C. • Efficient: Premixed with loading buffer. Ready to load onto agarose gels. • Versatile: Five different BenchTop DNA Markers available. Storage Conditions: Store at 22–25°C. – 1,353 bp – 1,078 – 872 – 603 – 310 – 281/271 – 234 – 194 – 118 – 72 2% agarose – 2,645 bp – 1,605 – 1,198 – 676 2% agarose – 517 – 460 – 396 – 350 – 222 – 179 – 126 – 75/65 [51,36] bp – 1,000 – 750 – 500 – 300 – 150 – 50 2% agarose bp – 250, 253 – 500 – 750 – 1,000 – 1,500 – 2,000 – 2,500 – 3,000 – 4,000 – 5,000 – 6,000 – 8,000 – 10,000 0.7% agarose bp – 1,500 – 1,000 – 900 – 800 – 700 – 600 – 500 – 400 – 300 – 200 – 100 2% agarose 8651TA BenchTop φX174 DNA/HaeIII Markers Cat.# G7511 Load 5µl/lane. BenchTop pGEM® DNA Markers Cat.# G7521 Load 5µl/lane. BenchTop PCR Markers Cat.# G7531 Load 6µl/lane. BenchTop 1kb DNA Ladder Cat.# G7541 Load 6µl/lane. BenchTop 100bp DNA Ladder Cat.# G8291 Load 6µl/lane. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 99 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com DNA Step Ladders Product Size Conc. Cat.# 10bp DNA Step Ladder 32.5 μg 0.65 µg/µl G4471 25bp DNA Step Ladder 100 μg 0.36 µg/µl G4511 50bp DNA Step Ladder 90 μg 0.34 µg/µl G4521 100bp DNA Step Ladder 100 μg 1 µg/µl G6951 200bp DNA Step Ladder 100 μg 1 µg/µl G6961 1kb DNA Step Ladder 90 μg 0.3 µg/µl G6941 For Laboratory Use. Description: The DNA Step Ladders are ladders of defined sizes with exact incremental steps between bands. The ladders are not intended for use in quantitative analysis. Each ladder is provided with a tube of 6X Blue/Orange Loading Dye. The fragments may be stained with ethidium bromide. 10bp DNA Step Ladder: Ten blunt-ended DNA fragments ranging from 10bp to 100bp in exactly 10bp increments. All of the bands are of approximately equal intensity with the exception of the 10bp band, which may appear slightly less intense. 25bp DNA Step Ladder: Twelve DNA fragments ranging from 25bp to 300bp in 25bp increments. An 1,800bp “backbone” fragment is also visible. The 300bp band is ≈3 times more intense than all other bands. 50bp DNA Step Ladder: Sixteen DNA fragments ranging from 50bp to 800bp in 50bp increments plus an 1,800bp “backbone” fragment. All bands except the 800bp band are of equal intensity; the 800bp band is ≈3 times more intense. 100bp DNA Step Ladder: Forty blunt-ended DNA fragments ranging from 100bp to 4,000bp in 100bp increments. Two internal features facilitate band identification. A high-intensity 500bp band stands out at the lowest segment of the ladder (<1kb). Bands within each segment (<1kb, <2kb, <4kb) have approximately the same intensity. 200bp DNA Step Ladder: Thirty-three blunt-ended DNA fragments ranging from 200bp to 6,600bp in 200bp increments. The 1,000bp band appears more intense than all other bands, which are of approximately equal intensity. 1kb DNA Step Ladder: Ten blunt-ended DNA fragments ranging from 1kb to 10kb in 1kb increments. All bands except the 5kb band are of equal intensity; the 5kb band is ≈3 times more intense. Recommended Loading: Cat.# G4471, G6951, G6961, G6941: Load 1μl/lane. Cat.# G4511, G4521: Load 5μl/lane. Storage Conditions: Store at –20°C. 8652TA 10bp DNA Step Ladder Cat.# G4471 Load 1µl/lane. 25bp DNA Step Ladder Cat.# G4511 Load 5µl/lane. 50bp DNA Step Ladder Cat.# G4521 Load 5µl/lane. bp – 100 ––––– 90 – 80 ––––– 70 – 60 – 50 – 40 – 30 – 20 – 10 4% agarose (3% NuSieve® GTG® agarose/1% agarose) bp – 300 – 200 – 175 – 150 – 125 – 100 – 75 – 50 – 25 – 250 ––––– 275 ––––– 225 2% agarose/TAE bp 2% agarose/TAE – 800 – 500 – 450 – 400 – 350 – 300 – 250 – 200 – 150 – 100 – 50 – 600 – 700 ––––– 750 ––––– 650 ––––– 550 100bp DNA Step Ladder Cat.# G6951 Load 1µl/lane. 200bp DNA Step Ladder Cat.# G6961 Load 1µl/lane. 1kb DNA Step Ladder Cat.# G6941 Load 1µl/lane. bp – 4,000 – 3,800 – 500 – 400 – 600 – 700 – 800 – 900 – 1,000 – 1,100 – 1,200 – 1,300 – 1,400 – 1,500 – 1,600 – 1,700 – 1,800 – 1,900 – 2,000 – 2,200 – 2,400 – 2,600 – 2,800 – 3,000 – 3,200 – 3,400 – 3,600 ––––––– 3,900 ––––––– 2,300 ––––––– 2,100 ––––––– 2,500 ––––––– 2,700 ––––––– 2,900 ––––––– 3,100 ––––––– 3,300 ––––––– 3,500 ––––––– 3,700 [300 200 100] 1% agarose bp [6,400, 6,600] – 200 – 400 – 600 – 800 – 1,000 – 1,200 – 1,400 – 1,600 – 1,800 – 2,000 – 2,200 – 2,400 – 2,600 – 2,800 – 3,000 – 3,400 – 3,800 – 4,200 – 4,600 – 5,000 – 5,400 – 5,800 – 6,200 1% agarose – 1,000 – 2,000 – 3,000 – 4,000 – 5,000 – 6,000 –––––––– 7,000 – 10,000 – 8,000 –––––––– 9,000 bp 0.7% agarose 8653TA Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 100 For complete and up-to-date product information visit: www.promega.com DNA Ladders Product Size Conc. Cat.# PCR Markers 250 μl ~0.06 µg/µl G3161 100bp DNA Ladder 250 μl 0.13 µg/µl G2101 1kb DNA Ladder 500 μl 0.1 µg/µl G5711 For Laboratory Use. Description: The DNA Ladders are ladders with defined sizes. The ladders are not intended for use in quantitative analysis. Each ladder is provided with a tube of 6X Blue/Orange Loading Dye. PCR Markers: Six bands of equal intensity of 50, 150, 300, 500, 750 and 1,000bp. The PCR Markers may be run on polyacrylamide gels with less loading volume; however, additional bands may be visible compared to those visible on agarose gels. 100bp DNA Ladder: Eleven fragments that range in size from 100bp to 1,000bp in 100bp increments with an additional band at 1,500bp. The 500bp fragment is present at increased intensity for easy identification. The ladder is dephosphorylated and ready for 5´ end-labeling with radioisotopes using T4 Polynucleotide Kinase, allowing visualization by autoradiography. 1kb DNA Ladder: Thirteen blunt-ended fragments with sizes ranging from 250bp to 10,000bp. The 1,000bp and 3,000bp fragments have increased intensity relative to the other bands on ethidium bromide-stained agarose gels for easy identification. All other fragments are of equal intensity. The ladder is dephosphorylated and ready for 5´ end-labeling with radioisotopes using T4 Polynucleotide Kinase, allowing visualization by autoradiography. Recommended Loading: Load 5μl/lane. Storage Conditions: Store at –20°C. PCR Markers Cat.# G3161 Load 5µl/lane. 100bp DNA Ladder Cat.# G2101 Load 5µl/lane. 1kb DNA Ladder Cat.# G5711 Load 5µl/lane. 8654TA bp – 1,000 – 750 – 500 – 300 – 150 – 50 2% agarose 0094TA05_3A bp – 1,500 – 1,000 – 900 – 800 – 700 – 600 – 500 – 400 – 300 – 200 – 100 2% agarose 0973TC03_5A bp – 250, 253 – 500 – 750 – 1,000 – 1,500 – 2,000 – 2,500 – 3,000 – 4,000 – 5,000 – 6,000 – 8,000 – 10,000 0.7% agarose 1409TA03_6A Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 101 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com Conventional DNA Markers Product Size Conc. Cat.# Lambda DNA/HindIII Markers 100 μg 0.5 µg/µl G1711 Lambda DNA/EcoRI Markers 100 μg 0.5 µg/µl G1721 Lambda DNA/EcoRI + HindIII Markers 100 μg 0.5 µg/µl G1731 ΦX174 DNA/HaeIII Markers 50 μg 1 µg/µl G1761 ΦX174 DNA/HinfI Markers 50 μg 1 µg/µl G1751 pGEM® DNA Markers 50 μg 1 µg/µl G1741 For Laboratory Use. Description: The Conventional DNA Digest Markers are created by digesting either λ DNA, ΦX174 replicative form DNA, or plasmids to completion with one or more restriction enzymes. The enzymes are heat-inactivated, and the DNA fragments are either phenol-extracted, then ethanol-precipitated or just ethanol-precipitated. The precipitated fragments are resuspended in storage buffer. The markers are not intended for quantitative analysis. Each marker is supplied with a tube of 6X Blue/Orange Loading Dye. λ DNA/HindIII Markers: Eight ethanol-precipitated DNA fragments ranging in size from 125bp to 23,130bp. λ DNA/EcoRI Markers: Six ethanol-precipitated DNA fragments ranging in size from 3,530bp to 21,226bp. λ DNA/EcoRI + HindIII Markers: Thirteen ethanol-precipitated DNA fragments ranging in size from 125bp to 21,226bp. ΦX174 DNA/HaeIII Markers: Eleven phenol-extracted, ethanol-precipitated DNA fragments ranging in size from 72bp to 1,353bp. ΦX174 DNA/HinfI Markers: Twenty ethanol-precipitated DNA fragments ranging in size from 24bp to 726bp. pGEM® DNA Markers: Fifteen phenol-extracted, ethanol-precipitated DNA fragments ranging in size from 36bp to 2,645bp. These unique markers are generated from separate digests of pGEM®-3 Vector DNA with HinfI, RsaI and AvaII later combined to form the markers. Recommended Loading: Load 1μl/lane. Storage Conditions: Store at –20°C. Lambda DNA/ HindIII Markers Cat.# G1711 Load 1µl/lane. Lambda DNA/ EcoRI Markers Cat.# G1721 Load 1µl/lane. Lambda DNA/EcoRI + HindIII Markers Cat.# G1731 Load 1µl/lane. φX174 DNA/ HaeIII Markers Cat.# G1761 Load 1µl/lane. φX174 DNA/ HinfI Markers Cat.# G1751 Load 1µl/lane. pGEM® DNA Markers Cat.# G1741 Load 1µl/lane. 8655TA bp – 23,130 – 9,416 – 6,557 – 4,361 – 2,322 – 2,027 [564, 125] 0.7% agarose 1258TB09_5A – 21,226 – 7,421 – 4,878 – 3,530 bp 5,804 5,643 0.7% agarose 1258TA09_5A bp – 2,645 – 676 – 517 – 460 – 396 – 350 – 222 – 179 – 126 – 75 – 65 – 51 [36] – 1,605 – 1,198 8% acrylamide 0266TA05_1A bp – 726 – 553 – 500 – 311 – 249 – 200 427 417 413 48 42 40 – 118 – 100 – 82 – 66 – 24 – 151 ––––– 140 ––––– 713 8% acrylamide 0265TA05_2A bp – 21,226 5,148 4,973 – 4,268 – 3,530 – 1,584 – 1,375 – 947 – 831 [564, 125] – 2,027 ––––––– 1,904 0.7% agarose 1258TC09_5A bp – 1,353 – 1,078 – 872 – 603 – 310 – 281 ––––– 271 – 234 – 194 – 118 [72] 8% acrylamide 1238TA09_5A Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 102 For complete and up-to-date product information visit: www.promega.com ΦX174 DNA/HinfI Dephosphorylated Markers Product Size Cat.# ΦX174 DNA/HinfI Dephosphorylated Markers 2.5 μg E3511 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ΦX174 DNA/HinfI Dephosphorylated Markers are prepared by digesting double-stranded ΦX174 DNA to completion with HinfI. The DNA fragments are then treated with calf intestinal alkaline phosphatase, phenol:chloroform-extracted, ethanol-precipitated and resuspended in TE buffer, making the markers ready for 5´ end-labeling. The 20 DNA fragments range in size from 24–726bp. The markers are not intended for use in quantitative analysis. This marker is especially convenient for applications such as primer extension, requiring DNA or RNA size estimations. Features: • Concentration: 50μg/ml. • Range (bp): 24–726. • Number of Bands: 20. • Convenient: Ready to label. Storage Conditions: Store at –20°C. ProMega-Markers® Lambda Ladders Product Size Cat.# ProMega-Markers® Lambda Ladders 40–60 lanes G3011 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ProMega-Markers® Lambda Ladders are prepared by concatemerization of λ phage DNA into multimers ranging in size from 50kb to 800kb and up, with each multimer, or rung, of the 20-step ladder differing in size by one λ genome (approximately 48.5kb). The ladders are embedded in dye-colored, 0.5% agarose string molds in 50mM EDTA. The ladders are not intended for use in quantitative analysis. Features: • Concentration: 0.5μg/5mm. • Range (bp): 50,000–800,000 and up. Storage Conditions: Store at 4°C. Do not freeze. bp – 726 – 553 – 500 – 311 – 249 – 200 427 417 413 48 42 40 – 118 – 100 – 82 – 66 – 24 – 151 ––––– 140 ––––– 713 8% acrylamide 0265TA05_2A φX174 DNA/ HinfI Markers Cat.# G1751 Load 1µl/lane. kb – 50 – 200 – 400 – 500 – 800 0080TA04_3A 0.6% agarose Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 103 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com RNA Markers Product Size Cat.# RNA Markers 50 μl G3191 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Promega RNA Markers are suitable for size estimation of single-stranded RNA from 0.28–6.58kb in glyoxal or formaldehyde-agarose gels. The RNA Markers consist of a ladder of nine RNA transcripts that are synthesized in vitro from specific templates. The sizes are 281, 623, 955, 1,383, 1,908, 2,604, 3,638, 4,981 and 6,583 bases. The markers are not intended for use in quantitative analysis. After electrophoresis, the fragments can be visualized by ethidium bromide staining. Recommended Loading: 3μl (prepared in formaldehyde/MOPS buffer and separated onto a 1% formaldehyde-agarose gel using MOPS running buffer). Features: • Range (bases): 281–6,583. • Number of Bands: 9. Storage Conditions: Store at –70°C. Broad Range Protein Molecular Weight Markers Product Size Conc. Cat.# Broad Range Protein Molecular Weight Markers 100 lanes 5 µl/lane V8491 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Broad Range Protein Molecular Weight Markers consist of nine clearly identifiable bands at convenient molecular weights. The protein sizes are 10, 15, 25, 35, 50, 75, 100, 150 and 225kDa. Each protein is present at a concentration of 0.1μg/μl, except for the 50kDa protein, which is present at 0.3μg/μl and serves as a reference indicator, having triple the intensity of the other proteins. All other proteins appear with equal intensity on the gel. These markers are intended for use as a size standard when performing SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) for estimation of the molecular weight of the protein of interest. Note that they are not stained. Features: • Reference Band: Band at 50kDa is 3X intensity for use as a reference. • Convenient: 9 bands at evenly spaced intervals. • Fast: Ready to load. Storage Conditions: Store at –20°C (weekly/monthly use) or 4°C (daily use). bases – 6,583 – 4,981 – 3,638 – 2,604 – 1,908 – 1,383 – 955 – 623 – 281 1% formaldehyde-agarose 0775TB09_4A – 225 kDa – 150 – 100 – 75 – 50 – 35 – 25 – 15 – 10 3480TA07_1A 4–20% Tris-Glycine SDS-PAGE gel Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 104 For complete and up-to-date product information visit: www.promega.com Restriction Enzymes 5980TA Recommended Buffer Recognition/ Cut Heat Inactivation Incubation Temperature Genome Qualified Blue/White Cloning Qualified GoTaq® Buffer Compatible Rapid Digest Capable Available in Helix 4248TA Removable Sticker Product Usage Information All the Information You Need—At a Glance On the following pages, restriction enzyme information is organized using icons to help you quickly and easily identify the features of each enzyme. See the diagram to the right to identify the meaning of the icons used. Product Usage, Quality Control and Lot-Specific Information Each enzyme comes in recyclable packaging that holds the enzyme, buffers (if applicable) and a lot-specific Product Information Sheet. The Product Information Sheet contains details of the quality control assays performed, product storage and usage information, protocols and references. Lot-specific information is printed on a removable sticker that can be pasted into a notebook or log book, simplifying your recordkeeping. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 105 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com AgeI 37 Product Size Conc. Cat.# AgeI 100 u 3–10 u/µl R7251 For Research Use Only. Not for Use in Diagnostic Procedures. Description: A▼ CCGG T T GGCC▲A Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. AluI 37 Product Size Conc. Cat.# AluI 500 u 10 u/µl R6281 For Research Use Only. Not for Use in Diagnostic Procedures. Description: AG▼CT TC▲GA Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. ApaI 37 Product Size Conc. Cat.# ApaI 5,000 u 10 u/µl R6361 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G GGCC▼C C▲CCGG G Features: • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. BamHI 37 Product Size Conc. Cat.# BamHI 2,500 u 10 u/µl R6021 12,500 u 10 u/µl R6025 BamHI (HC) 12,500 u 40–80 u/µl R4024 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G▼GATC C C CTAG▲G Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 106 For complete and up-to-date product information visit: www.promega.com BclI 50 Product Size Conc. Cat.# BclI 1,000 u 10 u/µl R6651 For Research Use Only. Not for Use in Diagnostic Procedures. Description: T▼ GATC A A CTAG▲T Storage Conditions: Store at –20°C. BglI 37 Product Size Conc. Cat.# BglI 1,000 u 10 u/µl R6071 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GCCN NNN▼NGGC CGGN▲NNN NCCG Storage Conditions: Store at –20°C. BglII 37 Product Size Conc. Cat.# BglII 500 u 10 u/µl R6081 2,500 u 10 u/µl R6085 For Research Use Only. Not for Use in Diagnostic Procedures. Description: A▼GATC T T CTAG▲A Features: • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. CfoI 37 Product Size Conc. Cat.# CfoI 3,000 u 10 u/µl R6241 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G CG▼C C▲GC G Storage Conditions: Store at –20°C. ClaI 37 Product Size Conc. Cat.# ClaI 500 u 10 u/µl R6551 2,500 u 10 u/µl R6555 For Research Use Only. Not for Use in Diagnostic Procedures. Description: AT▼ CG AT TA GC▲TA Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 107 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com DdeI 37 Product Size Conc. Cat.# DdeI 200 u 10 u/µl R6291 1,000 u 10 u/µl R6295 For Research Use Only. Not for Use in Diagnostic Procedures. Description: C▼TNA G G ANT▲C Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. DpnI 37 Product Size Conc. Cat.# DpnI 200 u 10 u/µl R6231 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GmeA▼TC CT▲ meAG Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. EcoRI 37 Product Size Conc. Cat.# EcoRI 5,000 u 12 u/µl R6011 15,000 u 12 u/µl R6017 EcoRI (HC) 25,000 u 40–80 u/µl R4014 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G▼ AATT C C TTAA▲G Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. EcoRV 37 Product Size Conc. Cat.# EcoRV 2,000 u 10 u/µl R6351 10,000 u 10 u/µl R6355 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GAT▼ATC CTA▲TAG Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 108 For complete and up-to-date product information visit: www.promega.com HaeIII 37 Product Size Conc. Cat.# HaeIII 2,500 u 10 u/µl R6171 10,000 u 10 u/µl R6175 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GG▼CC CC▲GG Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. HhaI 37 Product Size Conc. Cat.# HhaI 1,000 u 10 u/µl R6441 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G CG▼C C▲GC G Storage Conditions: Store at –20°C. HindIII 37 Product Size Conc. Cat.# HindIII 5,000 u 10 u/µl R6041 15,000 u 10 u/µl R6045 For Research Use Only. Not for Use in Diagnostic Procedures. Description: A▼AGCT T T TCGA▲A Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. HinfI 37 Product Size Conc. Cat.# HinfI 1,000 u 10 u/µl R6201 5,000 u 10 u/µl R6205 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G▼ANT C C TNA▲G Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 109 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com HpaII 37 Product Size Conc. Cat.# HpaII 1,000 u 10 u/µl R6311 5,000 u 10 u/µl R6315 For Research Use Only. Not for Use in Diagnostic Procedures. Description: C▼ CG G G GC▲C Storage Conditions: Store at –20°C. I-PpoI (Intron-Encoded Endonuclease) 37 Product Size Conc. Cat.# I-PpoI 10,000 u 100–200 u/µl R7031 For Research Use Only. Not for Use in Diagnostic Procedures. Description: CTCTC TTAA▼GGTAGC GAGAG▲AATT CCATCG Storage Conditions: Store at –20°C. KpnI 37 Product Size Conc. Cat.# KpnI 2,500 u 8–12 u/µl R6341 10,000 u 8–12 u/µl R6345 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G GTAC▼C C▲CATG G Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. MboI 37 Product Size Conc. Cat.# MboI 200 u 8–12 u/µl R6711 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ▼GATC CTAG▲ Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 110 For complete and up-to-date product information visit: www.promega.com MluI 37 Product Size Conc. Cat.# MluI 1,000 u 10 u/µl R6381 For Research Use Only. Not for Use in Diagnostic Procedures. Description: A▼CGCG T T GCGC▲A Features: • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. MspI 37 Product Size Conc. Cat.# MspI 2,000 u 10 u/µl R6401 10,000 u 10 u/µl R6405 For Research Use Only. Not for Use in Diagnostic Procedures. Description: C▼ CG G G GC▲C Storage Conditions: Store at –20°C. NcoI 37 Product Size Conc. Cat.# NcoI 200 u 10 u/µl R6513 1,000 u 10 u/µl R6515 For Research Use Only. Not for Use in Diagnostic Procedures. Description: C▼CATG G G GTAC▲C Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. NdeI 37 Product Size Conc. Cat.# NdeI 500 u 10 u/µl R6801 For Research Use Only. Not for Use in Diagnostic Procedures. Description: CA▼TA TG GT AT▲AC Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 111 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com NheI 37 Product Size Conc. Cat.# NheI 250 u 10 u/µl R6501 1,250 u 10 u/µl R6505 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G▼CTAG C C GATC▲G Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. NotI 37 Product Size Conc. Cat.# NotI 200 u 10 u/µl R6431 1,000 u 10 u/µl R6435 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GC▼GGCC GC CG CCGG▲CG Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. PstI 37 Product Size Conc. Cat.# PstI 3,000 u 10 u/µl R6111 15,000 u 10 u/µl R6115 For Research Use Only. Not for Use in Diagnostic Procedures. Description: C TGCA▼G G▲ACGT C Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. PvuI 37 Product Size Conc. Cat.# PvuI 100 u 2–10 u/µl R6321 500 u 2–10 u/µl R6325 For Research Use Only. Not for Use in Diagnostic Procedures. Description: CG AT▼CG GC▲TA GC Features: • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 112 For complete and up-to-date product information visit: www.promega.com RsaI 37 Product Size Conc. Cat.# RsaI 1,000 u 10 u/µl R6371 RsaI (HC) 5,000 u 40–80 u/µl R4374 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GT▼AC CA▲TG Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. SacI 37 Product Size Conc. Cat.# SacI 1,000 u 10 u/µl R6061 5,000 u 10 u/µl R6065 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G AGCT▼C C▲TCGA G Storage Conditions: Store at –20°C. SacII 37 Product Size Conc. Cat.# SacII 500 u 10 u/µl R6221 For Research Use Only. Not for Use in Diagnostic Procedures. Description: CC GC▼GG GG▲CG CC Features: • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. SalI 37 Product Size Conc. Cat.# SalI 2,000 u 10 u/µl R6051 10,000 u 10 u/µl R6055 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G▼ TCGA C C AGCT▲G Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. ScaI 37 Product Size Conc. Cat.# ScaI 1,000 u 8–12 u/µl R6211 For Research Use Only. Not for Use in Diagnostic Procedures. Description: AGT▼ACT TCA▲TGA Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 113 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com SgfI 37 Product Size Conc. Cat.# SgfI 250 u 8–12 u/µl R7103 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GCG AT▼CGC CGC▲TA GCG Storage Conditions: Store at –20°C. Do not freeze. SmaI 25 Product Size Conc. Cat.# SmaI 1,000 u 8–12 u/µl R6121 5,000 u 8–12 u/µl R6125 For Research Use Only. Not for Use in Diagnostic Procedures. Description: CCC▼GGG GGG▲CCC Storage Conditions: Store at –20°C. SpeI 37 Product Size Conc. Cat.# SpeI 200 u 10 u/µl R6591 1,000 u 10 u/µl R6595 For Research Use Only. Not for Use in Diagnostic Procedures. Description: A▼CTAG T T GATC▲A Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. Storage Conditions: Store at –20°C. SphI 37 Product Size Conc. Cat.# SphI 200 u 10 u/µl R6261 1,000 u 10 u/µl R6265 For Research Use Only. Not for Use in Diagnostic Procedures. Description: G CATG▼C C▲GTAC G Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. TaqI 65 Product Size Conc. Cat.# TaqI 1,000 u 10 u/µl R6151 10,000 u 10 u/µl R6155 For Research Use Only. Not for Use in Diagnostic Procedures. Description: T▼ CG A A GC▲T Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 114 For complete and up-to-date product information visit: www.promega.com XbaI 37 Product Size Conc. Cat.# XbaI 2,000 u 8–12 u/µl R6181 10,000 u 8–12 u/µl R6185 For Research Use Only. Not for Use in Diagnostic Procedures. Description: T▼CTAG A A GATC▲T Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. XhoI 37 Product Size Conc. Cat.# XhoI 3,000 u 10 u/µl R6161 10,000 u 10 u/µl R6165 For Research Use Only. Not for Use in Diagnostic Procedures. Description: C▼TCGA G G AGCT▲C Features: • Rapid Digest Capable: Capable of digesting DNA in 15 minutes or less. • GoTaq® Buffer Compatible: Active and capable of digestion directly in GoTaq® Green Master Mix. Storage Conditions: Store at –20°C. MULTI-CORE™ Buffer Pack Product Size Cat.# MULTI-CORE™ Buffer Pack 3 × 1 ml R9991 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MULTI-CORE™ Buffer Pack contains convenient aliquots of the Promega universal restriction enzyme 10X buffer. The MULTI-CORE™ Buffer is formulated to provide simple buffering conditions for performing multiple digestions. Many Promega restriction enzymes have between 50% and 100% activity in reactions using MULTI-CORE™ Buffer. Features: • Convenient and Economical: MULTI-CORE™ Buffer enables co-digestion of DNA with more than one enzyme in a single reaction. In most cases, only modest adjustments in the amount of enzyme used will ensure complete multiple digestions. Storage Conditions: Store at –20°C. 4-CORE® Buffer Pack Product Size Cat.# 4-CORE® Buffer Pack (Buffers A, B, C and D), 1ml each 4 ml R9921 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The 4-CORE® Buffer Pack contains convenient aliquots of Promega Restriction Enzyme 10X Buffers A, B, C and D. The majority of Promega restriction enzymes have optimal activity in one of these four 10X reaction buffers. Storage Conditions: Store at –20°C. Bovine Serum Albumin, Acetylated Product Size Conc. Cat.# Bovine Serum Albumin, Acetylated 1 ml 10 mg/ml R3961 400 μl 1 µg/µl R9461 R3961 For Laboratory Use. R9461 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Bovine Serum Albumin, Acetylated, can be used as an enzyme stabilizer or as a carrier protein. It is prepared by a modification of the method of Gonzalez et al. and dialyzed extensively with deionized water to remove impurities. Features: • Quality Tested: Each lot of BSA is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 115 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com Alkaline Phosphatases Alkaline Phosphatase, Calf Intestinal (CIAP) Product Size Conc. Cat.# Alkaline Phosphatase, Calf Intestinal 1,000 u 1 u/µl M1821 Alkaline Phosphatase, Calf Intestinal (HC) 1,000 u 20 u/µl M2825 Available Separately Size Cat.# CIAP Buffer Pack 1.5 ml M1833 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Alkaline Phosphatase, Calf Intestinal (CIAP), catalyzes the hydrolysis of 5´-phosphate groups from DNA, RNA, and ribo- and deoxyribonucleoside triphosphates. This enzyme is used to prevent recircularization and religation of linearized cloning vector DNA by removing phosphate groups from both 5´-termini and may also be used for the dephosphorylation of 5´ phosphorylated ends of DNA or RNA for subsequent labeling with [32P]ATP and T4 Polynucleotide Kinase. CIAP is active on 5´ overhangs, 5´ recessed and blunt ends. Features: • Available at High Concentration: Cat.# M2825 contains 1,000 units of CIAP at 20u/μl. • Blue/White Cloning Qualified: Promega’s blue/white cloning assay provides a higher level of quality control for enzymes used in cloning applications. • Provided with 10X Reaction Buffer: 0.5M Tris-HCl (pH 9.3 at 25°C), 10mM MgCl2 , 1mM ZnCl2 , 10mM spermidine. Storage Conditions: Store at –20°C. TSAP Thermosensitive Alkaline Phosphatase Product Size Cat.# TSAP Thermosensitive Alkaline Phosphatase 100 units M9910 For Research Use Only. Not for Use in Diagnostic Procedures. Description: TSAP Thermosensitive Alkaline Phosphatase catalyzes the removal of 5´ phosphate groups from DNA, thus preventing the recircularization and religation of linearized cloning vector DNA during ligation. It is effective on 3´ overhangs, 5´ overhangs and blunt ends. It is also useful for preparing DNA for 5´ end-labeling by removing existing phosphate groups from the 5´ end. TSAP is irreversibly inactivated by heating at 74°C for 15 minutes. Therefore, a DNA cleanup step is not required before proceeding to a ligation reaction. TSAP is fully active in all restriction enzyme reaction buffers tested under the conditions listed below, facilitating a streamlined restriction digestion, dephosphorylation and ligation reaction. Features: • Easy To Use: TSAP is active in all Promega restriction enzyme buffers, eliminating any cleanup steps or buffer swaps. • Convenient: TSAP is irreversibly inactivated by heating at 74°C for 15 minutes. This allows streamlining of the restriction enzyme digestion, dephosphorylation and ligation procedure by eliminating the need for cleanup after alkaline phosphatase treatment. • Blue/White Cloning-Qualified: Promega’s blue/white cloning assay provides a higher level of quality control for enzymes used in cloning applications. • Provided with Promega MULTI-CORE™ Buffer. Storage Conditions: Store at –20°C. See the expiration date on the label. Polymerases DNA Polymerase I Product Size Conc. Cat.# DNA Polymerase I 500 u 5–10 u/µl M2051 2,500 u 5–10 u/µl M2055 For Research Use Only. Not for Use in Diagnostic Procedures. Description: DNA Polymerase I catalyzes the template-directed polymerization of nucleotides into duplex DNA in a 5´→3´ direction. DNA Polymerase I possesses a 3´→5´ exonuclease activity or “proofreading” function, which lowers the error rate during DNA replication, and also contains a 5´→3´ exonuclease activity, which enables the enzyme to replace nucleotides in the growing strand of DNA by nick translation. The enzyme, purified from recombinant E. coli, is capable of catalyzing de novo synthesis of synthetic homopolymers and provides a convenient method for the preparation of a variety of defined DNA substrates. Features: • Flexible: DNA Polymerase I may be used in a variety of molecular applications. • May Be Heat-Inactivated: DNA Polymerase I is inactivated by heating at 68°C for 10 minutes. • Provided with 10X Reaction Buffer: 500mM Tris-HCl (pH 7.2 at 25°C), 100mM MgSO4 , 1mM DTT. Storage Conditions: Store at –20°C. DNA Polymerase I Large (Klenow) Fragment Product Size Conc. Cat.# DNA Polymerase I Large (Klenow) Fragment 150 u 5 u/µl M2201 500 u 5 u/µl M2206 For Laboratory Use. Description: DNA Polymerase I Large (Klenow) Fragment is a DNA-dependent DNA polymerase that lacks the 5´→3´ exonuclease activity of intact E. coli DNA Polymerase I but retains its 5´→3´ polymerase, 3´→5´ exonuclease and strand displacement activities. The enzyme is a 68kDa C-terminal fragment of DNA Polymerase I. The 5´→3´ polymerase activity of Klenow Fragment can be used to fill in 5´-protruding ends with unlabeled or labeled dNTPs, to sequence single- or double-stranded DNA templates, for in vitro mutagenesis using synthetic oligonucleotides, for cDNA second-strand synthesis and to generate single-stranded DNA probes. The 3´→5´ exonuclease activity can be used to generate blunt ends from a 3´-overhang. Features: • Flexible: DNA Polymerase I Large (Klenow) Fragment may be used in a variety of molecular applications. It is also active in many Promega 1X restriction enzyme buffers. • May Be Heat-Inactivated: DNA Polymerase I Large (Klenow) Fragment is inactivated by heating at 75°C for 10 minutes. • Provided with 10X Reaction Buffer: 500mM Tris-HCl (pH 7.2 at 25°C), 100mM MgSO4 , 1mM DTT. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 116 For complete and up-to-date product information visit: www.promega.com DNA Polymerase I Large (Klenow) Fragment, Exonuclease Minus Product Size Conc. Cat.# Klenow Fragment, Exonuclease Minus 100 u 5–10 u/µl M2181 For Laboratory Use. Description: DNA Polymerase I Large (Klenow) Fragment, Exonuclease Minus, is a DNA-dependent DNA polymerase that lacks both the 5´→3´ and the 3´→5´ exonuclease activities present in intact E. coli DNA Polymerase I. It is used for random primer labeling and in strand displacement amplification. Klenow Fragment, Exonuclease Minus, will leave a single-base 3´ overhang on a significant proportion of DNA fragments during fill-in of 5´-overhangs. Therefore, this enzyme is not recommended for preparation of blunt-ended fragments for ligation. Features: • Provided with 10X Reaction Buffer: 500mM Tris-HCl (pH 7.2 at 25°C), 100mM MgSO4 , 1mM DTT. • May Be Heat-Inactivated: DNA Polymerase I Large (Klenow) Fragment, Exonuclease Minus, is inactivated by heating at 75°C for 10 minutes. Storage Conditions: Store at –20°C. T4 DNA Polymerase Product Size Conc. Cat.# T4 DNA Polymerase 100 u 5–10 u/µl M4211 500 u 5–10 u/µl M4215 For Research Use Only. Not for Use in Diagnostic Procedures. Description: T4 DNA Polymerase catalyzes the 5´→3´ synthesis of DNA from a primed single-stranded DNA template. Although possessing a potent 3´→5´ proofreading exonuclease, T4 DNA Polymerase contains no 5´→3´ exonuclease activity. T4 DNA Polymerase can be used to fill 5´ protruding ends with labeled or unlabeled dNTPs or for the generation of blunt ends from DNA molecules with 3´ overhangs. Features: • High Fidelity: T4 DNA Polymerase is the enzyme of choice for applications where misincorporation is a concern. • Flexible: T4 DNA Polymerase may be used in a variety of molecular applications. Active in many Promega 1X restriction enzyme buffers. • May Be Heat-Inactivated: T4 DNA Polymerase is inactivated by heating at 75°C for 10 minutes. • Provided with 10X Reaction Buffer: 250mM Tris-acetate (pH 7.7), 1M potassium acetate, 100mM magnesium acetate and 10mM DTT. Storage Conditions: Store at –20°C. SP6 RNA Polymerase Product Size Conc. Cat.# SP6 RNA Polymerase 1,000 u 10–20 u/µl P1085 5,000 u 10–20 u/µl P1081 SP6 RNA Polymerase (HC) 2,500 u 80 u/µl P4084 For Research Use Only. Not for Use in Diagnostic Procedures. Description: SP6 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only SP6 DNA or DNA cloned downstream from an SP6 promoter can serve as a template for SP6 RNA Polymerase-directed RNA synthesis. Features: • Specific: SP6 RNA Polymerase exhibits extremely high affinity and specificity for SP6 promoter sequences. • Highly Pure: SP6 RNA Polymerase is >90% pure as determined by SDS polyacrylamide gel electrophoresis. Free of detectable levels of contaminating RNase and DNase activity (<1% release). • Flexible: Will incorporate 32P, 33P, 3 H and 35S nucleoside triphosphates. • Provided with 5X Reaction Buffer: Provided with 100mM DTT and Transcription Optimized 5X Buffer: 200mM Tris-HCl (pH 7.9 at 25°C), 30mM MgCl2 , 10mM spermidine, 50mM NaCl. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 117 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com T3 RNA Polymerase Product Size Conc. Cat.# T3 RNA Polymerase 1,000 u 10–20 u/µl P2083 T3 RNA Polymerase (HC) 2,500 u 80 u/µl P4024 For Research Use Only. Not for Use in Diagnostic Procedures. Description: T3 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only T3 DNA or DNA cloned downstream from a T3 promoter can serve as a template for T3 RNA Polymerase-directed RNA synthesis. Features: • Specific: T3 RNA Polymerase exhibits extremely high affinity and specificity for T3 promoter sequences. • Highly Pure: T3 RNA Polymerase is >90% pure as determined by SDS polyacrylamide gel electrophoresis. Free of detectable levels of contaminating RNase and DNase activity (<1% release). • Flexible: Will incorporate 32P, 33P, 3 H and 35S nucleoside triphosphates. • Provided with 5X Reaction Buffer: Provided with 100mM DTT and Transcription Optimized 5X Buffer: 200mM Tris-HCl (pH 7.9 at 25°C), 30mM MgCl2 , 10mM spermidine, 50mM NaCl. Storage Conditions: Store at –20°C. T7 RNA Polymerase Product Size Conc. Cat.# T7 RNA Polymerase 1,000 u 10–20 u/µl P2075 5,000 u 10–20 u/µl P2077 T7 RNA Polymerase (HC) 10,000 u 80 u/µl P4074 For Research Use Only. Not for Use in Diagnostic Procedures. Description: T7 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only T7 DNA or DNA cloned downstream from a T7 promoter can serve as a template for T7 RNA Polymerase-directed RNA synthesis. Features: • Specific: T7 RNA Polymerase exhibits extremely high affinity and specificity for T7 promoter sequences. • Highly Pure: T7 RNA Polymerase is judged to be greater than 90% pure as determined by SDS polyacrylamide gel electrophoresis. Free of detectable levels of contaminating RNase and DNase activity (<1% release). • Flexible: Will incorporate 32P, 33P, 3 H and 35S nucleoside triphosphates. • Provided with 5X Reaction Buffer: Provided with 100mM DTT and Transcription Optimized 5X Buffer: 200mM Tris-HCl (pH 7.9 at 25°C), 30mM MgCl2 , 10mM spermidine, 50mM NaCl. Storage Conditions: Store at –20°C. RNA Polymerase Promoter Sequencing Primer Product Size Conc. Cat.# SP6 Promoter Primer 2 μg 10 µg/ml Q5011 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The SP6 Promoter Primer is designed for sequencing inserts cloned into the pGEM® Vectors, pALTER®-MAX Vector and pCI-neo Vectors. The primer is designed to be annealed to single-stranded DNA or, after alkaline denaturation, to double-stranded DNA. The promoter primer is purified by gel electrophoresis or HPLC. Primer Sequence • SP6: 5´-d(TATTTAGGTGACACTATAG)-3´ Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 118 For complete and up-to-date product information visit: www.promega.com Ligases LigaFast™ Rapid DNA Ligation System Product Size Cat.# LigaFast™ Rapid DNA Ligation System 30 reactions M8221 150 reactions M8225 Available Separately Size Cat.# 2X Rapid Ligation Buffer 1.5 ml C6711 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The LigaFast™ Rapid DNA Ligation System is designed for the efficient ligation of sticky-ended DNA inserts into plasmid vectors in just 5 minutes (blunt-ended inserts in as little as 15 minutes). Rapid ligation is based on the combination of T4 DNA Ligase with a unique 2X Rapid Ligation Buffer. The LigaFast™ System is designed to eliminate any further purification prior to transformation of ligated DNA. The specially formulated 2X Rapid Ligation Buffer requires no additional ATP or Mg2+ addition prior to use. Features: • Flexible: Use with 5´, 3´ or blunt-ended DNA inserts. • Fast: Ligation of cohesive ends in 5 minutes, blunt ends in 15 minutes at room temperature. • Convenient: No requirement to purify ligated DNA prior to heat-shock transformation in E. coli. Ligations conducted at room temperature. • Ready-To-Use: No additional buffer modifications required prior to use. • Efficient: Ligations performed using the LigaFast™ System are comparable to standard overnight ligations. • Blue/White Cloning Qualified: Promega’s blue/white cloning assay provides a higher level of quality control for enzymes used in cloning applications. Storage Conditions: Store at –20°C. T4 DNA Ligase Product Size Conc. Cat.# T4 DNA Ligase 100 u 1–3 u/µl M1801 500 u 1–3 u/µl M1804 T4 DNA Ligase (HC) 500 u 10–20 u/µl M1794 Available Separately Size Cat.# T4 DNA Ligase Buffer Pack 1.5 ml C1263 C1263 For Research Use Only. Not for Use in Diagnostic Procedures. M1801, M1804, M1794 For Laboratory Use. Description: T4 DNA Ligase catalyzes the joining of two strands of DNA between the 5´-phosphate and the 3´-hydroxyl groups of adjacent nucleotides in either a cohesive-ended or blunt-ended configuration. The enzyme has also been shown to catalyze the joining of RNA to either a DNA or RNA strand in a duplex molecule but will not join single-stranded nucleic acids. The T4 DNA Ligase Buffer Pack includes 3 tubes of T4 DNA Ligase 10X Reaction Buffer. The composition of the 10X reaction buffer is 300mM Tris-HCl (pH 7.8 at 25°C), 100mM MgCl2 , 100mM DTT and 10mM ATP. Features: • Available at High Concentration: Cat.# M1794 contains 500 units of T4 DNA Ligase at 10–20u/μl. • Flexible: Use with 5´, 3´ or blunt-ended DNA inserts. • Provided with 10X Reaction Buffer: 300mM Tris-HCl (pH 7.8 at 25°C), 100mM MgCl2 , 100mM DTT and 10mM ATP. • Blue/White Cloning Qualified: Promega’s blue/white cloning assay provides a higher level of quality control for enzymes used in cloning applications. Storage Conditions: Store at –20°C. T4 RNA Ligase Product Size Conc. Cat.# T4 RNA Ligase 500 u 10 u/µl M1051 For Research Use Only. Not for Use in Diagnostic Procedures. Description: T4 RNA Ligase catalyzes the ATP-dependent ligation of singlestranded RNA or DNA onto the 5´-phosphoryl termini of single-stranded RNA or DNA. The enzyme, purified from recombinant E. coli CA4 (RNase I-deficient), has an apparent molecular weight of 43.5kDa. T4 RNA Ligase also catalyzes the addition of [5´-32P] nucleoside 3´,5´-bis (phosphate) onto single-stranded RNA. Features: • May Be Heat-Inactivated: T4 RNA Ligase may be inactivated by heating at 65°C for 15 minutes. • Provided with 10X Reaction Buffer: 500mM Tris-HCl (pH 7.8 at 25°C), 100mM MgCl2 , 50mM DTT, 10mM ATP. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 119 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com Kinases and DNA Labeling Systems T4 Polynucleotide Kinase Product Size Conc. Cat.# T4 Polynucleotide Kinase 100 u 5–10 u/µl M4101 1,000 u 5–10 u/µl M4103 Available Separately Size Cat.# T4 PNK Buffer Pack 1.5 ml C1313 For Research Use Only. Not for Use in Diagnostic Procedures. Description: T4 Polynucleotide Kinase catalyzes the transfer of the γ-phosphate from ATP to the 5´-terminus of polynucleotides or to mononucleotides bearing a 5´-hydroxyl group. The enzyme, purified from recombinant E. coli, may be used to phosphorylate RNA, DNA and synthetic oligonucleotides prior to subsequent manipulations such as ligation. Features: • May Be Heat-Inactivated: T4 Polynucleotide Kinase may be inactivated by heating at 68°C for 10 minutes. • Provided with 10X Reaction Buffer: 700mM Tris-HCl (pH 7.6 at 25°C), 100mM MgCl2 , 50mM DTT. • Blue/White Cloning Qualified: Promega’s blue/white cloning assay provides a higher level of quality control for enzymes used in cloning applications. Storage Conditions: Store at –20°C. DNA 5´ End-Labeling System Product Size Cat.# DNA 5´ End-Labeling System 10 reactions U2010 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The DNA 5´ End-Labeling System is a complete system for phosphorylating both double- and single-stranded DNA and RNA with T4 Polynucleotide Kinase and [γ-32P]ATP. The system includes enzymes, buffers and control DNA standards to measure reaction efficiencies. Calf Intestinal Alkaline Phosphatase is included for removal of the 5´-phosphate prior to labeling with T4 Polynucleotide Kinase. Features: • Convenient: Can use to label both single-stranded and double-stranded DNA and RNA. • Complete: System includes enzymes, buffers and control DNA standards for measuring reaction efficiencies (except radionucleotides). • Flexible: Works with [γ-32P]ATP, [γ-33P]ATP or [γ-35S]ATP. Storage Conditions: Store at –20°C. Prime-a-Gene® Labeling System Product Size Cat.# Prime-a-Gene® Labeling System 30 reactions U1100 Available Separately Nuclease-Free Water 150 ml P1195 Labeling 5X Buffer 300 μl U1151 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Prime-a-Gene® Labeling System provides a complete set of complementary reagents, including Labeling 5X Buffer that contains random synthetic hexadeoxynucleotide primers for random-primed labeling of linear template DNA with radionucleotides. As little as 25ng of input DNA can be used to generate probes with specific activities >1 × 109 cpm/μg. Features: • Ready to Use: Includes reagents needed for random-primed labeling of linear DNA, including random synthetic hexadeoxynucleotide primers (excluding radionucleotides). • High Specific Activity: Probes with specific activities >1 × 109 cpm/μg can be generated. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 120 For complete and up-to-date product information visit: www.promega.com Nucleases Exonuclease III Product Size Conc. Cat.# Exonuclease III 5,000 u 150–200 u/µl M1811 25,000 u 150–200 u/µl M1815 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Exonuclease III is a 3´→5´ exonuclease specific for doublestranded DNA. The enzyme catalyzes the stepwise removal of mononucleotides starting from a 3´-OH at nicks, blunt ends, recessed ends and 3´-overhangs of less than 4 bases, yielding nucleoside 5´-phosphates. Exonuclease III will also degrade DNA from 3´-phosphate ends due to its intrinsic 3´-phosphatase activity. In addition, the enzyme has apurinic endonuclease activity and ribonuclease H activity. Exonuclease III is used in conjunction with S1 nuclease for unidirectional deletion of sequences from the termini of DNA fragments. Features: • Flexible: Control deletion rate by varying incubation temperature. • May Be Heat-Inactivated: Exonuclease III may be inactivated by heating to 75°C for 10 minutes. • Provided with 10X Reaction Buffer: 660mM Tris-HCl (pH 8.0 at 25°C), 6.6mM MgCl2 . Storage Conditions: Store at –20°C. Mung Bean Nuclease Product Size Conc. Cat.# Mung Bean Nuclease 2,000 u 50–100 u/µl M4311 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Mung Bean Nuclease catalyzes the degradation of single-stranded DNA and RNA endonucleolytically to yield 5´-phosphoryl-terminated products. While the nuclease prefers ssDNA over dsDNA by 30,000-fold, at very high concentrations the enzyme degrades double-stranded DNA from both ends. Mung Bean Nuclease has been used for transcript mapping studies, for flushing staggered ends and for the separation of cDNA strands after synthesis with reverse transcriptase and DNA Polymerase I. Features: • Provided with 10X Reaction Buffer: 300mM sodium acetate (pH 5.0 at 15°C), 500mM NaCl, 10mM ZnCl2 . Storage Conditions: Store at –20°C. Ribonuclease H Product Size Conc. Cat.# Ribonuclease H 50 u 0.5–2 u/µl M4281 250 u 0.5–2 u/µl M4285 For Laboratory Use. Description: Ribonuclease H (RNase H) is an endonuclease that specifically hydrolyzes the phosphodiester bonds of RNA hybridized to DNA to produce 3´-OH and 5´-P-terminated products. It will not degrade single-stranded nucleic acids, double-stranded DNA or double-stranded RNA. Storage Conditions: Store at –20°C. RNase ONE™ Ribonuclease Product Size Conc. Cat.# RNase ONE™ Ribonuclease 1,000 u 5–10 u/µl M4261 5,000 u 5–10 u/µl M4265 For Laboratory Use. Description: RNase ONE™ Ribonuclease is a 27kDa periplasmic enzyme from E. coli that catalyzes the degradation of RNA to cyclic nucleotide monophosphate (NMP) intermediates. Slower hydrolysis further catalyzes the degradation of these intermediates to 3´-NMPs. RNase ONE™ Ribonuclease is one of the few known RNases that can cleave a phosphodiester bond between any two ribonucleotides. RNase ONE™ Ribonuclease may be used to remove RNA from DNA preparations, for RNase protection assays and for mapping or quantitation of RNA by selective cleavage of single-stranded regions. Features: • Flexible: RNase ONE™ Ribonuclease has the ability to cleave phosphodiester bonds between any two ribonucleotides. • Provided with 10X Reaction Buffer: 100mM Tris-HCl (pH 7.5 at 25°C), 50mM EDTA, 2M sodium acetate. Storage Conditions: Store at –20°C. Do not freeze at –70°C. Do not store on dry ice. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 121 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com RQ1 RNase-Free DNase Product Size Conc. Cat.# RQ1 RNase-Free DNase 1,000 u 1 u/µl M6101 For Laboratory Use. Description: RQ1 RNase-Free DNase is a preparation of deoxyribonuclease I that degrades single-stranded or double-stranded DNA to produce 3´-hydroxyl oligonucleotides. This preparation is qualified for use in applications where maintaining the integrity of RNA is critical. Features: • Convenient: 10X Reaction Buffer (400mM Tris-HCl [pH 8.0 at 25°C], 100mM MgSO4 , 10mM CaCl2 ) and Stop Buffer (20mM EGTA [pH 8.0 at 25°C]) are provided. Storage Conditions: Store at –20°C. S1 Nuclease Product Size Conc. Cat.# S1 Nuclease 10,000 u 20–100 u/µl M5761 For Research Use Only. Not for Use in Diagnostic Procedures. Description: S1 Nuclease degrades single-stranded DNA and RNA endonucleolytically to yield 5´-phosphoryl-terminated products. Double-stranded nucleic acids (DNA:DNA, DNA:RNA or RNA:RNA) are resistant to degradation except with extremely high concentrations of enzyme. The enzyme is used to remove single-stranded termini from double-stranded DNA, for selective cleavage of single-stranded DNA and for mapping RNA transcripts. Features: • Provided with 10X Reaction Buffer: 0.5M sodium acetate (pH 4.5 at 25°C), 2.8M NaCl, 45mM ZnSO4 . Storage Conditions: Store at –20°C. Additional Enzymes Single-Stranded DNA Binding Protein Product Size Conc. Cat.# Single-Stranded DNA Binding Protein 100 μg 1–5 µg/µl M3011 For Research Use Only. Not for Use in Diagnostic Procedures. Description: E. coli Single-Stranded DNA Binding Protein (SSB) consists of four identical 18.9kDa subunits. It binds with high affinity in a cooperative manner to single-stranded DNA but does not bind well to double-stranded DNA. It is involved in DNA replication and in recombination in vivo. Storage Conditions: Store at –20°C. Terminal Deoxynucleotidyl Transferase, Recombinant Product Size Conc. Cat.# Terminal Deoxynucleotidyl Transferase, Recombinant 300 u 30 u/µl M1871 1,500 u 30 u/µl M1875 Available Separately Size Cat.# Terminal Transferase Buffer Pack 3 × 500 μl M1893 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Terminal Deoxynucleotidyl Transferase, Recombinant, catalyzes the repetitive addition of mononucleotides to the terminal 3´-OH of a DNA initiator accompanied by the release of inorganic phosphate. Single-stranded DNA is preferred as an initiator. Polymerization is not template-dependent. The addition of 1mM Co2+ (as CoCl2 ) in the reaction buffer allows the tailing of 3´-ends with varying degrees of efficiency. Features: • Tails Any Type of 3´ End: The presence of 1mM CoCl2 in the reaction buffer allows the tailing of any type of 3´ end (3´ and 5´ overhangs or blunt ends). • Tested for Apoptotic DNA Labeling: Each lot of enzyme is qualified for success in the procedure outlined in the DeadEnd™ Fluorometric TUNEL System Technical Bulletin #TB235. • Provided with 5X Reaction Buffer: 500mM cacodylate buffer (pH 6.8 at 25°C), 5mM CoCl2 , 0.5mM DTT. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 122 For complete and up-to-date product information visit: www.promega.com Ribonuclease Inhibitors RNasin® Ribonuclease Inhibitors Product Size Conc. Cat.# RNasin® Ribonuclease Inhibitor 2,500 u 20–40 u/µl N2111 10,000 u 20–40 u/µl N2115 Recombinant RNasin® Ribonuclease Inhibitor 2,500 u 20–40 u/µl N2511 10,000 u 20–40 u/µl N2515 RNasin® Plus RNase Inhibitor 2,500 u 40 u/µl N2611 10,000 u 40 u/µl N2615 N2111, N2115 For Research Use Only. Not for Use in Diagnostic Procedures. N2511, N2515, N2611, N2615 For Laboratory Use. Description: RNases are ubiquitous and can cause RNA degradation and compromise RNA integrity. Native and Recombinant RNasin® Inhibitors are 50kDa proteins that inhibit RNase A family and human placental RNases by noncovalently binding to RNases in a 1:1 ratio. RNasin® Plus RNase Inhibitor is a recombinant mammalian RNase inhibitor that is expressed as a soluble protein in E. coli, allowing easy purification through a combination of ion exchange and hydrophobic interaction chromatography. The protein is capable of inhibiting eukaryotic RNases (e.g., RNase A and RNase B) similarly to human placental RNase inhibitor. RNasin® Plus RNase Inhibitor is tested in RT-PCR and compatible with enzymes such as AMV, M-MLV and ImProm-II™ Reverse Transcriptases or Taq and Tfl DNA Polymerases. RNasin® Plus RNase Inhibitor also is tested and compatible with quantitative, real-time RT-PCR in a TaqMan® assay. RNasin® Plus RNase Inhibitor offers increased resistance to oxidation over the human version of the protein. Two cysteines in the human protein have been identified as especially sensitive to oxidation and react by forming a disulfide bond that can block the active site of the inhibitor. RNasin® Plus, through natural amino acid diversity, lacks the ability to form this site-blocking disulfide. In addition, the new protein has characteristics never before realized, including continued inhibition of RNases above 50°C. Heating solutions of RNasin® Plus and RNase followed by cooling does not result in the reappearance of RNase activity—even when the solution is heated above the denaturation temperature of the RNasin® Plus protein alone. This allows RNasin® Plus to protect RNA species prior to, during and after heating, even at temperatures normally used during first-strand DNA synthesis in RT-PCR. Solutions heated up to 70°C for 15 minutes did not result in RNase reactivation. Features: • Achieve Broad-Spectrum RNase Inhibition: Inhibits common eukaryotic RNases. • Use with Many Enzymes: Does not inhibit SP6, T7 or T3 RNA Polymerase; GoScript™ Reverse Transcriptase, AMV or M-MLV Reverse Transcriptase; or Taq DNA polymerase. • Use in Many Downstream Assays: Functional across wide pH range (pH 5–8). • Choose Native or Recombinant Form: Recombinant form is made in bacteria, minimizing the chances of human nucleic acid contamination. With RNasin® Plus RNase Inhibitor, you also can: • Improve Resistance to Oxidation: Due to natural amino acid diversity, RNasin® Plus lacks the capability to form the active site-blocking disulfide bond that can form in the human protein under oxidative conditions. • Improve Purification: RNasin® Plus is expressed by E. coli as a soluble protein, allowing easy purification by a combination of ion exchange and hydrophobic interaction chromatography. No direct affinity chromatography required. The new process yields a >90% pure protein with no E. coli RNase carryover. • Use with RT-PCR Systems: RNasin® Plus has proven compatible with the Access and AccessQuick™ RT-PCR Systems, M-MLV Reverse Transcriptase, ImProm-II™ Reverse Transcription System and the GoScript™ Reverse Transcription System. Also proven compatible with TaqMan®-based RT-PCR Systems. • Protect During RNA Template Denaturation: Heating mixtures of RNasin® Plus RNase Inhibitor and RNase does not lead to reactivation of the RNase at temperatures even as high as 70°C for 15 minutes. Many RT-PCR protocols call for RNA template denaturation (e.g., 65–70°C for 5–10 minutes) in the presence of the RT primers prior to full RT reaction assembly for maximum sensitivity. You can now include RNasin® Plus at this step. • Protect During Higher Temperature RT Reactions: Add RNasin® Plus RNase Inhibitor during RT reaction assembly and take the reaction to temperatures above 50°C with enzymes like the ImProm-II™ and AMV Reverse Transcriptases. RNases that may be present will not be reactivated at the higher temperature. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 123 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com Subcloning Tools and Vectors Subcloning Tools Bundle Product Size Cat.# Subcloning Tools Bundle 1 each M1060 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Speed your subcloning with these easy-to-use tools. Purchase the Subcloning Tools Bundle, and get LigaFast™ Rapid DNA Ligation System, TSAP Thermosensitive Alkaline Phosphatase, BenchTop 100bp DNA Ladder, Wizard® SV Gel and PCR Clean-Up System and PureYield™ Plasmid Miniprep System for one low price. Features: • LigaFast™ Rapid DNA Ligation System: Rapid room temperature ligations of vectors and inserts in as little as 5 minutes. Transform competent bacteria immediately following the reaction. • TSAP Thermosensitive Alkaline Phosphatase: Use rapid protocol (included) to digest and dephosphorylate at the same time or use in a standard application. Heat-kill the enzyme after the reaction in 15 minutes. Active in common restriction enzyme buffers with no zinc requirement. • BenchTop 100bp DNA Ladder: Ready-to-load marker for agarose gel electrophoresis. Use when gel purifying either vector or insert. • Wizard® SV Gel and PCR Clean-Up System: Rapid gel purification of fragments for 100bp to 10kb. Great for removing enzymes from DNA as well. High-capacity and low elution volume. • PureYield™ Plasmid Miniprep System: Rapid 10-minute miniprep. Prepare your vector for subcloning or use to screen for recombinants. Storage Conditions: Store the LigaFast™ Rapid DNA Ligation System (M8221) and TSAP Thermosensitive Alkaline Phosphatase (M9910) at –20°C. Store the BenchTop 100bp DNA Ladder at 22–25°C; storage at –20°C can enhance the shelf life of this product. Store the Wizard® SV Gel and PCR Clean-Up System (A9281) and PureYield™ Plasmid Miniprep System (A1223) at 22–25°C. Flexi® Cloning System Product Size Cat.# Flexi® System, Entry/Transfer 5 entry and 20 transfer reactions C8640 Flexi® System, Transfer 100 transfer reactions C8820 Carboxy Flexi® System, Transfer 50 transfer reactions C9320 HaloTag® Cloning Starter System 1 each G6050 Available Separately 10X Flexi® Enzyme Blend (SgfI & PmeI) 25 μl R1851 100 μl R1852 Carboxy Flexi® Enzyme Blend (SgfI & EcoICRI) 50 μl R1901 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Flexi® Vector System is a directional cloning method for protein-coding sequences. It is based on two rare-cutting restriction enzymes, SgfI and PmeI, and provides a rapid, efficient and high-fidelity way to transfer protein-coding regions without the need to resequence. All Flexi® Vectors carry the lethal barnase gene, which is replaced by the DNA fragment of interest and acts as a positive selection for the successful ligation of the insert. Unlike site-specific recombination vector systems, the Flexi® Vector Systems do not require appending multiple amino acids to the amino or carboxy termini of the protein of interest. In addition, the systems do not require an archival entry vector, and most applications allow direct entry into the vector suited to the experimental design. C-terminal Flexi® Vectors allow expression of C-terminal-tagged proteins. While these vectors can act as acceptors of protein-coding regions flanked by SgfI and PmeI, they lack a PmeI site and contain a different blunt-ended site, EcoICRI. This joined sequence cannot be removed from the C-terminal Flexi® Vectors and transferred to other Flexi® Vectors. Features: • Versatility: You can choose between a variety of initial applications (e.g., bacterial protein, mammalian or cell-free protein expression) and then transfer to others as required. • Time Savings: Efficient transfer allows direct use of recombinant clones, minimizing time wasted screening background colonies. • Enhanced Productivity: Adaptable to high-throughput formats for large screening projects. • Easy Access: No licensing fees or complicated transfer restrictions. Storage Conditions: Cat.# C8640 is comprised of Cat.# C8641 and A9280. Store Cat.# C8641 at –20°C; store Cat.# A9280 at room temperature. Store Cat.# C8820 and C9320 at –20°C. Store enzyme blends at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 124 For complete and up-to-date product information visit: www.promega.com Untagged Flexi® Mammalian Expression Vectors Product Size Cat.# pF4A CMV Flexi® Vector 20 μg C8481 pF4K CMV Flexi® Vector 20 μg C8491 pF5A CMV-neo Flexi® Vector 20 μg C9401 pF5K CMV-neo Flexi® Vector 20 μg C9411 pF9A CMV hRluc-neo Flexi® Vector 20 μg C9361 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These vectors are designed specifically for high-level expression of proteins in mammalian cells from the CMV promoter with or without a selectable marker. The pFN9A Vector provides Renilla luciferase, which may be used as a transfection control. The pFN9A Vector was designed to complement pGL4 firefly luciferase vectors when exogenous proteins (e.g., a receptor of transcription factor) must be expressed for reporter assays. All inserts may be confirmed by cell-free expression with the TnT® T7 Quick System (Cat.# L1170). Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Versatility: You can choose between a variety of initial applications (e.g., bacterial protein, mammalian, or cell-free protein expression) and then transfer to others as required. • Time Savings: Efficient transfer allows direct use of recombinant clones, minimizing time wasted screening background colonies. • Enhanced Productivity: Adaptable to high-throughput formats for large screening projects. • Easy Access: No licensing fees or complicated transfer restrictions. Storage Conditions: Store vectors at –20°C. HaloTag® Vectors for E. coli and Cell-Free Protein Expression Product Size Cat.# pH6HTN His6 HaloTag® T7 Vector 20 μg G7971 pH6HTC His6 HaloTag® T7 Vector 20 μg G8031 pF1A T7 Flexi® Vector 20 μg C8441 pF1K T7 Flexi® Vector 20 μg C8451 pFN18A HaloTag® T7 Flexi® Vector 20 μg G2751 pFN18K HaloTag® T7 Flexi® Vector 20 μg G2681 pFN19A HaloTag® T7 SP6 Flexi® Vector 20 μg G1891 pFN19K HaloTag® T7 SP6 Flexi® Vector 20 μg G1841 pFC20A HaloTag® T7 SP6 Flexi® Vector 20 μg G1681 pFC20K HaloTag® T7 SP6 Flexi® Vector 20 μg G1691 pFN29A His6 HaloTag® T7 Flexi® Vector 20 μg G8261 pFN29K His6 HaloTag® T7 Flexi® Vector 20 μg G8331 pFC30A His6 HaloTag® T7 Flexi® Vector 20 μg G8321 pFC30K His6 HaloTag® T7 Flexi® Vector 20 μg G8381 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These vectors are used for inducible expression of HaloTag® fusion proteins in E. coli and cell-free systems using the T7 RNA polymerase promoter. Expression levels depend highly on the nature of the protein, but in general the N-terminal HaloTag® fusion protein (e.g., pFN18A/K, Cat.# G2751, G2681) can increase expression level, enhance refolding and boost solubility of the expressed protein. HaloTag® vectors are supplied in two formats: as multiple cloning site (MCS) vectors for traditional cloning and as Flexi® System vectors. Multiple Cloning Site (MCS) Vectors pH6HTN His6 HaloTag® T7 Vector (Cat.# G7971) is designed for protein expression with an N-terminal His6 -HaloTag® dual tag in E. coli and T7 cell-free expression systems. pH6HTC His6 HaloTag® T7 Vector (Cat.# G8031) is designed for protein expression with a C-terminal His6 -HaloTag® dual tag in E. coli and T7 cell-free expression systems. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 125 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com Flexi® System Vectors pF1A/K T7 Flexi® Vectors (Cat.# C8441, C8451) are designed for untagged protein expression. pFN18A/K HaloTag® T7 Flexi® Vectors (Cat.# G2751, G2681) are designed for protein expression with an N-terminal HaloTag® in E. coli and T7 cell-free expression systems. pFN19A/K HaloTag® T7 SP6 Flexi® Vectors (Cat.# G1891, G1841) are designed for protein expression with an N-terminal HaloTag® in T7 and SP6 cell-free expression systems. These vectors are optimized for cell-free expression systems. pFC20A/K HaloTag® T7 SP6 Flexi® Vectors (Cat.# G1681, G1691) are designed for protein expression with a C-terminal HaloTag® in E. coli and SP6 cell-free expression systems. These vectors are optimized for cell-free expression systems. pFN29A/K His6 HaloTag® T7 Flexi® Vectors (Cat.# G8261, G8331) are designed for protein expression with an N-terminal His6 -HaloTag® dual tag in E. coli T7 cell-free expression systems. pFC30A/K His6 HaloTag® T7 Flexi® Vectors (Cat.# G8321, G8381) are designed for protein expression with a C-terminal His6 -HaloTag® dual tag in E. coli T7 cell-free expression systems. Transferring coding regions in the Flexi® Vector System. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Choice of Systems: Choose between traditional (MCS) and Flexi® cloning to get the benefits of HaloTag® technology. • Dual Tag: Couple the protein solubility and labeling benefits of HaloTag® technology with the reusability and the throughput of Ni-affinity technology. • Versatile Cloning: Choose from a variety of expression systems and fusion tag orientations and then transfer to others as required (for Flexi® system). • Time Savings: Barnase insert (Flexi® system) decreases the number of background colonies, allowing efficient transfer of genetic constructs. Storage Conditions: Store vectors at –20°C. 4597MA SgfI PmeI lethal gene Ampr Kanr SgfI PmeI lethal gene Kanr SgfI PmeI proteincoding region proteincoding region Ampr SgfI PmeI Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 126 For complete and up-to-date product information visit: www.promega.com HQ and GST Tag Flexi® Vectors for E. coli and Cell-Free Protein Expression Product Size Cat.# pFN2A (GST) Flexi® Vector 20 μg C8461 pFN2K (GST) Flexi® Vector 20 μg C8471 pFN6A (HQ) Flexi® Vector 20 μg C8511 pFN6K (HQ) Flexi® Vector 20 μg C8521 pFC7A (HQ) Flexi® Vector 20 μg C8531 pFC7K (HQ) Flexi® Vector 20 μg C8541 pF1A T7 Flexi® Vector 20 μg C8441 pF1K T7 Flexi® Vector 20 μg C8451 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These vectors are used for inducible expression of HQ- and GST-tagged fusion proteins in E. coli and cell-free systems using the T7 RNA polymerase promoter. The HQ tag and polyhistidine tag (His) are comparable in their affinity for Ni ions and will bind to all His-binding surfaces and resins. In certain cases the HQ-tagged proteins can be eluted from the affinity columns at lower concentrations of imidazole—a property useful for some downstream applications such as enzymatic reactions. As with His tag, proteins can be expressed from bacterial, insect and mammalian systems and purified under either native or denaturing conditions. The GST tag has been successfully used to boost tagged protein solubility during E. coli expression. pFN2A/K (GST) Flexi® Vectors are designed for protein expression with an N-terminal GST tag in E. coli and T7 cell-free expression systems. pFN6A/K (HQ) Flexi® Vectors are designed for protein expression with an N-terminal HQ tag in E. coli and T7 cell-free expression systems. pFC7A/K (HQ) Flexi® Vectors are designed for protein expression with an C-terminal HQ in E. coli and T7 cell-free expression systems. pF1A/K T7 Flexi® Vectors (Cat.# C8441, C8451) are designed for inducible expression of native untagged protein. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Easy to Implement and Reliable: Choose between traditional His-affinity and GST-affinity resins for standard protein purification and prokaryotic expression applications. • Cost-Effective: Technology for reusable and cost-efficient Ni (His-affinity) and gluthathione (GST-affinity) resins. • Versatile Cloning: Choose from a variety of expression systems and fusion tag orientations and then transfer to others as required (for Flexi® system). • Time Savings: Barnase insert (Flexi® system) decreases the number of background colonies, allowing efficient transfer of genetic constructs. Storage Conditions: Store vectors at –20°C. pALTER®-MAX Vector Product Size Cat.# pALTER®-MAX Vector 20 μg Q5761 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pALTER®-MAX Vector is a 5,534bp plasmid. It contains the human cytomegalovirus (CMV) immediate-early enhancer/promoter region for strong, constitutive expression of cloned DNA inserts in a variety of mammalian cell types. The pALTER®-MAX Vector as supplied is chloramphenicol-resistant and ampicillin-sensitive. Storage Conditions: Store vector DNA at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 127 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com pGEM®-3Z Vector Product Size Cat.# pGEM®-3Z Vector 20 μg P2151 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-3Z Vector is intended for use as a standard cloning vector, as well as for the highly efficient synthesis of RNA in vitro. The vector carries the lacZ α-peptide and the multiple cloning region arrangement from pUC18 allowing selection of recombinants by blue/white screening. In addition, the vector contains both the SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. The pGEM®-3Z and pGEM®-4Z Vectors are essentially identical except for the orientation of the SP6 and T7 promoters. Features: • Blue/White Screening: Allows the easy identification of recombinant clones. • Versatile: This vector can be used for standard cloning and in vitro transcription from SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C. 0278VA05_4A ScaI 1818 AatII 2260 NdeI 2509 ori pGEM-3Z Vector (2,743bp) Ampr EcoRI SacI KpnI AvaI XmaI SmaI BamHI XbaI SalI AccI HincII PstI SphI HindIII SP6 T7 1 start 5 15 21 21 21 23 26 32 38 39 40 48 54 56 69 ➞ ➞ XmnI 1937 SspI 2142 NarI 2561 lacZ pGEM®-3Zf(+/–) Vectors Product Size Cat.# pGEM®-3Zf(+) Vector 20 μg P2271 pGEM®-3Zf(–) Vector 20 μg P2261 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-3Zf(+/–) Vectors contain T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be identified directly by color screening on indicator plates when using appropriate E. coli strains (e.g., JM109). The multiple cloning region contains unique restriction sites for EcoRI, SacI, KpnI, AvaI, SmaI, BamHI, XbaI, SalI, AccI, HincII, PstI, SphI and HindIII. The pGEM®-3Zf(+/–) Vectors can be used as standard cloning vectors and as templates for in vitro transcription. Features: • Blue/White Screening: Allows the easy identification of recombinant clones. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C and bacterial strain at –70°C. ScaI 1818 AatII 2260 NdeI 2509 ori pGEM®-3Zf(+/–) Vectors Ampr EcoRI SacI KpnI AvaI SmaI BamHI XbaI SalI AccI HincII PstI SphI HindIII SP6 T7 1 start 5 15 21 21 23 26 32 38 39 40 48 54 56 69 XmnI 1937 lacZ (3,197bp) Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 128 For complete and up-to-date product information visit: www.promega.com pGEM®-4Z Vector Product Size Cat.# pGEM®-4Z Vector 20 μg P2161 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-4Z Vector is intended for use as a standard cloning vector, as well as for the highly efficient synthesis of RNA in vitro. The vector carries the lacZ α-peptide and the multiple cloning region arrangement from pUC18 allowing selection of recombinants by blue/white screening. In addition, the vector contains both the SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. The pGEM®-3Z and pGEM®-4Z Vectors are essentially identical except for the orientation of the SP6 and T7 promoters. Features: • Blue/White Screening: Allows the easy identification of recombinant clones. • Versatile: This vector can be used for standard cloning and in vitro transcription from SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C and bacterial strain at –70°C. 0280VA05_4A ScaI 1820 AatII 2262 NdeI 2511 ori pGEM-4Z Vector (2,746bp) Ampr EcoRI SacI KpnI AvaI XmaI SmaI BamHI XbaI SalI AccI HincII PstI SphI HindIII SP6 T7 1 start 7 17 23 23 23 25 28 34 40 41 42 50 56 58 70 ➞ ➞ XmnI 1939 SspI 2144 NarI 2563 lacZ pGEM®-5Zf(+) Vector Product Size Cat.# pGEM®-5Zf(+) Vector 20 μg P2241 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-5Zf(+) Vector serves as a standard cloning vector and as a template for in vitro transcription. The vector contains T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be identified directly by color screening on indicator plates when using appropriate E. coli strains (e.g., JM109). The multiple cloning region contains unique restriction sites for ApaI, AatII, SphI, NcoI, SacII, EcoRV, SpeI, NotI, PstI, SalI, NdeI, SacI, BstXI and NsiI. Features: • Blue/White Screening: Allows the easy identification of recombinant clones. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C and bacterial strain at –70°C. ori (3,000bp) Ampr ApaI AatII SphI NcoI SacII EcoRV SpeI NotI PstI SalI NdeI SacI BstXI NsiI T7 1 start 14 20 26 37 46 51 55 62 73 75 82 94 103 112 126 XmnI 1994 lacZ SP6 ScaI 1875 pGEM®-5Zf(+) Vector Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 129 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com pGEM®-7Zf(+/–) Vectors Product Size Cat.# pGEM®-7Zf(+) Vector 20 μg P2251 pGEM®-7Zf(–) Vector 20 μg P2371 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-7Zf(+\–) Vectors serve as standard cloning vectors and as templates for in vitro transcription. These plasmids contain SP6 and T7 RNA polymerase promoters flanking a region of multiple cloning sites within the α-peptide coding region of β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be identified directly by color screening on indicator plates when using appropriate E. coli strains (e.g., JM109). The multiple cloning region is unique and includes restriction sites for ApaI, AatII, SphI, XbaI, XhoI, EcoRI, KpnI, SmaI, ClaI, HindIII, BamHI, SacI, BstXI and NsiI. Features: • Blue/White Screening: Allows the easy identification of recombinant clones. • Versatile: This standard cloning vector allows in vitro transcription from SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C and bacterial strain at –70°C. ScaI 1872 ori pGEM®-7Zf(+) Vector (2,997bp) Ampr SP6 T7 14 20 26 31 37 43 53 56 61 67 72 78 91 100 109 ➞ ➞ XmnI 1991 lacZ ApaI AatII SphI XbaI XhoI EcoRI KpnI SmaI Csp45I ClaI HindIII BamHI SacI BstXI NsiI 0286VC02_5A 1 start 123 pGEM®-9Zf(–) Vector Product Size Cat.# pGEM®-9Zf(–) Vector 20 μg P2391 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-9Zf(–) Vector is a recombinant plasmid designed to provide a versatile range of cloning strategies and efficient synthesis of RNA in vitro. The plasmid contains T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be identified directly by color screening on indicator plates when using appropriate E. coli strains (e.g., JM109). The multiple cloning region is unique and includes restriction sites for NsiI, SpeI, HindIII, XbaI, EcoRI, SalI and SacI. Features: • Excisable SP6/T7 Insert: This vector allows the excision of an insert containing the SP6 and T7 RNA polymerase promoters. • Blue/White Screening: Allows the easy identification of recombinant clones. • Versatile: This vector can be used for standard cloning and for in vitro transcription from SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C and bacterial strain at –70°C. ScaI 1816 ori (2,912bp) Ampr SP6 T7 82 XmnI 1935 NaeI 2382 lacZ NsiI SpeI HindIII XbaI EcoRI SalI SacI Tth111I NotI SfiI 2879 2887 9 12 18 27 36 42 52 pGEM®-9Zf(–) Vector 55 1 start Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 130 For complete and up-to-date product information visit: www.promega.com pGEM®-11Zf(+) Vector Product Size Cat.# pGEM®-11Zf(+) Vector 20 μg P2411 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-11Zf(+) Vector can be used as a standard cloning vector and as a template for in vitro transcription. This plasmid contains T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the α-peptide coding region of β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be identified directly by color screening on indicator plates when using appropriate E. coli strains (e.g., JM109). The multiple cloning region contains unique restriction sites for SfiI, SacI, EcoRI, SalI, XhoI, BamHI, ApaI, XbaI, NotI, SphI, NsiI and HindIII. Features: • Blue/White Screening: Allows the easy identification of recombinant clones. • Versatile: This vector can be used for standard cloning and in vitro transcription from SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C and bacterial strain at –70°C. ScaI 1842 ori pGEM®-11Zf(+) Vector (3,221bp) Ampr SP6 T7 1 start 17 27 29 35 41 47 57 59 67 76 78 80 93 ➞ ➞ XmnI 1961 lacZ SfiI SacI EcoRI SalI XhoI BamHI ApaI XbaI NotI SphI NsiI HindIII AatII 2284 NdeI 2533 0290VC05_4A pSP64 Poly(A) Vector Product Size Cat.# pSP64 Poly(A) Vector 20 μg P1241 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pSP64 Poly(A) Vector can be used as a standard cloning vector and for in vitro transcription from the SP6 promoter. The pSP64 Poly(A) Vector also can be used to generate poly(A)+ transcripts in vitro. The vector has a stretch of 30 dA:dT residues inserted between the SacI and EcoRI sites. Therefore, when foreign DNA is cloned into any polylinker site other than EcoRI (HindIII, PstI, SalI, AccI, HincII, XbaI, BamHI, AvaI, SmaI or SacI), linearization of the recombinant plasmid with EcoRI allows the use of SP6 RNA polymerase in vitro to prepare RNA copies of the inserted sequences that contain a synthetic 3´ “poly(A)” tail of 30 residues. Features: • In Vitro Transcription: The SP6 promoter is next to the polylinker. • Generates Poly(A)+ Transcripts In Vitro: A stretch of 30 dA:dT residues are inserted between the SacI and EcoRI sites in the polylinker. Poly(A) tails can stabilize RNAs and lead to greater yields for in vitro translation reactions. • Convenient: Multiple cloning region provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C. 0306VA05_2A PvuI 1704 AatII 2256 pSP64 Poly(A) Vector (3,030bp) Ampr ori HindIII PstI SalI AccI HincII XbaI BamHI AvaI SmaI SacI (dA:dT) 30 EcoRI SP6 1 start 7 20 22 23 24 28 34 39 41 50 86 ➞ PvuII 265 BglI 1454 FspI 1556 ScaI 1814 XmnI 1933 SspI 2138 SphI 2599 NaeI 2758 NheI 2789 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 131 8Cloning and DNA Markers For complete and up-to-date product information visit: www.promega.com pSP72 Vector Product Size Cat.# pSP72 Vector 20 μg P2191 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pSP72 Vector can be used as a standard cloning vector and also can be used for transcription of RNA in vitro. The pSP72 Vector contains the SP6 and T7 RNA polymerase promoters flanking a unique multiple cloning region, which includes restriction sites for XhoI, PvuII, HindIII, SphI, PstI, SalI, AccI, XbaI, BamHI, SmaI, KpnI, SacI, EcoRI, ClaI, EcoRV and BglII. The pSP72 and pSP73 Vectors are essentially identical except for the orientation of the multiple cloning site region. Features: • Versatile: This vector can be used for standard cloning and in vitro transcription from SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C. 0298VA05_2A PvuI 1578 AatII 2130 pSP72 Vector (2,462bp) Ampr ori XhoI PvuII HindIII SphI PstI SalI AccI XbaI BamHI SmaI KpnI SacI EcoRI ClaI EcoRV BglII SP6 T7 1 start 4 12 16 26 32 34 35 40 46 53 59 65 67 74 81 85 101 ➞ ➞ HpaI 136 BglI 1328 FspI 430 ScaI 1688 XmnI 1807 SspI 2012 NdeI 2379 pSP73 Vector Product Size Cat.# pSP73 Vector 20 μg P2221 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pSP73 Vector offers a wide range of restriction sites, providing greater versatility in cloning and transcription of RNA in vitro. The pSP73 Vector contains the SP6 and T7 RNA polymerase promoters and a unique multiple cloning region, which includes restriction sites for BglII, EcoRV, ClaI, EcoRI, SacI, KpnI, SmaI, BamHI, XbaI, SalI, AccI, PstI, SphI, HindIII, PvuII and XhoI. The pSP72 and pSP73 Vectors are essentially identical except for the orientation of the multiple cloning region. Features: • Versatile: This vector can be used for standard cloning and in vitro transcription from SP6 and T7 RNA polymerase promoters flanking the multiple cloning region. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store vector at –20°C. PvuI 1580 AatII 2132 pSP73 Vector (2,464bp) Ampr ori BglII EcoRV ClaI EcoRI SacI KpnI SmaI BamHI XbaI SalI AccI PstI SphI HindIII PvuII XhoI SP6 T7 1 start 6 14 19 24 34 40 42 45 51 57 58 67 73 75 83 87 103 ➞ ➞ HpaI 138 BglI 1330 FspI 1432 ScaI 1690 XmnI 1809 SspI 2014 NdeI 2381 0300VA05_2A Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 132 For complete and up-to-date product information visit: www.promega.com Bacterial Strains and Competent Cells Bacterial Strains Product Size Cat.# Bacterial Strain ES1301 mutS, Glycerol Stock (noncompetent) 200 μl Q6131 Bacterial Strain BMH 71-18 mutS, Glycerol Stock (noncompetent) 500 μl Q6321 Bacterial Strain JM109, Glycerol Stock 500 μl P9751 Bacterial Strain JM109(DE3), Glycerol Stock 500 μl P9801 Bacterial Strain LE392, Glycerol Stock 500 μl K9981 Bacterial Strain NM522, Glycerol Stock 500 μl P2301 For Research Use Only. Not for Use in Diagnostic Procedures. Competent Cells Product Size Cat.# Single Step (KRX) Competent Cells 20 × 50 μl L3002 L-Rhamnose Monohydrate 10 g L5701 50 g L5702 Single-Use JM109 Competent Cells, >108 cfu/µg 1 ml L2005 JM109 Competent Cells, >107 cfu/μg 1 ml L1001 JM109 Competent Cells, >108 cfu/μg 1 ml L2001 Single-Use HB101 Competent Cells, >108 cfu/µg 1 ml L2015 HB101 Competent Cells, >108 cfu/μg 1 ml L2011 Single-Use BL21(DE3)pLysS Competent Cells 1 ml L1195 BL21(DE3)pLysS Competent Cells, >106 cfu/μg 1 ml L1191 For Research Use Only. Not for Use in Diagnostic Procedures. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 133 9 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Nucleic Acid Extraction DNA Extraction 134 Plasmid Purification 144 RNA Extraction 149 Total Nucleic Acid Extraction 154 DNA/RNA Cleanup and Concentration 155 Nucleic Acid Extraction Table of Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 134 For complete and up-to-date product information visit: www.promega.com DNA Extraction Molecular Biology Lab Guide Product Size Cat.# Molecular Biology Lab Guide 1 each GEN1978 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Molecular Biology Lab Guide (6” × 9”, 132 pages) is a resource designed for the scientist just embarking on their career. The Guide focuses on fundamental technologies and techniques to provide an overview of the work you might encounter in a molecular biology research setting. Through the combination of conversational writing, helpful ProTips, and real-life examples, the Molecular Biology Lab Guide is like having your own personal tutor to explain basic concepts that can help you navigate through the challenges that come with molecular biology research. Features: • Spiral-bound for lay-flat reference • QR codes for easy video viewing • Pullout guides/references • Compact size ideal for daily use • Dedicated space for taking notes Maxwell® FSC DNA IQ™ Casework Kit Product Size Cat.# Maxwell® FSC DNA IQ™ Casework Kit 48 preps AS1550 Not For Medical Diagnostic Use. Description: The Maxwell® FSC DNA IQ™ Casework Kit is designed for optimal DNA extraction from forensic casework samples. These samples may include blood stains, semen stains, hairs, cigarette butts, tissue samples and trace or “touch” DNA samples regularly encountered in forensic DNA analysis. The kit contains the same trusted reagents as the DNA IQ™ System in a convenient, prefilled cartridge format and is optimized to provide a final DNA extract in a pure, concentrated format. The Maxwell® FSC DNA IQ™ Casework Kit uses a plastic cartridge and newly designed plunger that allow DNA elution in a final volume of no more than 50μl. DNA IQ™ Lysis Buffer, Resin and Wash Buffer are included in the prefilled cartridge, and DNA IQ™ Elution Buffer is included in the kit to ensure proper storage of the DNA. The Maxwell® FSC DNA IQ™ Casework Kit is compatible with the Maxwell® FSC Instrument (Chapter 13), which includes a surface tablet and easy, intuitive interface. Features: • Use for blood stains, semen stains, hairs, cigarette butts, tissue samples and trace or “touch” DNA samples. • Easy-to-use spin baskets circumvent the need to transfer swabs helping minimize cross-contamination. • Uses the same reagents as the DNA IQ™ Systems in an automated format. Storage Conditions: Store at 15–30°C. Forensic Grade Consumables Product Size Cat.# Elution Tubes, 0.5ml 50/pack AS7201 FSC Plungers 50/pack AS7151 LEV Plungers 50/pack AS1651 Nuclease-Free Water 150ml P1196 DNA IQ™ Spin Baskets 50/pack V1225 ClickFit Microtube, 1.5ml 100/pack V4745 AS7201, AS7151, AS1651, V1225, V4745 Not For Medical Diagnostic Use. P1196 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Promega forensic products are manufactured in alignment with the ISO 18385 standard. This standard ensures minimal risk of human DNA contamination for products used to collect, store and analyze biological materials for forensic purposes. Use with both Maxwell® FSC DNA IQ™ Casework Kit and DNA IQ™ Casework Pro Kit for Maxwell® 16. Learn more at: www.promega.com/products/genetic-identity/forensic-grade-faq/ Storage Conditions: Store all Forensic Grade Consumables at 15–30°C. Nuclease-Free Water can be stored at any temperature below 30°C. Maxwell® HT DNA FFPE Isolation System Product Size Cat.# Maxwell® HT DNA FFPE Isolation System 4 × 96 preps A6372 Available Separately Size Cat.# Buffer A (BWA) 125 ml A6371 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® HT DNA FFPE Isolation System provides a simple and reliable method for high-throughput, rapid isolation of genomic DNA from FFPE (formalin-fixed, paraffin-embedded) tissue samples. The purified DNA can be used directly in a variety of downstream applications, including PCR and next-generation sequencing. The Maxwell® HT DNA FFPE Isolation System purifies nucleic acid using paramagnetic particles, which provide a mobile solid phase to optimize sample capture, washing and purification of gDNA. The use of paramagnetic particles for DNA capture eliminates the need for centrifugation or vacuum manifolds, making the system suitable for full automation. In addition, the system does not require an organic solvent, making it safe and convenient. Features: • Robust, precipitation-free protocol, no chance of lost pellets • High yields of pure DNA from FFPE samples without using xylene or other hazardous chemicals • Ideal for use in downstream applications including qPCR and nextgeneration sequencing (NGS) Storage Conditions: Store at room temperature (15–30°C). Do not refrigerate or freeze any of the reagents. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 135 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com Maxwell® RSC PureFood Pathogen Kit Product Size Cat.# Maxwell® RSC PureFood Pathogen Kit 48 preps AS1660 Not For Medical Diagnostic Use. Description: If you need to make quick decisions about potential food spoilage and contamination, the Maxwell® RSC PureFood Pathogen Kit offers a simple extraction protocol to obtain high-quality bacterial DNA from a variety of food sample types. The kit works with inhibiting sample types, and can lyse both Gram+ or Gram– bacteria, eliminating laborious sample preparation steps like enzymatic pretreatment. The extracted DNA is ready for advanced downstream molecular analyses including NGS, serotyping, and identification of spoilage organisms. The high-performance Maxwell® chemistries coupled with the trusted benchtop Maxwell® RSC instrument allow you to purify bacterial DNA from food samples in as little as 40 minutes, giving you the ability to get answers more quickly. Features: • Isolate DNA from raw or processed food samples • Works well with inhibiting sample types • No need for labor-intensive sample processing Storage Conditions: Store at 15–30°C. Maxwell® RSC FFPE Plus DNA Kit Product Size Cat.# Maxwell® RSC FFPE Plus DNA Kit 48 preps AS1720 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® RSC FFPE Plus DNA Kit is used with the Maxwell® RSC Instruments to extract DNA from formalin-fixed, paraffin-embedded tissue samples. The kits are designed for optimal purification of DNA from one to ten 5μm thin sections of FFPE tissue samples, maximizing yield and eliminating the need to concentrate the extract prior to amplification. The protocol provides overnight proteinase K digestion of samples prior to DNA purification. After proteinase K digestion, tissue lysates are placed directly into the FFPE Kit cartridges, and amplification-ready genomic DNA is obtained in approximately 30 minutes. The Maxwell® RSC Instrument processes 1–16 cartridges per run. The Maxwell® RSC 48 Instrument processes 1–48 samples per run. The kit does not use hazardous xylene, providing a much safer method than other FFPE purification products. Quality testing demonstrates virtually no PCR inhibitors in purified samples. Features: • Purifies DNA from 1–48 (5µm) FFPE samples • Faster digestion option without organic solvents • Sufficient yield for downstream amplification Storage Conditions: Store at 15–30°C. Casework Consumables Product Size Cat.# CW Spin Baskets 50/pack AS8101 CW Microfuge Tubes, 1.5ml 50/pack AS8201 Not For Medical Diagnostic Use. Description: The CW Spin Baskets and CW Microfuge Tubes, 1.5ml, are ethylene-oxide-treated and enable preprocessing of solid samples without the need to transfer swabs, simplifying the process and reducing the chance of cross-contamination. Use with both Maxwell® FSC DNA IQ™ Casework Kit and DNA IQ™ Casework Pro Kit for Maxwell® 16. Storage Conditions: Store all consumables at 15–30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 136 For complete and up-to-date product information visit: www.promega.com ReliaPrep™ Large Volume HT gDNA Isolation System Product Size Cat.# ReliaPrep™ Large Volume HT gDNA Isolation System 1 each A2751 HSM 2.0 Instrument 1 each A2715 Alkaline Protease (APA) 130 ml A1721 Cell Lysis Buffer (CLD) 1,400 ml A1731 160 ml A1732 Binding Buffer (BBA) 1,600 ml A1741 200 ml A1742 ReliaPrep™ Resin 115 ml A1752 5.5 ml A1753 Prepared Wash Buffer (WBC) 3,500 ml A2681 Proteinase K (PK) Solution 23 ml A5051 Nuclease-Free Water 500 ml P1197 Available Separately Size Conc. Cat.# RNase A Solution 5 ml 4 mg/ml A7974 20X TE Buffer (pH 7.5) 25 ml A2651 Tissue Lysis Buffer (TLA) 500 ml A5091 Nuclease-Free Water 1,000 ml P1199 Integrated Reagent Caps 4 /pk A2701 HSM 2.0 Instrument Cover 1 each A2712 HSM 2.0 Tube Rack 1 each A2713 HSM 2.0 Tube Rack Stand 1 each A2714 HSM 2.0 Instrument 1-Year Service Agreement 1 each SA1330 ReliaPrep™ LV 32 HSM Standard Service Agreement 1 each SA3070 Bottle for 50% Ethanol 1 each A2691 A2751, A7974, A2651, A2715, A1721, A5091, A1731, A1732, P1199, A1741, A1742, A2701, A1752, A1753, A2712, A2681, A2713, A2714, A5051, P1197, SA3070, A2691 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ Large Volume HT gDNA Isolation System isolates genomic DNA (gDNA) from 1–10ml of blood in a scalable format. The chemistry eliminates tedious centrifugation steps as well as the use of hazardous chemicals, which are inherent in precipitation-based chemistries. Each reagent kit provides enough reagents to process up to 96 × 10ml whole blood samples. The system has been automated on robotic liquid-handling workstations, allowing walkaway purification of genomic DNA from 1–10ml of whole blood, regardless of sample storage or shipping conditions. For low-throughput isolation of gDNA from up to 32 samples at one time, the HSM 2.0 can be used in a manual mode, where the user performs the pipetting functions. The HSM has software that controls the instrument and directs the user through the purification protocol. Features: • Decrease Hands-On Time: Automation reduces operator time spent on instrument setup and takedown by allowing walkaway operation for large numbers of samples at one time. • Remove Protocol Bottlenecks: Heater Shaker Magnet eliminates the need to move samples on the robot deck, reducing instrument failures; precipitation-free chemistry dramatically reduces purification failures. • Achieve Peace of Mind: Automated liquid level sensing with operator notification allows recovery of samples in case of error. • Isolate Pure DNA from All Samples: Purification chemistry is equally effective at recovering DNA from pristine as well as challenged (hemolysed or frozen) samples. • Save a Day or Two of Processing: Samples are eluted in buffer, ready for use in downstream assays or archiving, eliminating resuspension of pelleted DNA, which can take 24–48 hours. • Reduce Waste: Chemistry is automatically scaled for each sample and plastic use is conserved, reducing liquid and solid waste during sample runs. Storage Conditions: Store at 15–30°C. ReliaPrep™ Blood gDNA Miniprep System Product Size Cat.# ReliaPrep™ Blood gDNA Miniprep System 100 preps A5081 250 preps A5082 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ Blood gDNA Miniprep System provides a complete, ready-to-use method for purification of gDNA from up to 200μl of blood or body fluid, consistently isolating pure, intact gDNA without the use of alcohol washes or precipitations. Genomic DNA can be prepared from fresh or frozen blood in less than 40 minutes with expected DNA yields of 4–10μg, depending on the white blood cell count of the blood sample. Features: • Easy to Use: Reagents are supplied “ready to go”; no additions required. • Save Time: Eluted DNA obtained in 30 minutes or less. • No Ethanol: Eliminates alcohol inhibition and carryover. • Pure gDNA: Improved A260/A230 ratios vs. the leading competitor. • Peace of Mind: Consistent results from run to run and between users even with hemolyzed samples. • Concentrated DNA: Good recovery and purity in as little as 50μl elution. Storage Conditions: Store at 15–30°C. ReliaPrep™ gDNA Tissue Miniprep System Product Size Cat.# ReliaPrep™ gDNA Tissue Miniprep System 100 preps A2051 250 preps A2052 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ gDNA Tissue Miniprep System provides a complete, ready-to-use method for purification of gDNA from up to 25mg of tissue, a buccal (cheek) swab, or a 1cm mouse tail snip, obtaining intact gDNA without the use of ethanol washes or precipitations. Features: • Easy to Use: Reagents are supplied “ready-to-use”—no additions required. • Save Time: Eluted DNA obtained in 30 minutes or less (hands-on time). • No Ethanol: Eliminates alcohol inhibition and carryover. • Pure gDNA: Improved A260/A230 ratios vs. the leading competitor. • Peace of Mind: Consistent results from run to run and between users. • Concentrated DNA: Good recovery and purity in as little as 50μl elution. Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 137 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com Maxwell® HT 96 gDNA Blood Isolation System Product Size Cat.# Maxwell® HT 96 gDNA Blood Isolation System 1 × 96 preps A2670 4 × 96 preps A2671 Available Separately Size Conc. Cat.# Heat Block Adapter 1 each A2661 RNase A Solution 5 ml 4 mg/ml A7974 25mM Tris-HCl (pH 8.0) 60 ml A2641 10mM EDTA (pH 8.0) 10 ml A2631 20X TE Buffer (pH 7.5) 25 ml A2651 Wash Buffer (WBA) 500 ml A1761 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® HT 96 gDNA Blood Isolation provides a simple and reliable method for the rapid isolation of gDNA in a multiwell format. gDNA may be purified from blood and Oragene®•Discover sample collection devices. The purified gDNA can be used directly in PCR assays, microarrays and nextgeneration sequencing applications. The use of paramagnetic particles for DNA capture eliminates the need for centrifugation or vacuum manifolds, making the system suitable for full automation. In addition, the system does not require an organic solvent, making it safe and convenient. DNA yields of up to 12µg are expected from input blood volumes of 350µl, depending on the WBC count of the sample. Saliva samples can have variable amounts of gDNA, and up to 18µg or more of DNA may be recovered from a 700µl Oragene® collection device sample. Features: • Improve Productivity: Walkaway automation of genomic DNA extraction. • Eliminate Sample Rework: Robust, precipitation-free protocol, no chance of “lost pellets”. • Simplify Workflow: High yields of pure DNA from pristine and challenged or hemolysed samples. • Reduce Time to Results: Pure gDNA ready for demanding applications; samples in solution; no resuspension required. Storage Conditions: Store all components at 15–30°C. ReliaPrep™ FFPE gDNA Miniprep System Product Size Cat.# ReliaPrep™ FFPE gDNA Miniprep System 10 reactions A2351 100 reactions A2352 Available Separately Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ FFPE gDNA Miniprep System provides a complete, all-inclusive method for purifying quality genomic DNA from formalinfixed paraffin-embedded tissue without using hazardous solvents or overnight digestion. Genomic DNA can be isolated from FFPE tissue in approximately two and one-half hours with minimal hands-on time. Features: • Isolate Quality, Intact gDNA: Optimized lysis and binding conditions reverse modifications introduced by the fixation process, resulting in intact, amplifiable gDNA. • Safely Deparaffinize Your Sample: Deparaffinization step occurs without harsh organic solvents. • Save Time: Purify gDNA from FFPE tissue in less than two and one-half hours with minimal hands-on time. No overnight digestion required. • Easy to Use: Minimal preparation time; simply add ethanol and go! Storage Conditions: Store at room temperature. Wizard® Genomic DNA Purification Kit Product Size Cat.# Wizard® Genomic DNA Purification Kit 100 isolations × 300 μl A1120 500 isolations × 300 μl A1125 100 isolations × 10 ml A1620 Available Separately Size Conc. Cat.# Cell Lysis Solution (Genomic Purification) 1 liter A7933 Nuclei Lysis Solution 50 ml A7941 1 liter A7943 Protein Precipitation Solution 25 ml A7951 350 ml A7953 DNA Rehydration Solution 50 ml A7963 RNase A Solution 1 ml 4 mg/ml A7973 Proteinase K 100 mg V3021 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® Genomic DNA Purification Kit provides a simple, solution-based method for isolation of DNA from white blood cells, tissue culture cells, animal tissue, plant tissue, yeast and Gram-positive and Gram-negative bacteria. DNA purified with this system is suitable for a variety of applications, including amplification, digestion with restriction endonucleases and membrane hybridizations (e.g., Southern and dot/slot blots). Features: • Improved Productivity: Rapidly isolate genomic DNA from blood, tissue culture, animal and plant cells, bacteria and yeast in approximately 60 minutes. • Scalability: Reagent volumes can be adjusted to correspond to the amount of material to be processed. • Flexibility: Genomic DNA purified from a variety of sample types is suitable for a variety of applications. • Your Choice of Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 138 For complete and up-to-date product information visit: www.promega.com Wizard® SV Genomic DNA Purification System Product Size Cat.# Wizard® SV Genomic DNA Purification System 50 preps A2360 250 preps A2361 Available Separately Size Conc. Cat.# Wizard® SV Lysis Buffer 50 ml Z3052 Column Wash Solution (CWA) 185 ml A1311 Nuclei Lysis Solution 50 ml A7941 EDTA, 0.5M (pH 8.0), Molecular Biology Grade 100 ml V4231 RNase A Solution 1 ml 4 mg/ml A7973 Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 A2360, Z3052, A2361, A7941, V4231, A7973, V1231, V4741 For Research Use Only. Not for Use in Diagnostic Procedures. A1311 For Laboratory Use. Description: The Wizard® SV Genomic DNA Purification System provides a fast, simple, membrane-based technique for preparing genomic DNA from cultured cells and tissue, including mouse tails. Genomic DNA can be purified from cultured cells in about 20 minutes. Isolation from tissue or mouse tails requires an overnight digestion with Proteinase K (Cat.# V3021). Amplifiable genomic DNA can be isolated from up to 5 × 106 cells, 20mg of tissue or up to 1.2cm of a mouse tail tip without a centrifugation clearing step. The Wizard® SV Genomic DNA Purification System can be used in either a microcentrifuge (spin) or vacuum protocol. Up to 20 samples can be processed at once in the vacuum format with the Vac-Man® Laboratory Vacuum Manifold (Cat.# A7231) and the Vacuum Adapters (Cat.# A1331). Features: • Improved Productivity: Obtain genomic DNA approximately 20 minutes after lysis. • High Yield: Purify 20–30μg of DNA per prep from 1.2cm mouse tail. • Format Choice: Perform purification by either spin or vacuum formats. Storage Conditions: Store at 22–25°C. Wizard® SV 96 Genomic DNA Purification System Product Size Cat.# Wizard® SV 96 Genomic DNA Purification System 1 × 96 preps A2370 4 × 96 preps A2371 Available Separately Size Conc. Cat.# Wizard® SV Lysis Buffer 50 ml Z3052 Column Wash Solution (CWA) 185 ml A1311 Nuclei Lysis Solution 50 ml A7941 EDTA, 0.5M (pH 8.0), Molecular Biology Grade 100 ml V4231 RNase A Solution 1 ml 4 mg/ml A7973 Wizard® SV 96 Binding Plates 10 pack A2271 A2370, Z3052, A2371, A7941, V4231, A7973, A2271 For Research Use Only. Not for Use in Diagnostic Procedures. A1311 For Laboratory Use. Description: The Wizard® SV 96 Genomic DNA Purification System provides a high-throughput, membrane-based technique for consistent preparation of genomic DNA from cultured cells and tissue, including mouse tails. Amplifiable genomic DNA can be isolated from up to 5 × 106 cells, 20mg of tissue or up to 1.2cm of a mouse tail tip without a centrifugation clearing step. With the Wizard® SV Genomic DNA purification system, genomic DNA is purified from cell lysates using 96-well vacuum filtration. Washing the bound DNA requires no disassembly of the manifold, and filtrate waste products are delivered directly to a vacuum trap, eliminating the need to empty waste collection trays. The Wizard® SV Genomic DNA Purification System is designed for use either in a manual format or with Beckman Coulter or PerkinElmer automated instruments. Features: • Improve Productivity: Obtain genomic DNA from mouse tails in 45–60 minutes, genomic DNA from cultured cells in 30 minutes. No spins required. • Achieve High Yield: Purify 20–30μg of DNA per prep from 1.2cm of mouse tail. • Gain Confidence in Applications: Purified DNA ready for amplification. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 139 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com MagneSil® ONE, Fixed Yield Blood Genomic System Product Size Cat.# MagneSil® ONE, Fixed Yield Blood Genomic System 1 × 96 preps MD1370 Collection Plates (4-pack) 1 each A9161 Available Separately Lysis Buffer, Blood 160 ml MD1392 Alcohol Wash, Blood 120 ml MD1412 Anti-Foam Reagent 300 μl MD1431 MagneSil® PMPs-Fixed Yield 25 ml MD1451 Elution Buffer, Blood 45 ml MD1421 MD1370, MD1392, A9161, MD1451, MD1421 For Research Use Only. Not for Use in Diagnostic Procedures. MD1412, MD1431 For Laboratory Use. Description: The MagneSil® ONE, Fixed Yield Blood Genomic System purifies 1μg of DNA (+/– 50%) from 60μl of anti-coagulated whole blood. Purification of a “fixed yield” of DNA eliminates the need to quantitate and normalize concentrations postpurification. The highly pure DNA isolated is suitable for use in PCR, multiplex PCR and SNP genotyping applications. Walkaway automation is available on the Beckman Coulter Biomek® FX in a 96-well format. Process 96 samples in about 1 hour with no hands-on time following robot setup. Features: • Improve Productivity: Use walkaway automation to extract genomic DNA and eliminate DNA quantitation prior to PCR. • Achieve Consistent Results: Obtain 1μg (fixed yield) of highly pure DNA from 60μl of blood. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 20–25°C. MagneSil® Blood Genomic, Max Yield System Product Size Cat.# MagneSil® Blood Genomic, Max Yield System 1 × 96 preps MD1360 Available Separately Anti-Foam Reagent 300 μl MD1431 MagneSil® Paramagnetic Particles 25 ml MD1441 Salt Wash, Blood 90 ml MD1401 Alcohol Wash, Blood 70 ml MD1411 Elution Buffer, Blood 45 ml MD1421 MD1360, MD1401, MD1411, MD1421 For Research Use Only. Not for Use in Diagnostic Procedures. MD1431, MD1441 For Laboratory Use. Description: The MagneSil® Blood Genomic, Max Yield System provides automated high-throughput DNA purification on the Beckman Coulter Biomek® FX using MagneSil® Paramagnetic Particle technology. DNA from 96 samples of anti-coagulated human whole blood is purified in about 1 1/2 hours with no hands-on time once the robot protocol is initiated. Studies on DNA recovery and purity and PCR results show no cross-contamination between samples in adjacent wells. Purified DNA is qualified for single-locus “simple PCR” as well as more demanding applications such as multiplex PCR (e.g., PowerPlex® 16 System [Cat.# DC6531], Y Chromosome Deletion Detection System [Cat.# MD1531]) and SNP genotyping. Features: • Improve Productivity: Walkaway automation of genomic DNA extraction. • Achieve Maximum Yield: The average yield of 96 purified samples from normal healthy adults is ≥4μg. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 140 For complete and up-to-date product information visit: www.promega.com MagneSil® Genomic, Large Volume System Product Size Cat.# MagneSil® Genomic, Large Volume System 48 preps A4082 Available Separately eLysis Buffer, Large Volume System 1 L A4091 A4082 For Research Use Only. Not for Use in Diagnostic Procedures. A4091 For Laboratory Use. Description: The MagneSil® Genomic, Large Volume System, is designed for scalable, automated genomic DNA isolation from large-volume samples, eliminating laborious centrifugation steps and the use of hazardous organic solvents. The system has been automated on the Tecan Freedom EVO® liquid handler, providing walkaway purification of genomic DNA from a variety of starting materials, including 1–10ml whole blood samples, regardless of sample storage or shipping conditions. The instrument uses only the amount of reagents required to process each sample, maximizing efficiency and value per prep. The MagneSil® Genomic, Large Volume System, uses a robust noncentrifugation-based automated method to purify genomic DNA from fresh, frozen or mishandled blood and other samples with similar yields and quality. The system bypasses many of the challenges of traditional centrifugation-based methods by lysing the entire whole blood sample and then directly capturing total genomic DNA from the lysed sample using MagneSil® Paramagnetic Particles (PMPs). The genomic DNA bound to the MagneSil® PMPs is washed to remove contaminants such as heme and cellular proteins, then eluted into an aqueous solution ready for use in downstream applications. There is no need for tedious and lengthy DNA rehydration. The purified genomic DNA is suitable for a variety of downstream applications such as single and multiplex PCR, restriction digestion and real-time PCR. Features: • Improve Productivity: Walkaway automation from blood-collection tube to application-ready DNA. • Rely on an Integrated Solution: One reagent system and automated method provide yield and purity from any sample type (fresh or frozen blood, samples of unknown quality and mixed sample populations). • Enjoy Smart Scalability: Scale sample size from 1–10ml of blood, batch size from 1–96 samples and reagent usage from input sample volume. • Achieve Turnkey Automation: Optimized protocol available for the Tecan Freedom EVO® instrument. This and other validated automated methods are available at: www.promega.com/automethods/ Storage Conditions: Store at 22–25°C. Fixed-Tissue Genomic DNA Purification Product Size Cat.# MagneSil® Genomic, Fixed Tissue System 100 samples MD1490 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagneSil® Genomic, Fixed Tissue System provides a fast, simple technique to prepare genomic DNA from formalin-fixed, paraffinembedded tissue. After an overnight Proteinase K digestion, genomic DNA can be manually purified from formalin-fixed, paraffin-embedded thin tissue sections in less than an hour. Amplifiable genomic DNA can be isolated from 10μm thin sections without centrifugation of the lysate prior to purification. Up to 12 samples can be processed in the manual format using the MagneSphere® Technology Magnetic Separation Stand (twelve-position) (Cat.# Z5342). Features: • Purify High-Quality DNA: The composition of the wash buffers and protocol have been optimized to yield genomic DNA that is largely free of small DNAs, a potent inhibitor of PCR amplification. • Rely on Performance-Tested Amplification Results: Amplify targets in multiplex PCR and targets as large as 450–1,800bp. Storage Conditions: MD1490 consists of two separate items shipped at different temperatures. MD1170 (part 1 of 2 for MD1490—Processing Module) contains Proteinase K, DTT and Incubation Buffer, which are shipped on dry ice. Store MD1170 at –20°C. MD1180 (part 2 of 2 for MD1490—Purification Module) contains Lysis Buffer, 2X Wash Buffer, Resin and Elution Buffer, which are shipped at room temperature, 22–25°C. Store MD1180 at room temperature, 22–25°C. ReadyAmp™ Genomic DNA Purification System Product Size Cat.# ReadyAmp™ Genomic DNA Purification System 100 reactions A7710 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReadyAmp™ Genomic DNA Purification System yields single-stranded DNA (ssDNA) from whole blood or blood stains that may be used directly in amplification reactions without further manipulation. The process takes less than one hour and requires no organic extractions or ethanol precipitations. Features: • Simple and Effective: ReadyAmp™ resin removes PCR inhibitors. • Convenient: Isolated DNA can be used directly in PCR amplifications. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 141 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com MagneSil® KF, Genomic System Product Size Cat.# MagneSil® KF, Genomic System 200 preps MD1460 Available Separately MagneSil® KF, Paramagnetic Particles 40 ml MD1471 Lysis Buffer, KF 160 ml MD1521 MD1460 For Research Use Only. Not for Use in Diagnostic Procedures. MD1471, MD1521 For Laboratory Use. Description: The MagneSil® KF, Genomic System is designed for easy, walkaway, low- to moderate-throughput automated genomic DNA purification from blood and other samples. For blood samples, lysis occurs concurrently with DNA binding to MagneSil® Paramagnetic Particles. After washes to remove heme and proteins, purified genomic DNA is ready for PCR and other downstream applications. The system is designed to purify 2–6μg of genomic DNA from 200μl of anti-coagulated liquid blood. The MagneSil® KF, Genomic System is designed to run on the Thermo Electron KingFisher® mL instrument, which automates DNA purification in a flexible 1- to 15-sample batch, 25-minute walkaway format. The compact size of the KingFisher® mL allows it to be used on the benchtop or in a laminar flow hood. Please contact Thermo Electron for more information on the KingFisher® mL instrument. Features: • Improve Productivity: Use automated 25-minute optimized, walkaway protocol with no training. Eliminate laborious manual methods. • Rely On a Performance-Tested System: Purified DNA is tested in PCR, multiplex PCR, fluorescent STR analysis and SNP genotyping applications. • Conserve Valuable Lab Space: The small footprint (30 × 30 × 30cm) of the Thermo Electron KingFisher® mL instrument delivers automated throughput that makes sense for smaller labs. No external PC required. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ Storage Conditions: Store at 22–25°C. Do not freeze the MagneSil® KF Paramagnetic Particles. MagaZorb® DNA Mini-Prep Kit Product Size Cat.# MagaZorb® DNA Mini-Prep Kit 200 preps MB1004 800 preps MB1008 Available Separately Size Conc. Cat.# Proteinase K (PK) Solution 16 ml 20 mg/ml MC5008 20-Position Microcentrifuge Tube Magnetic Separator 1.5 ml CD4002 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagaZorb® DNA Kit provides an easy, fast and cost-effective technique for isolating PCR-quality DNA. Using one simple protocol, a high yield of purified DNA can be isolated from a wide variety of sources including whole blood (fresh or frozen, citrate-, heparin- or EDTA-treated), buffy coat, leukocytes, milk, seminal fluid, dried blood spots, cultured cells, tissue (fresh, frozen or formalin-fixed paraffin-embedded), saliva, urine, stool, hair, buccal swabs and vaginal swabs. The 20-Position Microcentrifuge Tube Magnetic Separator (Cat.# CD4002) utilizes a microcentrifuge tube rack that can be removed from the high-strength magnets for wash steps or incubation in a water bath. The rack is designed to hold the microcentrifuge tubes so that they will not fall out even when turned upside down, and it can withstand temperatures of up to 80°C for convenient manipulation of sample tubes. Please note that the magnets in the 20-Position Microcentrifuge Tube Magnetic Separator are designed specifically for use with the MagaZorb® DNA Kit; separation may not work with other particles. Features: • Convenient: Contains all needed reagents so that no reagent preparation is required. • Efficient: Eliminates centrifugation, vacuum filtration or column separation, increasing sample throughput and improving reproducibility. • Safe: Does not require organic solvents, eliminating the need for special storage or waste disposal. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 142 For complete and up-to-date product information visit: www.promega.com Wizard® Magnetic 96 DNA Plant System Product Size Cat.# Wizard® Magnetic 96 DNA Plant System 2 × 96 preps FF3760 4 × 96 preps FF3761 Available Separately Wash Buffer, Plant 40 ml A3811 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® Magnetic 96 DNA Plant System is designed for manual or automated 96-well, high-throughput purification of DNA from plant leaf and seed tissue. The system has been validated with corn and tomato leaf, as well as with canola and sunflower seeds. The DNA purified from these samples can be used in PCR as well as more demanding applications such as RAPD analysis. Unlike column-based systems, the binding of nucleic acids to magnetic particles can occur in solution, enhancing contact with the wash buffer and increasing nucleic acid purity. Protocols are available for Beckman Coulter instruments. Features: • Improved Productivity: Manual and automated 96-well protocols cut purification time compared to CTAB extraction. • Ease of Handling: Eliminates organic extractions, multiple centrifugations and cumbersome filter plates. • Confidence in Applications Performance: Validated for both leaf and seed tissue by PCR and RAPD analysis. • Automation: Validated automated methods available at: www.promega.com/automethods/ • Your Choice of Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. Wizard® Magnetic DNA Purification System for Food Product Size Cat.# Wizard® Magnetic DNA Purification System for Food 200 preps FF3750 400 preps FF3751 Available Separately Lysis Buffer A, Food 100 ml A8191 Lysis Buffer B, Food 100 ml Z3191 Precipitation Solution, Food 150 ml Z3201 A8191, Z3191, Z3201 For Research Use Only. Not for Use in Diagnostic Procedures. FF3750, FF3751 For in vitro use only. Description: The Wizard® Magnetic DNA Purification System for Food is designed for purification of DNA from a variety of food samples including corn seeds, cornmeal, soybeans, soy flour and soy milk. Processed food, such as corn chips, chocolate and chocolate-containing foods, lecithin and vegetable oils may also be used with the suggested protocol variations. The DNA purified from these samples can be used in PCR-based testing for genetically modified organism (GMO) DNA sequences. Features: • Improved Productivity: Obtain results in one-third the time of current methods. • Ease of Handling: Requires minimal centrifugation and eliminates organic extractions. • Versatility and Robustness: Validated with a broad variety of foodstuffs, including difficult samples such as lecithin and vegetable oils. Storage Conditions: Store at 22–25°C. Maxwell® 16 System DNA Purification Kits Product Size Cat.# Low Elution Volume (LEV) Maxwell® 16 LEV Blood DNA Kit 48 preps AS1290 Maxwell® 16 FFPE Plus LEV DNA Purification Kit 48 preps AS1135 Maxwell® 16 Cell LEV DNA Purification Kit 48 preps AS1140 Maxwell® 16 Buccal Swab LEV DNA Purification Kit 48 preps AS1295 Maxwell® 16 FFPE Tissue LEV DNA Purification Kit 48 preps AS1130 Maxwell® 16 LEV Plant DNA Kit 48 preps AS1420 Standard Elution Volume (SEV) Maxwell® 16 Blood DNA Purification Kit 48 preps AS1010 Maxwell® 16 Blood DNA Purification System (IVD) 48 preps AS1015 Maxwell® 16 Cell DNA Purification Kit 48 preps AS1020 Maxwell® 16 Tissue DNA Purification Kit 48 preps AS1030 Maxwell® 16 Mouse Tail DNA Purification Kit 48 preps AS1120 Available Separately Maxwell® 16 Flexi Method Firmware 1 each AS6411 LEV Plungers 50 /pk AS6101 LEV Elution Tubes 50 /pk AS6201 Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 Elution Buffer, Blood 45 ml MD1421 SEV Plungers 50 /pk AS5201 SEV Elution Tubes 50 /pk AS5101 AS1290, AS1135, AS1140, AS1295, AS1130, AS1010, AS1020, AS1030 For Laboratory Use. AS1420, AS1120, AS6101, AS6201, V1231, V4741, MD1421, AS5201, AS5101, AS6411 For Research Use Only. Not for Use in Diagnostic Procedures. AS1015 For In Vitro Diagnostic Use. This product is only available in certain countries. Description: The Maxwell® 16 Genomic DNA Purification Kits are designed for use with the Maxwell® 16 Instrument. DNA purification kits are provided with corresponding optimized automated methods. You get consistent yield and purity from easy-to-use automation. For genomic DNA purification, the Maxwell® 16 System is the only system that makes purification from tissue as easy as purification from blood or cells. The action of the plunger grinds solid tissue samples directly in the lysis buffer in the prefilled reagent cartridges. Integrated grinding replaces time- and laborintensive use of lytic enzymes such as proteinase K or manual tissue grinding prior to purification. Kits for optimized DNA purification from eukaryotic tissue, blood, cells, mouse tail and FFPE tissue sections are available. Protocols for a variety of new samples are being developed. The Maxwell® 16 DNA Purification Kits are General Purpose Medical Devices (GPR) in the USA. For up-to-date information visit: www.promega.com/maxwell16/ Features: • Achieve High Yield: Efficient processing and higher sample capacity than comparable systems. • Enjoy Amazing Speed: Hands-free purification of genomic DNA in 18–30 minutes. • Get More Time: Easily process tissues and cells. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 143 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com Maxwell® RSC System DNA Purification Kits Product Size Cat.# Maxwell® RSC Blood DNA Kit 48 preps AS1400 Maxwell® RSC Whole Blood DNA Kit 48 preps AS1520 Maxwell® RSC DNA FFPE Kit 48 preps AS1450 Maxwell® RSC Cell DNA Purification Kit 48 preps AS1370 Maxwell® RSC ccfDNA Plasma Kit 48 preps AS1480 Maxwell® RSC Buccal Swab DNA Kit 48 preps AS1640 Maxwell® RSC Stabilized Saliva DNA Kit 48 preps AS1630 Maxwell® RSC Tissue DNA Kit 48 preps AS1610 Maxwell® RSC Cultured Cells DNA Kit 48 preps AS1620 Maxwell® RSC Buffy Coat DNA Kit 48 preps AS1540 Maxwell® RSC Plant DNA Kit 48 preps AS1490 Maxwell® RSC PureFood GMO and Authentication Kit 48 preps AS1600 Available Separately Maxwell® RSC Instrument 1 each AS4500 RSC/CSC Deck Tray 1 each SP6019 Maxwell® Instrument Bar Code Reader 1 each AS3200 Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 CTAB Buffer 100 ml MC1411 AS1600, MC1411 Not For Medical Diagnostic Use. All others For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® Rapid Sample Concentrator (RSC) Instrument is an automated nucleic acid purification system that processes up to 16 samples in a single run. The instrument is used with the prefilled reagent cartridges provided in the Maxwell® RSC Purification Kits to purify DNA or RNA from a wide range of sample types. The intuitive graphical user interface makes the instrument easy to use, and the integrated Quantus™ Fluorometer lets you collect purification and quantification data in one report. These kits can be used for automated DNA purification with the Maxwell® RSC Instrument: Maxwell® RSC Blood DNA Kit • Extracts DNA from whole blood or buffy coat samples in 30–40 minutes. • Processes up to 400µl of whole blood. • Yields up to 15µg of gDNA, depending on white blood cell count. Maxwell® RSC Whole Blood DNA Kit • Extracts DNA from 50–500µl of whole blood in less than 40 minutes. • Simple, walkaway protocol with no preprocessing. • Compatible with blood stored in EDTA, heparin and citrate anticoagulants. Maxwell® RSC DNA FFPE Kit • Extracts amplifiable DNA from FFPE tissue sections. • Eliminates the use of hazardous organic solvents. • Purified DNA performs better in downstream applications. Maxwell® RSC Cell DNA Purification Kit • Extracts DNA from samples containing less than 10,000 cells. • Compatible with low-cell-number samples such as amniotic fluid, cerebral spinal fluid and cell supernatants. • Cells are collected and processed in up to 400μl volumes, and extraction is complete in about 30 minutes. Maxwell® RSC ccfDNA Plasma Kit • Simple, walkaway protocol with no preprocessing. • Provides high yields of pure and amplifiable ccfDNA. • Scalable protocol, process ccfDNA from 0.2–1ml of plasma. Maxwell® RSC Buccal Swab DNA Kit • Optimized reagents for buccal swab extraction. • Decreased hands-on time with simple protocol. • Consistent results with sufficient DNA for HLA assays. Maxwell® RSC Stabilized Saliva DNA Kit • Simple protocol with optimized reagents. • Consistent DNA yields. • DNA ready to use in downstream assays such as HLA typing. Maxwell® RSC Tissue DNA Kit • Extracts DNA from up to 50mg of mammalian tissue. • Purifies high yields of amplifiable DNA. • Automated protocol improves efficiency. Maxwell® RSC Cultured Cells DNA Kit • Extracts DNA from up to 5 × 106 mammalian tissue culture cells and 2 × 109 bacterial cells. • Simple, walkaway protocol requires no sample preprocessing. • Purified DNA is ready for analysis in about 45 minutes. Maxwell® RSC Buffy Coat DNA Kit • Purifies high yields of DNA from 50–250µl of buffy coat samples in about 50 minutes. • Simple walkaway protocol with no preprocessing. • Compatible with blood stored in EDTA, heparin and citrate anticoagulants. Maxwell® RSC Plant DNA Kit • Extracts DNA from a range of plant tissues, including soybean, corn and Arabidopsis. • Consistent purification, no organic extractions and minimal preprocessing. • Purified DNA is ready to use in downstream applications including amplification assays. Maxwell® RSC PureFood GMO and Authentication Kit • Purifies high-quality DNA from a range of food and feed samples. • Results in highly concentrated DNA that is ready to use in downstream assays. • Simple, five-step protocol saves time and eliminates organic extraction steps. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 144 For complete and up-to-date product information visit: www.promega.com Plasmid Purification PureYield™ Plasmid Miniprep System Product Size Cat.# PureYield™ Plasmid Miniprep System 100 preps A1223 250 preps A1222 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PureYield™ Plasmid Miniprep System is designed to rapidly isolate highly pure plasmid DNA. The system provides a rapid method for purification of up to 15μg of plasmid DNA from 600μl to 3ml of bacteria culture. Plasmid DNA can be purified in as little as 10 minutes. The PureYield™ Plasmid Miniprep System incorporates a unique Endotoxin Removal Wash designed to remove substantial amounts of protein, RNA and endotoxin contaminants from purified plasmid DNA. Removal of contaminants improves the robustness of sensitive applications such as eukaryotic transfection, in vitro transcription and coupled in vitro transcription/translation (e.g., TnT® Quick Coupled Transcription/ Translation System). Purification is achieved without isopropanol precipitation of purified plasmid DNA or extensive centrifugation, providing rapid purification from a single method. The system has been designed for use with centrifugation or vacuum (e.g., the Vac-Man® Laboratory Vacuum Manifold). Features: • Improved Productivity: Rapid protocol purifies plasmid DNA in 10 minutes. • Robust Performance: High purity and concentration of plasmid DNA gives proven performance in transfection, cell-free expression and other molecular biology applications. • Confidence in Results: Lysis/neutralization indicator dye ensures success every time. • Flexible: Centrifugation and vacuum protocols are available. Storage Conditions: Store all system components at 22–25°C. Wizard® Plus SV Minipreps DNA Purification Systems Product Size Cat.# Wizard® Plus SV Minipreps DNA Purification System 50 preps A1330 250 preps A1460 1,000 preps A1465 Wizard® Plus SV Minipreps DNA Purification System + Vacuum Adapters 50 preps A1340 250 preps A1470 Available Separately Column Wash Solution (CWA) 185 ml A1311 Alkaline Protease Solution 3 ml A1441 Vacuum Adapters 20 each A1331 A1311 For Laboratory Use. A1330, A1441, A1460, A1331, A1465, A1340, A1470 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® Plus SV Minipreps DNA Purification System, a silica membrane-based system, provides a simple and reliable method for rapid isolation of plasmid DNA. The entire miniprep procedure can be completed in 45 minutes or less, depending on the number of samples processed. Using the system, plasmid DNA can be purified from 1–10ml of overnight E. coli culture. The purified plasmid DNA can be used directly for automated fluorescent BigDye® terminator DNA sequencing as well as for other standard molecular biology techniques without further manipulation. It also can be used for in vitro transcription reactions when supplemented with a ribonuclease inhibitor such as Recombinant RNasin® Ribonuclease Inhibitor (Cat.# N2511). Features: • Improved Productivity: 20 minipreps processed in less than 45 minutes. • High Performance: 1–20μg of high-quality plasmid DNA, enough for multiple applications. • Safety and Convenience: No phenol extractions or precipitations required. • Flexibility: Choice of spin (microcentrifuge) or vacuum purification formats. • Consistent Quality: Alkaline protease step improves plasmid quality. • Confidence in Results: Purified DNA meets a target of >98% accuracy over 500 bases using pGEM®-3Zf(+) Vector in BigDye® terminator sequencing. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 145 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com PureYield™ Plasmid Midiprep System Product Size Cat.# PureYield™ Plasmid Midiprep System 25 preps A2492 100 preps A2495 300 preps A2496 Available Separately Cell Resuspension Solution (CRA) 315 ml A7115 Cell Lysis Solution (CLA) 315 ml A7125 Neutralization Solution (NSB) 500 ml A1485 Eluator™ Vacuum Elution Device 4 each A1071 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PureYield™ Plasmid Midiprep System is designed to isolate transfection-quality plasmid DNA. The system provides a rapid method for purification of 100–200μg of plasmid DNA from 50ml bacteria culture. Plasmid DNA can be purified in as little as 30 minutes with the vacuum protocol, greatly reducing the time spent on purification compared to silica resin or other membrane-column methods. An alternative protocol allows purification of over 400μg of high-copy-number plasmid from 250ml of E. coli culture. The PureYield™ Plasmid Midiprep System incorporates a unique Endotoxin Removal Wash designed to remove substantial amounts of protein, RNA and endotoxin contaminants from purified plasmid DNA. Removal of contaminants improves the robustness of sensitive applications such as eukaryotic transfection, in vitro transcription and coupled in vitro transcription/translation (e.g., TnT® Quick Coupled Transcription/Translation System). Purification is achieved without isopropanol precipitation of purified plasmid DNA or extensive centrifugation, providing rapid purification from a single method. The system has been designed for use with centrifugation or vacuum (e.g., the Vac-Man® Laboratory Vacuum Manifold). The Eluator™ Vacuum Elution Device is used to elute nucleic acids from PureYield™ Midiprep or Maxiprep columns. It consists of two pieces, a blue base and a clear column assembly. The base interfaces with a Vacuum Manifold that contains Luer-Lok® fittings, such as the Vac-Man® Laboratory Vacuum Manifold (Cat.# A7231), and holds a 1.5ml tube to capture the eluted nucleic acids. The column assembly accepts PureYield™ Midiprep or Maxiprep columns. The Eluator™ Device eliminates the requirement for a centrifuge with a swinging bucket rotor for nucleic acid purification, simplifying and speeding purification protocols. Features: • Improved Productivity: Vacuum protocol allows plasmid DNA purification in as little as 30 minutes. • Confidence in Results: High purity and concentration of plasmid DNA gives proven performance in transfection, in vitro expression and other molecular biology applications. • Ease of Use: Simple protocol eliminates tedious high-speed centrifugation, gravity-drip columns, and post-elution alcohol precipitation. • Flexibility: PureYield™ membrane column allows purification of large amounts of plasmid DNA, exceeding the capabilities of other midiprep systems. Storage Conditions: Store all system components at 22–25°C. PureYield™ Plasmid Maxiprep System Product Size Cat.# PureYield™ Plasmid Maxiprep System 10 preps A2392 25 preps A2393 Available Separately Eluator™ Vacuum Elution Device 4 each A1071 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PureYield™ Plasmid Maxiprep System isolates transfectionquality plasmid DNA. The system provides a rapid method for purification of up to 1mg of plasmid DNA from a 250ml bacterial culture. Plasmid DNA can be purified rapidly with the vacuum protocol, greatly reducing the time spent on purification compared to silica resin or other membrane-column methods. The PureYield™ Plasmid Maxiprep System incorporates a unique Endotoxin Removal Wash designed to remove substantial amounts of protein, RNA and endotoxin contaminants from purified plasmid DNA. Removal of contaminants improves the robustness of sensitive applications such as eukaryotic transfection, in vitro transcription and coupled in vitro transcription/translation (e.g., TnT® Quick Coupled Transcription/Translation System). Purification is achieved without isopropanol precipitation of purified plasmid DNA. The system has been designed for use with a vacuum source and vacuum manifold (e.g., the Vac-Man® Laboratory Vacuum Manifold). The Eluator™ Vacuum Elution Device is used to elute nucleic acids from PureYield™ Midiprep or Maxiprep columns. It consists of two pieces, a blue base and a clear column assembly. The base interfaces with a Vacuum Manifold that contains Luer-Lok® fittings, such as the Vac-Man® Laboratory Vacuum Manifold (Cat.# A7231), and holds a 1.5ml tube to capture the eluted nucleic acids. The column assembly accepts PureYield™ Midiprep or Maxiprep columns. The Eluator™ Device eliminates the requirement for a centrifuge with a swinging bucket rotor for nucleic acid purification, simplifying and speeding purification protocols. Features: • Improved Productivity: Vacuum protocol simplifies purification of multiple samples at one time. • Confidence in Results: High purity and concentration of plasmid DNA gives proven performance in transfection, in vitro expression and other molecular biology applications. • Ease of Use: Simple protocol eliminates tedious, gravity-drip columns and post-elution alcohol precipitation. • Flexibility: PureYield™ membrane column allows purification of large amounts of plasmid DNA, exceeding the capabilities of other maxiprep systems. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 146 For complete and up-to-date product information visit: www.promega.com Wizard® Plus Minipreps DNA Purification Systems Product Size Cat.# Wizard® Plus Minipreps DNA Purification System 50 preps A7100 100 preps A7500 250 preps A7510 Available Separately Cell Resuspension Solution (CRA) 150 ml A7112 Cell Lysis Solution (CLA) 150 ml A7122 Neutralization Solution (NSA) 150 ml A7131 Column Wash Solution (CWB) 125 ml A8102 Wizard® Minipreps DNA Purification Resin 250 ml A7141 Wizard® Minicolumns 250 each A7211 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The resin-based Wizard® Plus Minipreps DNA Purification System provides a simple and reliable method for rapid isolation of plasmid DNA. When using the standard protocol, the entire miniprep process can be completed in 15 minutes or less, with no organic extractions or ethanol precipitations. Minipreps may be processed individually or in multiples with the Vac-Man® (20-sample capacity, Cat.# A7231) or Vac-Man® Jr. (2-sample capacity, Cat.# A7660) Laboratory Vacuum Manifold. DNA is eluted from the Wizard® Minicolumn in Nuclease-Free Water (Cat.# P1193). The purified plasmid can be used directly for automated fluorescent DNA sequencing and restriction digestion without further manipulation and also can be used for in vitro transcription reactions supplemented with a ribonuclease inhibitor, such as Recombinant RNasin® Ribonuclease Inhibitor (Cat.# N2511). The Wizard® Minipreps DNA Purification Resin is used in the isolation and preparation of plasmid DNA in conjunction with the Wizard® Plus Minipreps DNA Purification Systems. The resin is available with the systems and as a standalone product. Features: • High Performance: DNA is suitable for most molecular biology applications, including fluorescent sequencing. • Confidence in Results: Purified DNA meets a target of >98% accuracy over 500 bases using pGEM®-3Zf(+) Vector in BigDye® terminator sequencing. • Fast: Entire procedure may be completed in 15 minutes or less. • Convenient: No phenol extractions or ethanol precipitations required. Storage Conditions: Store at 22–25°C. Wizard® Plus Midipreps DNA Purification System Product Size Cat.# Wizard® Plus Midipreps DNA Purification System 25 preps A7640 Available Separately Cell Resuspension Solution (CRA) 150 ml A7112 Cell Lysis Solution (CLA) 150 ml A7122 Neutralization Solution (NSA) 150 ml A7131 Column Wash Solution (CWB) 125 ml A8102 Wizard® Midipreps DNA Purification Resin 1,000 ml A7701 Wizard® Midicolumns 100 each A7651 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The resin-based Wizard® Plus Midipreps DNA Purification System provides a simple and reliable method for rapid isolation of plasmid DNA. When using the standard protocol, the entire midiprep process can be completed in 90 minutes or less, yielding up to 200μg of high-quality DNA with no organic extractions or ethanol precipitations. Multiple midipreps can be easily processed at one time with the Vac-Man® (20-sample capacity, Cat.# A7231) or Vac-Man® Jr. (2-sample capacity, Cat.# A7660) Laboratory Vacuum Manifold. DNA is eluted from the Wizard® Midicolumn in Nuclease-Free Water (Cat.# P1193). The purified plasmid can be used directly for automated fluorescent DNA sequencing or restriction digestion without further manipulation and also can be used for in vitro transcription reactions supplemented with a ribonuclease inhibitor such as Recombinant RNasin® Ribonuclease Inhibitor (Cat.# N2511). The system includes sufficient reagents for 25 DNA isolations from 10–100ml of liquid culture. Features: • Fast: Rapid batch column method used for DNA isolation. • Safe: Eliminates the need for cesium chloride:ethidium bromide gradient centrifugation and does not require organic extractions. • Reliable: Yields plasmid DNA of comparable quantity and quality to cesium chloride:ethidium bromide gradient techniques that are much more timeand labor-intensive. • High Performance: DNA is suitable for restriction enzyme digestions, automated fluorescent DNA sequencing, transformation and subcloning. • Confidence in Results: Purified DNA meets a target of >98% accuracy over 500 bases using pGEM®-3Zf(+) Vector in BigDye® terminator sequencing. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 147 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com Wizard® Plus Maxipreps DNA Purification System Product Size Cat.# Wizard® Plus Maxipreps DNA Purification System 10 preps A7270 Available Separately Cell Resuspension Solution (CRA) 150 ml A7112 Cell Lysis Solution (CLA) 150 ml A7122 Neutralization Solution (NSA) 150 ml A7131 Column Wash Solution (CWB) 125 ml A8102 Wizard® Maxipreps DNA Purification Resin 500 ml A7401 Wizard® Maxi/Megapreps Filtering System 50 each A7421 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® Plus Maxipreps DNA Purification System provides a simple and rapid resin-based batch column method for purification of plasmid DNA that eliminates the need for cesium chloride:ethidium bromide gradient centrifugation. Use of this system requires only a centrifuge, a vacuum source and a vacuum manifold. This system typically yields 300μg–1mg of high-copynumber plasmid DNA (200–20,000bp) from a 100–500ml culture in less than three hours. The purified DNA is eluted in Nuclease-Free Water (Cat.# P1193) and can be used directly for DNA sequencing and restriction digestion without further manipulation. The DNA also can be used for in vitro transcription reactions supplemented with a ribonuclease inhibitor such as Recombinant RNasin® Ribonuclease Inhibitor (Cat.# N2511). Features: • Flexible: DNA is suitable for restriction enzyme digestions, automated fluorescent DNA sequencing, transformation and subcloning. • High Quality: Yields plasmid DNA of comparable quantity and quality to cesium chloride:ethidium bromide gradient techniques that are much more time- and labor-intensive. • Fast: Rapid batch binding and column washing method used for DNA isolation. • Safe: Eliminates the need for cesium chloride:ethidium bromide gradient centrifugation and does not require organic extractions. Storage Conditions: Store at 22–25°C. Wizard® Plus Megapreps DNA Purification System Product Size Cat.# Wizard® Plus Megapreps DNA Purification System 5 preps A7300 Available Separately Cell Resuspension Solution (CRA) 150 ml A7112 Cell Lysis Solution (CLA) 150 ml A7122 Neutralization Solution (NSA) 150 ml A7131 Column Wash Solution (CWB) 125 ml A8102 Wizard® Maxi/Megapreps Filtering System 50 each A7421 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Wizard® Plus Megapreps DNA Purification System provides a simple and rapid method for large-scale purifications of plasmid DNA that eliminates the need for cesium chloride:ethidium bromide gradient centrifugation. Use of this system requires only a centrifuge, a vacuum source and a vacuum manifold. The system yields greater than one milligram of high-copy-number plasmid DNA (200–20,000bp) from a 1,000ml culture in less than three hours. The purified DNA is eluted in Nuclease-Free Water (Cat.# P1193) or TE buffer and can be used directly for DNA sequencing and restriction digestion without further manipulation. The DNA also can be used for in vitro transcription reactions supplemented with a ribonuclease inhibitor such as Recombinant RNasin® Ribonuclease Inhibitor (Cat.# N2511). Features: • Fast: Rapid batch binding and column washing method used for DNA isolation • Safe: Eliminates the need for cesium chloride:ethidium bromide gradient centrifugation and does not require organic extractions. • Reliable: Yields plasmid DNA of comparable quantity and quality to cesium chloride:ethidium bromide gradient techniques that are much more timeand labor-intensive. • Yield: Each megaprep produces >1mg of DNA from 1,000ml of bacterial culture when using a high-copy-number plasmid. • Quality: DNA is suitable for restriction enzyme digestions, automated fluorescent DNA sequencing, transformation and subcloning. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 148 For complete and up-to-date product information visit: www.promega.com Wizard® SV 96 and SV 9600 Plasmid DNA Purification Systems Product Size Cat.# Wizard® SV 96 Plasmid DNA Purification System 1 × 96 preps A2250 5 × 96 preps A2255 Wizard® SV 9600 Plasmid DNA Purification System 100 × 96 preps A2258 Available Separately Column Wash Solution (CWA) 185 ml A1311 Column Wash Solution (CWA) 370 ml A1318 Wizard® SV 96 Neutralization Solution 500 ml A1481 950 ml A1488 Wizard® SV 96 Cell Resuspension Solution 500 ml A7113 800 ml A7118 Wizard® SV 96 Cell Lysis Solution 500 ml A7123 800 ml A7128 Nuclease-Free Water 150 ml P1195 Alkaline Protease Solution 3 ml A1441 Wizard® SV 96 Binding Plates 10 pack A2271 100 pack A2278 Wizard® SV 96 Lysate Clearing Plates 10 pack A2241 100 pack A2248 A1311 For Laboratory Use. A2250, A1318, A2255, A1481, A2258, A1488, A7113, A7118, A7123, A7128, P1195, A1441, A2271, A2278, A2241, A2248 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® SV 96 and SV 9600 Plasmid DNA Purification Systems provide a simple and reliable method for the rapid isolation of plasmid DNA using a silica-membrane, 96-well, high-throughput format. A single plate can be processed in 60 minutes or less. The purified plasmid can be used directly for automated fluorescent DNA sequencing as well as for other standard molecular biology techniques, including restriction enzyme digestion. The Wizard® SV 96 and SV 9600 Systems are designed for use either in a manual format or with Beckman Coulter or PerkinElmer automated instruments. Features: • Performance by Design: Vac-Man® 96 Vacuum Manifold eliminates waste handling and allows simultaneous lysate clearing and DNA binding. Novel plate design prevents cross-contamination during sample processing. • Flexibility: Designed for use in both manual and automated formats. • Confidence in Results: Purified DNA meets a target of >98% accuracy over 600 bases using pGEM®-3Zf(+) Vector DNA in BigDye® terminator sequencing. • Automation: Validated automated methods available at: www.promega.com/automethods/ • Your Choice of Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. Wizard® MagneSil® Plasmid Purification System Product Size Cat.# Wizard® MagneSil® Plasmid Purification System 4 × 96 preps A1630 8 × 96 preps A1631 Wizard® MagneSil® Plasmid Purification System, HTP1 100 × 96 preps A1635 Available Separately MagneSil® RED 100 ml A1641 MagneSil® BLUE 100 ml A2201 Cell Resuspension Solution 500 ml A7114 Cell Lysis Solution 500 ml A7124 Neutralization Solution 500 ml A7132 Elution Buffer 500 ml A1655 Collection Plates (4-pack) 1 each A9161 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® MagneSil® Plasmid DNA Purification System provides a simple and reliable method for the rapid isolation of plasmid DNA in a 96-well, high-throughput format. The purified plasmid can be used directly for automated fluorescent sequencing, such as with BigDye® terminator sequencing chemistry, as well as for other standard molecular biology techniques including restriction enzyme digestion. The use of the MagneSil® Paramagnetic Particles for lysate clearing (BLUE) as well as DNA capture (RED) circumvents the need for centrifugation or vacuum manifolds, making the system ideal for full automation on a Beckman Coulter or Tecan instrument. Features: • Improve Productivity: Process multiple plates without user intervention. • Gain Confidence: Consistent performance in fluorescent sequencing reactions. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 149 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com Wizard MagneSil Tfx™ System Product Size Cat.# Wizard MagneSil Tfx™ System 4 × 96 preps A2380 Available Separately Endotoxin Removal Resin 100 ml A2191 4/40 Wash Solution 115 ml A2221 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard MagneSil Tfx™ System provides a simple and reliable method for the rapid isolation of transfection-quality plasmid DNA in a 96-well, high-throughput format. The use of MagneSil® Paramagnetic Particles for lysate clearing as well as DNA capture circumvents the need for centrifugation or vacuum manifolds, allowing DNA purification with the Wizard MagneSil Tfx™ System to be completely automated. An automated method has been developed for use of this product with a Beckman Coulter Biomek® FX robotic workstation. This procedure requires approximately 45 minutes to process a single 96-well plate. The method can be adapted to other robotic workstations, such as the Beckman Coulter Biomek® 2000 or the Tecan Genesis® instrument. Features: • Improve Transfection Results: Use of Endotoxin Removal Resin cuts endotoxin carryover as much as 95% over standard sequencing-grade automated plasmid systems. • Enhance Mammalian Protein Expression: Three- to fivefold increase in protein expression compared to plasmid isolated from an automated sequencing-grade plasmid purification system. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. RNA Extraction ReliaPrep™ miRNA Cell and Tissue Miniprep System Product Size Cat.# ReliaPrep™ miRNA Cell and Tissue Miniprep System 10 preps Z6210 50 preps Z6211 250 preps Z6212 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ReliaPrep™ miRNA Cell and Tissue Miniprep System provides complete isolation of total RNA, including microRNA (miRNA) and other small non-coding RNA (sncRNA) subspecies, from a wide variety of cell and tissue types as quickly as 40 minutes. The proprietary column/binding matrix can efficiently capture total RNA, including miRNA, from very small amounts of input material. Using this membrane-based purification system, 1 × 102 to 1 × 106 cultured cells or 0.25–20mg of tissue can be processed per purification. The system incorporates a DNase treatment step, which effectively removes substances that can inhibit downstream assays. Features: • Easily Extract Total RNA in 40 Minutes: Experience superior ease of use compared to competitive purification chemistries; whether you’re a novice or an expert, 40-minute protocol reliably extracts total RNA, including miRNA. • Eliminate Harsh Organic Reagents: Bring your miRNA extraction out of the hood and onto your bench. Save money by eliminating the costly disposal of hazardous organic waste. • Isolate Pure RNA: Consistently isolate pure total RNA, including miRNA and other small non-coding RNAs, through an optimized chemistry. • Work with Low Elution Volumes: Extract high concentrations of amplifiable mRNA, miRNA and other small non-coding RNA in elution volumes that meet the needs of your downstream assays. Storage Conditions: Store at 15–30°C. ReliaPrep™ FFPE Total RNA Miniprep System Product Size Cat.# ReliaPrep™ FFPE Total RNA Miniprep System 10 reactions Z1001 100 reactions Z1002 Available Separately Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ FFPE Total RNA Miniprep System provides a complete, all-inclusive method for purification of quality total RNA from formalin-fixed paraffin-embedded tissue without using hazardous solvents or overnight digestion. Total RNA can be isolated from FFPE tissue in approximately one and one-half hours with minimal hands-on time. Features: • Easy to Use: Minimal preparation time. • Safe: Deparaffinization step occurs without harsh organic solvents. • Isolate Quality, Intact Total RNA: Fine-tuned protocol results in high-quality, intact, amplifiable total RNA. Storage Conditions: Store at room temperature. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 150 For complete and up-to-date product information visit: www.promega.com ReliaPrep™ RNA Miniprep Systems Product Size Cat.# ReliaPrep™ RNA Cell Miniprep System 10 preps Z6010 50 preps Z6011 250 preps Z6012 ReliaPrep™ RNA Tissue Miniprep System 10 preps Z6110 50 preps Z6111 250 preps Z6112 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ RNA Miniprep Systems provide a fast and simple technique for preparation of intact total RNA from cultured cells or tissue in as little as 30 minutes. The proprietary column/binding matrix can efficiently capture RNA from very small amounts of input material, isolating RNA eluted in a minimal volume (less than 15µl). Using this membrane-based purification system, from 100 to 5 × 106 cultured cells or 0.25 to 20mg of tissue can be processed per purification. The system incorporates a DNase treatment step directly on the minicolumn membrane and effectively removes substances that can inhibit downstream assays. Purification is achieved without the use of phenol:chloroform extractions or ethanol precipitations, resulting in pure RNA that does not require additional purification or concentration of the RNA for use in demanding applications. Features: • Be Efficient: Allows use of precious samples. • Have Confidence: Provides maximum sensitivity for downstream assays without worry of inhibition when measuring low-copy-number targets. • Save Effort: No need to further concentrate samples for use. • Save Time: Rapid protocol and provided DNase reagents streamline laboratory processes. Storage Conditions: Store at 15–30°C. SV Total RNA Isolation System Product Size Cat.# SV Total RNA Isolation System 10 preps Z3101 50 preps Z3100 250 preps Z3105 Available Separately Red Blood Cell Lysis Solution (CLB) 200 ml Z3141 RNA Lysis Buffer (RLA) 50 ml Z3051 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The SV Total RNA Isolation System provides a fast and simple technique for preparation of intact total RNA from tissues, cultured cells and white blood cells in as little as one hour. Using this membrane-based purification system, up to 60mg of tissue can be processed per purification, depending on tissue type. The system incorporates a DNase treatment step directly on the minicolumn membrane. This step substantially reduces genomic DNA contamination, which can interfere with amplification-based methodologies. Purification is achieved without the use of phenol:chloroform extractions or ethanol precipitations, and there is no DNase carryover in the final RNA preparation. Features: • Safety and Efficiency: Rapid isolation of high yields of total RNA without the use of hazardous compounds like phenol. • Flexibility: Single system for isolation directly from blood, cells or tissue. Two methods available for purification: microcentrifugation (spin) or vacuum. • Confidence: Purified RNA suitable for all routine molecular biology applications, including RT-PCR and Northern blotting. Storage Conditions: Store at 22–25°C. PureYield™ RNA Midiprep System Product Size Cat.# PureYield™ RNA Midiprep System 10 preps Z3740 50 preps Z3741 Available Separately RNA Lysis Buffer (RLA) 50 ml Z3051 RNA Wash Solution (RWA) 58.8 ml Z3091 Red Blood Cell Lysis Solution (CLB) 200 ml Z3141 Eluator™ Vacuum Elution Device 4 each A1071 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PureYield™ RNA Midiprep System isolates intact, pure total RNA from essentially any sample type for use in a wide range of applications. The use of a novel Clearing Agent enables the rapid purification of total RNA with undetectable levels of genomic DNA contamination without using DNase. A novel combination of reagents, membranes and protocol leads to yields of up to 1mg of total RNA without organic solvents, protease digestions or alcohol precipitations. One kit can be used to isolate pure total RNA from a wide variety of sample types, such as tissues, cultured cells, bacteria, yeast, plants and blood. The protocol also can be adapted for other sample types. Commonly used methods provide total RNA that is contaminated with genomic DNA. This contamination can interfere with sensitive methods, such as realtime RT-PCR and microarray analysis. The PureYield™ RNA Midiprep System avoids this problem by selectively removing the genomic DNA prior to total RNA purification. The eluted total RNA is free of detectable DNA and ready for use in sensitive downstream applications. The system has been designed for use with centrifugation or vacuum (e.g., the Vac-Man® Laboratory Vacuum Manifold) formats. The Eluator™ Vacuum Elution Device is used to elute nucleic acids from PureYield™ Midiprep or Maxiprep columns. It consists of two pieces, a blue base and a clear column assembly. The base interfaces with a Vacuum Manifold that contains Luer-Lok® fittings, such as the Vac-Man® Laboratory Vacuum Manifold (Cat.# A7231), and holds a 1.5ml tube to capture the eluted nucleic acids. The column assembly accepts PureYield™ Midiprep or Maxiprep columns. The Eluator™ Device eliminates the requirement for a centrifuge with a swinging bucket rotor for nucleic acid purification, simplifying and speeding purification protocols. Features: • Enhanced Results: Purified total RNA with undetectable genomic DNA contamination improves results in downstream applications. • Improved Productivity: Purifying total RNA without the use of DNase treatment reduces steps during purification and in downstream applications. • Safety and Efficiency: Rapid purification of high yields of total RNA without the use of hazardous organic solvents. • Flexibility: Single system for purifying total RNA directly from cultured cells, bacteria, yeast, plants and other sample types. Storage Conditions: Store the RNA Lysis Buffer (RLA) with added β-Mercaptoethanol (BME) at 4°C. Store all other components at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 151 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com RNAgents® Denaturing Solution Product Size Cat.# RNAgents® Denaturing Solution 120 ml Z5651 For Research Use Only. Not for Use in Diagnostic Procedures. Description: RNAgents® Denaturing Solution lyses cells or tissue under conditions that rapidly inhibit ribonucleases, using two potent inhibitors of RNase, guanidine thiocyanate and β-mercaptoethanol. The RNAgents® Denaturing Solution is designed to be used in concert with acidic phenol:chloroform and alcohol (isopropanol) for purification of total RNA. Storage Conditions: Store at 4°C. SV 96 Total RNA Isolation System Product Size Cat.# SV 96 Total RNA Isolation System 1 × 96 each Z3500 5 × 96 each Z3505 Available Separately RNA Lysis Buffer (RLA) 50 ml Z3051 RNA Wash Solution (RWA) 58.8 ml Z3091 Nuclease-Free Water 150 ml P1195 Wizard® SV 96 Binding Plates 10 pack A2271 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The SV 96 Total RNA Isolation System provides a high-throughput technique to prepare intact RNA from tissue and cultured cells. Total RNA can be purified from 96 samples in less than an hour without centrifugation. The system also incorporates a DNase treatment step that is designed to substantially reduce genomic DNA contamination, which can interfere with amplification-based methodologies. Purification is achieved without phenol:chloroform extraction or ethanol precipitation, and there is no detectable DNase carryover in the final RNA preparation. Protocols are available for Beckman Coulter and PerkinElmer instruments. Features: • Confidence in Results: The product is tested to ensure that purified RNA will perform optimally in RT-PCR. • Unique Design: Novel vacuum manifold eliminates waste handling. Novel plate design prevents cross-contamination during sample processing. • Flexibility: The system is designed for both manual and automated formats. • Automation: Validated automated methods available at: www.promega.com/automethods/ • Your Choice of Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store the SV RNA Lysis Buffer with β-Mercaptoethanol (BME) added at 4°C. Store all other components at 22–25°C. MagneSil® Total RNA mini-Isolation System Product Size Cat.# MagneSil® Total RNA mini-Isolation System 4 plate Z3351 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagneSil® Total RNA mini-Isolation System provides a high-throughput 96-well format for fast, simple preparation of intact total RNA from small amounts of cell culture (≤1 × 105 tissue culture cells), tissue (≤2mg tissue lysate in 100μl) or freshly isolated whole blood (≤20μl). The protocol enables high-throughput automated purification on a variety of liquid-handling workstations. Isolation of total RNA in a 384-well format from cell culture (≤1 × 103 cells) and freshly isolated whole blood (≤5μl) also may be performed. Total RNA purification is achieved without vacuum filtration, centrifugation or precipitation. The 96-well total RNA isolation procedure takes about 30 minutes to complete using a liquid-handling workstation. Total RNA purified using this system is suitable for a variety of molecular biology applications including endpoint RT-PCR amplification and real-time RT-PCR. Features: • Improve Productivity: Only 30 minutes are required to process one 96-well plate, or 50 minutes for one 384-well plate on a Beckman Coulter Biomek® FX liquid handler. • Improve Real-Time PCR Performance: Elution volumes as low as 15μl provide concentrated RNA without the need for time-consuming vacuum concentration. • Gain Confidence in Results: DNase I treatment is included to remove genomic DNA contamination. • Achieve Convenience: Robotic protocols require no user intervention once you start the automated robotic method. • Automate This Assay: Validated automated methods are available at: www.promega.com/automethods/ Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 152 For complete and up-to-date product information visit: www.promega.com PolyATtract® System 1000 Product Size Cat.# PolyATtract® System 1000 with Magnetic Stand Scalable Z5420 PolyATtract® System 1000 without Magnetic Stand Scalable Z5400 PolyATtract® System 1000 Magnetic Separation Stand 1 each Z5410 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PolyATtract® System 1000 isolates messenger RNA directly from crude cell or tissue lysates, eliminating the need for total RNA isolations. This system uses the MagneSphere® technology for the purification of poly(A)+ RNA, eliminating the need for oligo(dT) cellulose columns. The increased yield of mRNA using this system allows the detection of low-copy-number mRNAs in relatively small amounts of material using Northern blot analysis. The isolated mRNA is suitable for all molecular biology applications, including in vitro translation, cDNA synthesis, PCR analysis, ribonuclease (RNase) protection assays, primer extension and Northern blots. The MagneSphere® Technology Magnetic Separation Stands can be used in conjunction with any of the PolyATtract® Systems and are ideal for applications requiring multiple paramagnetic isolations of biomolecules. Features: • Improved Productivity: mRNA purification directly from tissue or cells in 45 minutes or less. Allows quick collection of magnetic particles. • Flexibility: Works with tissue amounts from 5mg–2g per isolation. Magnetic separation stand (Cat.# Z5410) accommodates 1.5ml, 2ml, 15ml and 50ml tube sizes. • Convenience: No lengthy ethanol precipitation steps, phenol:chloroform extractions, or overnight ultracentrifugation through cesium chloride gradients and lithium chloride (LiCl) precipitations. Storage Conditions: Store at 4°C. Do not freeze the MagneSphere® Paramagnetic Particles. Streptavidin MagneSphere® Paramagnetic Particles Product Size Conc. Cat.# Streptavidin MagneSphere® Paramagnetic Particles 9 ml 1 mg/ml Z5481 25 ml 1 mg/ml Z5482 For Laboratory Use. Description: The Streptavidin MagneSphere® Paramagnetic Particles (PMPs) may be used in the magnetic separation and purification of a wide variety of biotinylated nucleic acid or protein molecules. The particles are quality-tested and approved for isolation of biotinylated nucleic acids, proteins and antibodies. Features: • Confidence: The Streptavidin MagneSphere® Paramagnetic Particles feature strong, specific binding to biotinylated molecules. • Improved Purity: Enable binding, washing and magnetic separation from undesired materials in a solution. • Flexibility: Applications include purification of DNA, mRNA and proteins. Storage Conditions: Store at 4°C. Do not freeze the paramagnetic particles. PolyATtract® mRNA Isolation Systems Product Size Cat.# PolyATtract® mRNA Isolation System I (Refill for Z5200) 3 isolations Z5210 PolyATtract® mRNA Isolation System II with Magnetic Stand 3 isolations Z5200 PolyATtract® mRNA Isolation System III with Magnetic Stand 15 isolations Z5300 PolyATtract® mRNA Isolation System IV (Refill for Z5300) 15 isolations Z5310 Available Separately Biotinylated Oligo(dT) Probe (50pmol/μl) 35 μl Z5261 MagneSphere® Technology Magnetic Separation Stand (two-position) 1.5 ml Z5332 12 × 75 mm Z5333 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PolyATtract® mRNA Isolation Systems use the MagneSphere® technology to isolate mRNA rapidly and effectively from total RNA. The systems use a biotinylated oligo(dT) primer to hybridize, at high efficiency in solution, to the 3´ poly(A)+ region present in most mature eukaryotic mRNAs. The hybrids are bound to streptavidin coupled to paramagnetic particles, captured using a magnetic separation stand and washed at high stringency. The mRNA is eluted from the solid phase by the simple addition of ribonuclease-free, deionized water. With total RNA as the starting material, poly(A)+ mRNA is isolated in approximately 45 minutes. The isolated mRNA is suitable for all molecular biology applications, including in vitro translation and cDNA synthesis. Cat.# Z5200 contains sufficient reagents for 3 separate mRNA isolations, each from 1–5mg of total RNA. Cat.# Z5210 contains the same reagents as Cat.# Z5200, excluding the Magnetic Separation Stand. Cat.# Z5300 contains sufficient reagents for 15 separate mRNA isolations, each from 100–1,000μg of total RNA. Cat.# Z5310 contains the same reagents as Cat.# Z5300, excluding the Magnetic Separation Stand. Features: • Improved Productivity: Entire mRNA purification process can be completed in approximately 45 minutes. • Highly Pure mRNA: Due to the strength and selectivity of the interaction between streptavidin and biotin, mRNA bound to the biotinylated oligo(dT) is captured by streptavidin-coated magnetic particles. • Confidence in Your Applications: Isolated mRNA is suitable for use with in vitro translation, RT-PCR and cDNA synthesis. • Flexibility: Configurations for use with large or small amounts of cells and tissues. Storage Conditions: Store at 4°C. Do not freeze the MagneSphere® Paramagnetic Particles. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 153 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com Maxwell® 16 System RNA Purification Kits Product Size Cat.# Low Elution Volume (LEV) Maxwell® 16 miRNA Tissue Kit 48 preps AS1470 Maxwell® 16 LEV simplyRNA Cells Kit 48 preps AS1270 Maxwell® 16 LEV simplyRNA Tissue Kit 48 preps AS1280 Maxwell® 16 LEV simplyRNA Blood Kit 48 preps AS1310 Maxwell® 16 Tissue LEV Total RNA Purification Kit 48 preps AS1220 Maxwell® 16 Cell LEV Total RNA Purification Kit 48 preps AS1225 Maxwell® 16 LEV RNA FFPE Kit 48 preps AS1260 Maxwell® 16 LEV Plant RNA Kit 48 preps AS1430 Available Separately Maxwell® 16 Flexi Method Firmware 1 each AS6411 Maxwell® 16 High Strength LEV Magnetic Rod and Plunger Bar Adaptor 1 each SP1070 LEV Plungers 50 /pk AS6101 LEV Elution Tubes 50 /pk AS6201 SEV Plungers 50 /pk AS5201 SEV Elution Tubes 50 /pk AS5101 AS1470, AS1310, AS1260, AS1430, SP1070, AS6101, AS6201, AS5201, AS5101 For Research Use Only. Not for Use in Diagnostic Procedures. AS1270, AS1280, AS1220, AS1225, AS6411 For Laboratory Use. Description: The Maxwell® 16 LEV simplyRNA Cells Kit, Maxwell® 16 LEV simplyRNA Blood Kit, Maxwell® 16 LEV simplyRNA Tissue Kit, Maxwell® 16 Tissue LEV Total RNA Purification Kit, Maxwell® 16 Cell LEV Total RNA Purification Kit, Maxwell® 16 LEV RNA FFPE Kit and Maxwell® 16 LEV Plant RNA Kit are for use with the Maxwell® 16 Instrument configured with the LEV High Strength Magnetic Rod and Plunger Bar Adaptor. This RNA purification procedure is a simple method with minimal lysate handling before automated purification on the Maxwell® 16 Instrument. The low elution volume is used to generate concentrated high-quality RNA suitable for use in downstream applications such as quantitative RT-PCR. The kit provides the reagents for processing the samples and uses prefilled cartridges for purification, maximizing simplicity and convenience. The simple protocols require adding a cleared lysate to the reagent cartridge. Simply place the reagent cartridge into the Maxwell® 16 Instrument, and press start. Purified RNA is obtained in less than 45 minutes of hands-free instrument operation. No post-purification treatment with nuclease, cleanup or concentration is required to achieve superior performance in downstream applications. Features: • Enjoy Confidence in Your Application Results: Essentially undetectable contaminating genomic DNA means fewer repeated experiments and unexplained or variable results. • Choose Your Sample Type: Flexibility to purify from tissue, cells, blood and other samples. • Achieve High Yield and High Concentration: High yields and high-concentration total RNA result in better performance in gene expression analysis applications. Maxwell® RSC System RNA Purification Kits Product Size Cat.# Maxwell® RSC miRNA Tissue Kit 48 preps AS1460 Maxwell® RSC RNA FFPE Kit 48 preps AS1440 Maxwell® RSC miRNA Plasma and Serum Kit 48 preps AS1680 Maxwell® RSC simplyRNA Blood Kit 48 preps AS1380 Maxwell® RSC simplyRNA Tissue Kit 48 preps AS1340 Maxwell® RSC simplyRNA Cells Kit 48 preps AS1390 Maxwell® RSC Plant RNA Kit 48 preps AS1500 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® Rapid Sample Concentrator (RSC) Instrument is an automated nucleic acid purification system that processes up to 16 samples in a single run. The instrument is used with the prefilled reagent cartridges provided in the Maxwell® RSC Purification Kits to purify DNA or RNA from a wide range of sample types. The intuitive graphical user interface makes the instrument easy to use, and the integrated Quantus™ Fluorometer lets you collect purification and quantification data in one report. These kits can be used for automated RNA purification with the Maxwell® RSC Instrument. Maxwell® RSC miRNA Tissue Kit • Purifies total RNA, including miRNA, from mammalian tissue samples • Eliminates use of hazardous organic solvents. Maxwell® RSC RNA FFPE Kit • Purifies amplifiable RNA from FFPE tissue samples. • Eliminates use of hazardous organic solvents. Maxwell® RSC miRNA Plasma and Serum Kit • High-quality, amplifiable RNA from mammalian plasma, serum or enriched exosomes • Simple, safe RNA extraction without organic reagents • Automated RNA extraction of 1–48 samples in a single run Maxwell® RSC simplyRNA Tissue Kit • Purifies total RNA from up to 20mg of tissue in under an hour. • Reduces pre-extraction sample handling to 4 steps. Maxwell® RSC simplyRNA Cells Kit • Purifies total RNA from fresh or frozen cells in under an hour. • Reduces pre-extraction sample handling to 4 steps. Maxwell® RSC simplyRNA Blood Kit • Purifies total RNA from 2.5ml of fresh whole blood. • Reduces centrifugation steps. • Yields highly concentrated RNA from up to 16 samples in under an hour. Maxwell® RSC Plant RNA Kit • Extracts RNA from a range of plant sample types with no organic reagents. • Cellulose-based paramagnetic particles offer higher binding capacity for increased yields. • Extracted RNA is ready for downstream applications. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 154 For complete and up-to-date product information visit: www.promega.com Total Nucleic Acid Extraction Maxwell RSC Viral Total Nucleic Acid Purification Kit Product Size Cat.# Maxwell® RSC Viral Total Nucleic Acid Purification Kit 48 preps AS1330 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® RSC Viral Total Nucleic Acid Purification Kit purifies samples using paramagnetic particles, which provide a mobile solid phase to optimize sample capture, washing and purification of nucleic acid. The Maxwell® RSC and Maxwell® RSC 48 Instruments are magnetic particlehandling instruments that efficiently bind nucleic acids to theparamagnetic particle in the first well of a prefilled cartridge. The samples are processed through a series of washes before the total nucleic acid is eluted. Features: • Extracts viral total nucleic acid (RNA and DNA) from serum, plasma and other samples following brief lysis step • Accommodates a range of samples sizes from 100–300µl • Yields highly concentrated nucleic acids that are ready to use in downstream applications Storage Conditions: Store at 15–30°C. Maxwell 16 Viral Total Nucleic Acid Purification Kit Product Size Cat.# Maxwell® 16 Viral Total Nucleic Acid Purification Kit 48 preps AS1150 Maxwell® 16 Viral Total Nucleic Acid Purification System (IVD) 48 preps AS1155 AS1150 For Laboratory Use. AS1155 For In Vitro Diagnostic Use. This product is only available in certain countries. Description: The Maxwell® 16 Viral Total Nucleic Acid Purification Kit is used with the Maxwell® 16 Instrument to extract viral total nucleic acid (RNA and DNA) from serum or plasma samples. The kit contains all necessary reagents in convenient prefilled cartridges. The simple protocol involves three main steps. First, lysis buffer and proteinase K are mixed to prepare a lysis solution. Second, lysis solution is mixed with sample. Third, the lysate is added into the cartridges. Purified viral total nucleic acids are ready for analysis in approximately 45 minutes. Purified nucleic acids are ready for use in applications such as qPCR and qRT-PCR. The Maxwell® System provides efficient processing and higher sample capacity than comparable systems, without detectable cross-contamination between samples, speeding sample processing and reducing rework. Features: • Accommodates a range of sample sizes from 100–300µl • Yields concentrated nucleic acids ready-for-use in downstream applications Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 155 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com DNA/RNA Cleanup and Concentration Wizard® SV Gel and PCR Clean-Up System Product Size Cat.# Wizard® SV Gel and PCR Clean-Up System 50 preps A9281 250 preps A9282 1,000 preps A9285 Wizard® SV Gel and PCR Clean-Up System and x-tracta™ Gel Extractor Bundle 50 preps/25 extractors A9283 250 preps/100 extractors A9284 Available Separately Membrane Binding Solution 20 ml A9301 Vacuum Adapters 20 each A1331 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® SV Gel and PCR Clean-Up System is designed to extract and purify DNA fragments of 100bp to 10kb from standard or low-melting agarose gels or to purify products directly from PCR and other common reactions such as restriction digests. Up to 95% recovery is achieved depending upon the DNA fragment size. PCR products are commonly purified to remove excess nucleotides and primers. This membrane-based system, which can bind up to 40μg of DNA, allows recovery of isolated DNA fragments or PCR products in as little as 15 minutes, depending on the number of samples processed. The purified DNA can be used for automated fluorescent DNA sequencing, cloning, labeling, restriction enzyme digestion or in vitro transcription/translation without further manipulation. Features: • Improved Productivity: Purify DNA fragments or PCR products in as little as 15 minutes. • Enhanced Cloning Results: Up to 95% recovery eluted in as little as 15μl. • Confidence in Results: Purified DNA routinely achieves 700 bases with >98% accuracy in automated fluorescent sequencing. • Applications Tested: DNA is suitable for automated fluorescent sequencing, cloning, labeling, restriction enzyme digestion or in vitro transcription/translation without further manipulation. • One System to Do It All: One system can replace up to four kits from other suppliers. Storage Conditions: Store at 22–25°C. ReliaPrep™ RNA Clean-Up and Concentration System Product Size Cat.# ReliaPrep™ RNA Clean-Up and Concentration System 10 preps Z1071 50 preps Z1072 250 preps Z1073 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ RNA Clean-Up and Concentration System is designed to reduce carryover of reagents and concentrate samples in a simple, fast protocol. The system can process dilute samples or sample pools up to 300µl in a single column and elute them in 15µl of water or TE buffer. It maintains good recovery of RNA samples and ensures usefulness in downstream applications such as RT-qPCR, Northern blot analysis or RNA sequencing. Features: • Column-based method for rapid concentration and clean-up of RNA • High binding capacity to accommodate large samples • Small elution volumes provide highly concentrated samples and remove inhibitors Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 156 For complete and up-to-date product information visit: www.promega.com ReliaPrep™ DNA Clean-Up and Concentration System Product Size Cat.# ReliaPrep™ DNA Clean-Up and Concentration System 10 preps A2891 50 preps A2892 250 preps A2893 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ DNA Clean-Up and Concentration System is designed to quickly concentrate and purify dilute DNA solutions, extract and purify DNA fragments of 100bp–10kb from standard or low-melt agarose gels in either Tris acetate (TAE) or Tris borate (TBE) buffer, or to purify products directly from a PCR amplification. This membrane-based system can bind up to 60µg of DNA and concentrate as much as 300µl of dilute DNA, recovering isolated DNA fragments or PCR products in as little as 10 minutes, depending on the number of samples processed and the protocol used. A single reagent stream is used for all three procedures, making the system both fast and easy. The purified DNA can be used for automated fluorescent DNA sequencing, cloning, labeling, restriction enzyme digestion, nextgeneration sequencing or in vitro transcription/translation. The ReliaPrep™ DNA Clean-Up and Concentration System can be used with linear DNA fragments, supercoiled plasmid DNA or single-stranded linear or circular DNA. Features: • Column-based method for rapid concentration and clean-up of DNA • High binding capacity to accommodate large samples • Small elution volumes provide highly concentrated samples and remove inhibitors Storage Conditions: Store at 15–30°C. x-tracta™ Gel Extractor Product Size Cat.# x-tracta™ Gel Extractor 25 /pack A2121 100 /pack A2122 Wizard® SV Gel and PCR Clean-Up System and x-tracta™ Gel Extractor Bundle 50 preps/25 extractors A9283 250 preps/100 extractors A9284 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The x-tracta™ Gel Extractor tool provides a convenient, safe method for removal of agarose gel fragments for further processing. The device removes a 0.13 × 0.33 inch gel piece from agarose gels for easy transfer into a microcentrifuge tube for processing. The x-tracta™ tool eliminates the need for razor blades or scalpels, and its single-use design eliminates the possibility for sample-to-sample cross-contamination. Note: The x-tracta™ Gel Extractor works best on 0.6–2% analytical grade agarose gels. Please exercise caution if using the x-tracta™ Gel Extractor on Low Melting Point (LMP) agarose gels because the extractor does not work effectively on these due to the gel consistency. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 157 9Nucleic Acid Extraction For complete and up-to-date product information visit: www.promega.com Wizard® PCR Preps DNA Purification System Product Size Cat.# Wizard® PCR Preps DNA Purification System 50 preps A7170 250 preps A2180 Available Separately Wizard® PCR Preps DNA Purification Resin 250 ml A7181 Direct Purification Buffer 25 ml A7241 Wizard® Minicolumns 250 each A7211 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® PCR Preps DNA Purification System provides a simple, reliable way to purify double-stranded PCR-amplified DNA. Using the 15-minute batch column purification method, PCR products are effectively separated from contaminants, including primer-dimers and amplification primers. This system also can be used to purify DNA fragments from agarose gels. The DNA can be eluted in water or TE buffer, free of salts or macromolecular contaminants. Multiple PCR Preps may be processed easily at one time with the Vac-Man® Laboratory Vacuum Manifold (Cat.# A7231). Features: • Improved Productivity: Purify PCR products directly from reactions in 15 minutes. • Flexibility: Separate PCR products from other reaction components such as primers and primer-dimers or from gel slices. • Labor Saving Format: Process multiple purifications simultaneously using the Vac-Man® Laboratory Vacuum Manifold. Storage Conditions: Store at 22–25°C. Wizard® DNA Clean-Up System Product Size Cat.# Wizard® DNA Clean-Up System 100 preps A7280 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® DNA Clean-Up System provides a simple and effective way to purify linear and circular DNA (200–50,000bp) from many molecular biology reactions. Using a quick batch-column procedure, the entire process can be completed in 15 minutes or less with no organic extractions or ethanol precipitations. DNA is eluted in water or TE buffer, ready for use. Multiple preps may be processed easily at one time with the Vac-Man® Laboratory Vacuum Manifold (Cat.# A7231). Features: • Improved Productivity: Results in 15 minutes or less. • Convenience: No phenol extractions or ethanol precipitations. • Flexibility: Works with a wide range of DNA sizes from 200–50,000bp in length. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 158 For complete and up-to-date product information visit: www.promega.com Wizard® SV 96 PCR Clean-Up System Product Size Cat.# Wizard® SV 96 PCR Clean-Up System 1 × 96 preps A9340 4 × 96 preps A9341 8 × 96 preps A9342 100 × 96 preps A9345 Available Separately Membrane Binding Solution 20 ml A9301 Wizard® SV 96 Binding Plates 10 pack A2271 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® SV 96 PCR Clean-Up System is designed for high-throughput purification of 100bp to 10kb PCR products from excess nucleotides, primers and primer dimers. This membrane-based system allows recovery of >90% in as little as 20 minutes. The purified DNA can be used for automated fluorescent sequencing, cloning, labeling, restriction digestion or microarray analysis without further manipulation. The Wizard® SV 96 PCR Clean-Up System uses 96-well filtration without the need to disassemble the manifold. Filtrate waste is delivered directly to a vacuum trap, eliminating the need to dispose of collected waste within the manifold assembly. Protocols are available for automated instruments from Beckman Coulter and PerkinElmer. Features: • High Performance: Optimized methods deliver purified PCR products suitable for demanding applications such as microarray analysis. • Confidence: Average recovery for 100–500bp fragments of >90%. Automated fluorescent sequencing Phred* 20 scores >600. • Automation: Validated automated methods available at: www.promega.com/automethods/ • Your Choice of Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ *A Phred score is a widely recognized method to measure the quality of DNA sequences. Phred is a base-calling program for DNA sequence traces available from Codoncode Corporation. Storage Conditions: Store at 22–25°C. Wizard® MagneSil® Sequencing Reaction Clean-Up System Product Size Cat.# Wizard® MagneSil® Sequencing Reaction Clean-Up System 4 × 96 preps A1831 8 × 96 preps A1832 Wizard® MagneSil® Sequencing Reaction Clean-Up System, HTP1 100 × 96 preps A1835 Available Separately MagneSil® GREEN 100 ml A8231 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® MagneSil® Sequencing Reaction Clean-Up System was developed for high-throughput purification of sequencing reactions, including BigDye® Terminator reactions. Cleanup is performed using the proprietary MagneSil® GREEN Paramagnetic Particles with standard, nonskirted 96-well amplification plates. No user intervention is required from the time the plates are placed on the instrument until the samples are ready for loading onto the fluorescent DNA sequencer. Protocols are available for automated instruments from Beckman Coulter and Tecan. The system relies upon the MagnaBot® II for magnetic separation. The Plate Clamp 96 and Plate Stand are recommended for automated use because they ensure PCR plates are uniformly flat for liquid transfer on a robotic instrument. Features: • Get Immediate Results: Validated, walkaway method. • Gain Confidence in Results: Purified products are approved for fluorescent sequencing reactions. Phred* 20 quality scores ≥650 bases. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ *A Phred score is a widely recognized method to measure the quality of DNA sequences. Phred is a base-calling program for DNA sequence traces available from Codoncode Corporation. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 159 10 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Nucleic Acid Quantitation and Analysis DNA and RNA Quantitation 160 In vitro Transcription 164 RNA Interference 167 RT-PCR and RT-qPCR 169 Nucleic Acid Quantitation and Analysis Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 160 For complete and up-to-date product information visit: www.promega.com DNA and RNA Quantitation QuantiFluor® ONE dsDNA System Product Size Cat.# QuantiFluor® ONE dsDNA System 100 reactions E4871 500 reactions E4870 Available Separately K562 Genomic DNA 80 μg E4931 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The QuantiFluor® ONE dsDNA System contains a fluorescent double-stranded DNA-binding dye (504nmEx/531nmEm) developed for use in an “add-and-read” format for dye and standard, making sample quantitation easy. This system enables sensitive quantitation of small amounts of doublestranded DNA (dsDNA). The QuantiFluor® ONE dsDNA System was developed using the fluorescence module of the GloMax® Multi+ Detection System with Instinct® Software, GloMax® Discover System and the Quantus™ Fluorometer. The QuantiFluor® ONE dsDNA System can be used with any fluorometer that is capable of measuring fluorescence at the appropriate excitation and emission wavelengths. Features: • Perform No Dilutions; Use No Extra Tubes: Add-and-read format makes this dye simple to use. • Increase Your Sensitivity: Significantly increased sensitivity compared to absorbance at 260nm (NanoDrop® spectrophotometer), allowing you to quantitate low-concentration samples with confidence. • Experience Minimal Binding: Highly specific to dsDNA; minimal binding to ssDNA, RNA, protein and interfering compounds. • Take Advantage of Flexible Instrumentation: Integrated on Quantus™ and GloMax® detection instruments, yet compatible with any fluorometer capable of measuring the appropriate fluorescence excitation and emission spectra. Storage Conditions: Store the QuantiFluor® ONE dsDNA Dye and QuantiFluor® ONE Lambda DNA at –30°C to +10°C. Store the 1X TE Buffer at –30°C to +30°C. QuantiFluor® dsDNA System Product Size Cat.# QuantiFluor® dsDNA System 1 ml E2670 QuantiFluor® dsDNA Sample Kit 1 each E2671 Available Separately 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The QuantiFluor® dsDNA System contains a fluorescent DNA-binding dye that enables sensitive quantitation of small amounts of double-stranded DNA (dsDNA) in solution. The quantitation of dsDNA is a very important step in many biological applications, particularly in standard molecular biology techniques. The dye shows minimal binding to singlestranded DNA (ssDNA) and RNA, allowing specific quantitation of dsDNA. Features: • Experience Minimal Binding: Highly specific to dsDNA; minimal binding to ssDNA, RNA, protein and interfering compounds. • Increase Your Sensitivity: Significantly increased sensitivity compared to absorbance at 260nm (NanoDrop® spectrophotometer) for lowconcentration samples. Performs better or equal to PicoGreen® dye and can detect as little as 50pg/ml. • Set Up Quickly and Easily: System includes all required reagents to quickly set up and quantitate dsDNA. • Use with Promega Instruments: Pre-optimized on both the Quantus™ Fluorometer and GloMax®-Multi+ Instrument. • Use for Next-Gen Sequencing: Successfully used in several Next-Gen Sequencing systems, including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. Storage Conditions: Product may arrive frozen. Upon receipt, store at 2–10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 161 10Nucleic Acid Quantitation and Analysis For complete and up-to-date product information visit: www.promega.com QuantiFluor® ssDNA System Product Size Cat.# QuantiFluor® ssDNA System 1 ml E3190 Available Separately 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The QuantiFluor® ssDNA System contains a fluorescent dye that enables sensitive quantitation of small amounts of single-stranded (ssDNA) in solution. Detecting and quantitating ssDNA is useful for a variety of research interests in molecular biology. These include studying ssDNA viruses, quantitating short synthetic ssDNA probes for site-directed mutagenesis, analysis of firststrand cDNAs and quantitating bisulfite-converted DNA to study DNA methylation. Features: • Increase Your Sensitivity: Significantly increased sensitivity compared to absorbance at 260nm (NanoDrop® spectrophotometer) for lowconcentration samples. • Save Precious Sample for Downstream Assays: Less template DNA required than spectrophotometry. • Set Up Quickly and Easily: System includes all required reagents to quickly set up and quantitate ssDNA. • Experience Flexible Instrument Compatibility: Use easily on both the QuantiFluor® Fluorometer and GloMax®-Multi Instrument. This system also can be used on any fluorescent instrument with appropriate optical channels. • Remain Cost-Effective: Value priced for those customers who are cost-conscious and budget-constrained. • Use with Promega Instruments: Pre-optimized on both the Quantus™ Fluorometer and GloMax®-Multi+ Instrument. Storage Conditions: Store at –30° to –10°C, protected from light. QuantiFluor® RNA System Product Size Cat.# QuantiFluor® RNA System 1 ml E3310 Available Separately 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Sensitive quantitation of RNA is important for the success of downstream applications. The QuantiFluor® RNA System contains a fluorescent RNA-binding dye that enables sensitive quantitation of small amounts of RNA in solution. Detecting and quantitating small amounts of RNA is a very important step that is used in many biological applications, particularly in molecular biology techniques. Features: • Increase Your Sensitivity: Significantly increased sensitivity compared to absorbance results on the NanoDrop® spectrophotometer, allowing you to quantitate low-concentration samples with confidence. • Save Precious Sample for Downstream Assays: Less template RNA required than for quantification by spectrophotometry. • Experience Flexible Instrument Compatibility: Use easily on both the QuantiFluor®-ST Fluorometer and GloMax®-Multi Instrument. This system also can be used on any fluorescent instrument with appropriate optical channels. • Remain Cost-Effective: Value priced, robust option for RNA quantitation. • Use with Promega Instruments: Pre-optimized on both the Quantus™ Fluorometer and GloMax®-Multi+ Instrument. Storage Conditions: Store at –30°C to –10°C, protected from light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 162 For complete and up-to-date product information visit: www.promega.com Quantus™ Fluorometer Product Size Cat.# Quantus™ Fluorometer 1 each E6150 Available Separately 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 Quantus™ Instrument Standard Service Agreement 1 each SA4040 E4941, E6150, E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Quantus™ Fluorometer is a dual-channel fluorometer for your quantitation workflow. Designed to provide highly sensitive fluorescent detection when quantifying nucleic acids, the compact instrument is simple to operate. The Quantus™ Fluorometer is optimized with preprogrammed settings for Promega QuantiFluor® Dye Systems (QuantiFluor® dsDNA, RNA and ssDNA Systems) to quantitate nucleic acids and offers the flexibility to create customized methods and quantitation settings for other fluorescent dyes. The Quantus™ Fluorometer is equipped with two fluorescence channels for nucleic acid and protein quantitation: • Blue fluorescence channel: Excitation 495nm shortpass (wavelengths up to 495nm), emission 510–580nm. • Red fluorescence channel: Excitation 640nm shortpass (wavelengths up to 640nm), emission 660–720nm. Features: • Experience High Performance: Integrated with QuantiFluor® Dyes for high sensitivity, broad dynamic range and target specificity. Great for low-level sample quantitation such as FFPE or viral samples. • Achieve Increased Sensitivity: Significantly increased sensitivity over absorbance at 260nm (NanoDrop® spectrophotometer) for those samples that are low in concentration. Ten times more sensitive than Qubit® 2.0 and a detection limit of 50pg/ml, compared to 500pg/ml for the Qubit® 2.0. With a customized low standard curve, lower amounts can be detected. • Implement Easy-to-Use Workflow and Navigation: Flexible with custom protocols and user-defined settings. PC software for data management workflow. • Easily Incorporate into Your Laboratory: Affordable price is very cost-effective. • Use for Next-Gen Sequencing: Successfully used in several Next-Gen Sequencing systems, including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. Quantus™ NGS Starter Package Product Size Cat.# Quantus™ NGS Starter Package 1 each E5150 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Quantus™ NGS Starter Package provides you with highly sensitive and easy-to-use DNA quantitation for your NGS applications all in one discounted bundle. Contents include a Quantus™ Fluorometer (Cat.# E6150); QuantiFluor® ONE dsDNA System (Cat.# E4870) and enough 0.5ml assay tubes for 500 reactions. The Quantus™ Fluorometer is a compact and easy-to-operate instrument designed for highly sensitive fluorescent detection of nucleic acids. The Quantus™ Fluorometer is optimized with preprogrammed settings for Promega QuantiFluor® Dye Systems (QuantiFluor® dsDNA, RNA, ssDNA Systems) for nucleic acid quantitation and offers flexibility to create customized methods and quantitation settings for other dyes. The QuantiFluor® ONE dsDNA System provides a fluorescent double-stranded DNA-binding dye in an “add-and-read” format for both dye and standard, simplifying DNA quantitation and speeding up your workflow. It’s as easy to use as NanoDrop® absorbance-based methods but much more sensitive for low-concentration samples. Features: • Employ Integrated Instrumentation and Assay: The QuantiFluor® dyes are optimized for high sensitivity, broad dynamic range and target specificity on the Quantus™ Fluorometer. • Measure Low dsDNA Concentrations: Add-and-read format makes measuring low concentrations of dsDNA simple—no dilutions, no extra tubes. • Notice Increased Sensitivity: Significantly increased sensitivity over absorbance at 260nm (NanoDrop spectrophotometer) for those samples that are low in concentration. • Expect High Specificity to dsDNA: Minimal binding to ssDNA, RNA, protein and interfering compounds. • Spend Less Money: Cost-effective to easily incorporate into your laboratory. • Use for Next-Gen Sequencing: Successfully used in several NGS systems including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. Storage Conditions: Store QuantiFluor® ONE dsDNA Dye and QuantiFluor® ONE Lambda DNA at –30°C to +10°C. Store 1X TE Buffer at –30°C to +30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 163 10Nucleic Acid Quantitation and Analysis For complete and up-to-date product information visit: www.promega.com Plexor® HY System Product Size Cat.# Plexor® HY System 200 reactions DC1001 800 reactions DC1000 Available Separately Plexor® Calibration Kit, Set A 1 each DC1500 Water, Amplification Grade 6,250 μl DW0991 Not For Medical Diagnostic Use. Description: The Plexor® HY System is a real-time PCR assay to determine the concentration of total human DNA and male human DNA simultaneously in one reaction. The kit contains an internal PCR control (IPC) to test for false-negative results that may occur in the presence of PCR inhibitors and a melt curve function to confirm that the correct product was amplified. Plexor® HY is a sensitive multiplex kit that routinely detects approximately 6.4pg of total DNA. PCR setup is performed at room temperature and is compatible with automated platforms. The system works by measuring a reduction in fluorescent signal during amplification. Amplification of each target uses only two primers, one of which contains both a fluorescent tag and a modified base. As amplification proceeds, fluorescence is reduced by site-specific incorporation of a fluorescent quencher opposite the complementary modified base. The quencher is in close proximity to a fluorescent dye located on the end of the primer, resulting in a reduction of fluorescent signal. After PCR, a melt analysis can be performed to provide an internal control for the final assay design or to expedite troubleshooting. The Plexor® HY System is optimized for use on the Applied Biosystems 7500 and 7500 FAST real-time PCR systems and Stratagene Mx3005P® and Mx3000P® qPCR systems. For information about use with other qPCR instrumentation, contact Promega Technical Services. The Plexor® Analysis Software is available for free download. The unique functions of this software allow you to quickly and easily review data and create reports. Replicate samples are automatically averaged, template amounts are calculated and the necessary volume of DNA is displayed for your optimized STR amplification conditions. Features: • Simultaneously Quantify Autosomal and Y-Chromosome DNA: Less variability, less time, more valuable data. • Consistently and Reproducibly Detect 6.4pg of DNA: If you can’t detect it with Plexor® HY, you can’t detect it with your STR system. • Be Confident in Your Data: Internal positive control and melt-curve analysis guard against false-negative and false-positive results. Storage Conditions: Store at –20°C. RNA Markers Product Size Cat.# RNA Markers 50 μl G3191 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Promega RNA Markers are suitable for size estimation of single-stranded RNA from 0.28–6.58kb in glyoxal or formaldehyde-agarose gels. The RNA Markers consist of a ladder of nine RNA transcripts that are synthesized in vitro from specific templates. The sizes are 281, 623, 955, 1,383, 1,908, 2,604, 3,638, 4,981 and 6,583 bases. The markers are not intended for use in quantitative analysis. After electrophoresis, the fragments can be visualized by ethidium bromide staining. Recommended Loading: 3μl (prepared in formaldehyde/MOPS buffer and separated onto a 1% formaldehyde-agarose gel using MOPS running buffer). Features: • Range (bases): 281–6,583. • Number of Bands: 9. Storage Conditions: Store at –70°C. bases – 6,583 – 4,981 – 3,638 – 2,604 – 1,908 – 1,383 – 955 – 623 – 281 1% formaldehyde-agarose 0775TB09_4A Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 164 For complete and up-to-date product information visit: www.promega.com In Vitro Transcription RiboMAX™ Large Scale RNA Production Systems Product Size Cat.# RiboMAX™ Large Scale RNA Production System—SP6 1 system P1280 RiboMAX™ Large Scale RNA Production System—T7 1 system P1300 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The RiboMAX™ Large Scale RNA Production Systems consistently produce 2–5mg/ml of RNA in a 1ml reaction, about 10- to 20-fold more RNA than is produced with the standard Riboprobe® System transcription reaction. The RiboMAX™ System reactions differ from those of the Riboprobe® Systems in three primary ways: a HEPES (pH 7.5) buffer is used rather than a Tris-HCl (pH 7.9) buffer; rNTP and magnesium concentrations are elevated at levels appropriate for either SP6 or T7 RNA polymerase; and inorganic pyrophosphatase is included in the reaction. RNAs synthesized with the RiboMAX™ System perform better for in vitro translation in rabbit reticulocyte translation systems than RNA synthesized by standard methods. The reduction of components inhibitory to translation may be advantageous for other applications requiring biologically active RNA. Because the RiboMAX™ Systems produce large quantities of RNA, these systems are not recommended for the generation of high-specific-activity RNA probes. Note: Use of the RiboMAX™ System for production of capped transcripts requires separate purchase of the Ribo m7 G Cap Analog (Cat. P1711). Features: • Flexible: Systems are available for use with SP6 and T7 RNA polymerases. • Scalable: Reactions can be scaled up or down to suit varying RNA production requirements. • High-Quality: Synthesis of enhanced, translation-grade RNA. Storage Conditions: Store at –20°C. T7 RiboMAX™ Express Large Scale RNA Production System Product Size Cat.# T7 RiboMAX™ Express Large Scale RNA Production System 1 system P1320 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The T7 RiboMAX™ Express Large Scale RNA Production System is an in vitro transcription system designed for the consistent production of milligram amounts of RNA in a short amount of time. Due to optimization of the enzyme mix and transcription buffer, yields of 5–8.5mg/ml are generated in 30 minutes, compared to 2–4 hours with other commercially available systems. To minimize pipetting steps and errors, the 2X transcription buffer includes all four rNTPs. In addition, the system includes RQ1 RNase-Free DNase for the removal of plasmid template after transcription. Due to the combined 2X buffer and rNTPs, the T7 RiboMAX™ Express System is not recommended for the synthesis of RNA for applications that require capped RNA. For synthesis of capped RNA, please order the standard RiboMAX™ Large Scale RNA Production System—T7 (Cat.# P1300). Features: • Fast: The T7 RiboMAX™ Express System produces milligram amounts of RNA in as little as 30 minutes rather than 2–4 hours as with other commercially available systems. • Convenient: The four rNTPs and 2X transcription buffer have been combined, thus minimizing pipetting errors and setup time. • Flexible: Efficiently transcribes DNA templates of varying sizes. Works with transcripts as short as 21bp. Storage Conditions: Store at –20°C. Riboprobe® Systems Product Size Cat.# Riboprobe® System—SP6 1 system P1420 Riboprobe® System—T3 1 system P1430 Riboprobe® System—T7 1 system P1440 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Riboprobe® Systems are designed for in vitro preparation of high-specific-activity single-stranded RNA probes or microgram quantities of defined RNA transcripts from cloned DNA inserts. These systems contain all components necessary for in vitro transcription from a DNA template (excluding the radioisotope) and also contain RQ1 RNase-Free DNase (Cat.# M6101) for template removal following transcription. Features: • Specific: SP6, T7 and T3 RNA Polymerases are extremely promoterspecific, allowing production of virtually homogeneous RNA using plasmid DNA as a template. • Choice of Enzyme: Systems available with SP6 RNA Polymerase, T7 RNA Polymerase or T3 RNA Polymerase. • Convenient: Includes positive control template for use with SP6, T7 or T3 RNA Polymerase, DNase I for removal of DNA template and Recombinant RNasin® Ribonuclease Inhibitor. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 165 10Nucleic Acid Quantitation and Analysis For complete and up-to-date product information visit: www.promega.com Riboprobe® Combination Systems Product Size Cat.# Riboprobe® Combination System—T3/T7 RNA Polymerase 1 system P1450 Riboprobe® Combination System—SP6/T7 RNA Polymerase 1 system P1460 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Riboprobe® Combination Systems are designed for in vitro preparation of high-specific-activity single-stranded RNA probes or microgram quantities of defined RNA transcripts from cloned DNA inserts. The Riboprobe® Combination Systems include the RNA polymerases, all of the required reagents (excluding radioisotope) for performing transcription reactions in vitro and RQ1 RNase-Free DNase (Cat.# M6101) for removal of the template following transcription. Features: • Flexible: Allows synthesis of RNA corresponding to either the coding or noncoding strand of cloned DNA from a single plasmid construct. • Specific: SP6, T7 and T3 RNA Polymerases are extremely promoterspecific, allowing production of virtually homogeneous RNA using plasmid DNA as a template. • Convenient: Includes positive control template for use with T7, T3 or SP6 RNA polymerase, DNase I for removal of DNA template and Recombinant RNasin® Ribonuclease Inhibitor. Storage Conditions: Store at –20°C. Riboprobe® System Components and Buffers Product Size Conc. Cat.# Riboprobe® System Buffers 1 system P1121 rATP, rCTP, rGTP, rUTP, each at 10mM in separate tubes 0.5 ml P1221 Available Separately RQ1 RNase-Free DNase 1,000 u 1 u/µl M6101 rATP, 10mM 0.5 ml P1132 rCTP, 10mM 0.5 ml P1142 rGTP, 10mM 0.5 ml P1152 rUTP, 10mM 0.5 ml P1162 DTT, Molecular Grade 100 μl 100 mM P1171 Transcription Optimized 5X Buffer 200 μl P1181 Nuclease-Free Water 50 ml P1193 M6101, P1132, P1221, P1142, P1152, P1162, P1171, P1193 For Laboratory Use. P1121, P1181 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Riboprobe® System Buffers are components of the single and combination Riboprobe® Systems. The buffers are also available as standalone products. RQ1 RNase-Free DNase is used to remove template DNA from RNA preparations and is qualified for use in applications where maintaining the integrity of RNA is critical. Product is quality tested to ensure the absence of detectable RNase activity. 10X Reaction Buffer and 10X Stop Buffer included. rATP, rCTP, rGTP and rUTP are provided in individual tubes, qualified for use with the Riboprobe® Systems. The rNTPs are supplied in nuclease-free water. Purity has been verified by HPLC analysis. Features: • Pretested: Reagents are tested with other Riboprobe® System components. rNTPs are tested for functionality with in vitro transcription reactions. • Transcription Qualified: Reagents are qualified for use for in vitro transcription reactions with SP6, T7 or T3 RNA Polymerase. Storage Conditions: Store at –20°C. Ribo m7 G Cap Analog Product Size Conc. Cat.# Ribo m7 G Cap Analog 10 A254 units 40 mM P1711 25 A254 units 40 mM P1712 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Ribo m7 G Cap Analog is a modified ribonucleotide with the structure (m7 G(5´)ppp(5´)G). This methylated ribonucleotide can be incorporated onto the 5´-end of transcripts synthesized in vitro and simulates the 7-methyl guanosine 5´-cap structure found on most eukaryotic mRNA molecules. Features: • Improved Translation: Enhances translation efficiency in many reticulocyte-based reactions. • Effective: Protects RNA from intracellular digestion. • Flexible: Can be used in either the Riboprobe® Systems or RiboMAX™ Large Scale RNA Production Systems. Storage Conditions: Store at –20°C. pGEM® Express Positive Control Template Product Size Cat.# pGEM® Express Positive Control Template 10 μg P2561 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM® Express Positive Control Template is created by linearizing a vector with the restriction enzyme ScaI. The Positive Control Template may be used to monitor in vitro transcription reactions when using the Riboprobe® Systems. Features: • Multi-Sized RNAs: SP6 RNA polymerase produces transcripts of 1,787 and 2,566 bases; T7 RNA polymerase produces transcripts of 1,065 and 2,346 bases; T3 RNA Polymerase produces transcripts of 250 and 1,525 bases. • Flexible: Template can be used with SP6, T7 or T3 RNA polymerases. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 166 For complete and up-to-date product information visit: www.promega.com Transcription Factor Consensus Oligonucleotides Product Size Conc. Cat.# AP1 Consensus Oligonucleotide 175 pmol 1.75 pmol/µl E3201 35 pmol 1.75 pmol/µl E3202 AP2 Consensus Oligonucleotide 175 pmol 1.75 pmol/µl E3211 35 pmol 1.75 pmol/µl E3212 CREB Consensus Oligonucleotide 175 pmol 1.75 pmol/µl E3281 35 pmol 1.75 pmol/µl E3282 NF-κB Consensus Oligonucleotide 175 pmol 1.75 pmol/µl E3291 35 pmol 1.75 pmol/µl E3292 OCT1 Consensus Oligonucleotide 175 pmol 1.75 pmol/µl E3241 35 pmol 1.75 pmol/µl E3242 SP1 Consensus Oligonucleotide 175 pmol 1.75 pmol/µl E3231 35 pmol 1.75 pmol/µl E3232 TFIID Consensus Oligonucleotide 175 pmol 1.75 pmol/µl E3221 35 pmol 1.75 pmol/µl E3222 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The electrophoretic mobility shift assay (EMSA, gel shift, gel retardation) is a relatively simple and sensitive method to investigate protein:DNA interactions. These oligonucleotides contain consensus DNA-binding sites for individual sequence-specific transcription factors. The double-stranded oligonucleotides are designed with 5´ OH blunt ends, making them easily labeled to high specific activity with T4 polynucleotide kinase. Storage Conditions: Store at –20°C. Characteristics of the Consensus Oligonucleotides and Binding Proteins. AP1 (c-jun) 5ʹ-CGC TTG ATG AGT CAG CCG GAA-3ʹ 3ʹ-GCG AAC TAC TCA GTC GGC CTT-5ʹ Forms DNA binding dimers with other members of the AP1 family and with Fos through leucine zipper formation. AP2 5ʹ-GAT CGA ACT GAC CGC CCG CGG CCC GT-3ʹ 3ʹ-CTA GCT TGA CTG GCG GGC GCC GGG CA-5ʹ May act independently as both a TPA- and cAMP-inducible element and can be specifi cally inhibited by large T antigen. CREB 5ʹ-AGA GAT TGC CTG ACG TCA GAG AGC TAG-3ʹ 3ʹ-TCT CTA ACG GAC TGC AGT CTC TCG ATC-5ʹ Confers responsiveness to cAMP; it contains a leucine zipper motif for dimerization, and the associated basic domain is homologous to c-Jun DNA binding domains. NF-κB 5ʹ-AGT TGA GGG GAC TTT CCC AGG C-3ʹ 3ʹ-TCA ACT CCC CTG AAA GGG TCC G-5ʹ Binds to κ light chain enhancer in B cells and is present in a covert cytoplasmic form in non-B cells. OCT1 5ʹ-TGT CGA ATG CAA ATC ACT AGA A-3ʹ 3ʹ-ACA GCT TAC GTT TAG TGA TCT T-5ʹ A member of the OCT family, which is apparently ubiquitous in mammalian cells, the bipartite POU domain includes the POU-box and the homeo domain. SP1 5ʹ-ATT CGA TCG GGG CGG GGC GAG C-3ʹ 3ʹ-TAA GCT AGC CCC GCC CCG CTC G-5ʹ O-glycosylated transcription factor with sequence specifi city conferred through three zinc fi ngers in the DNA binding domain. TFIID 5ʹ-GCA GAG CAT ATA AGG TGA GGT AGG A-3ʹ 3ʹ-CGT CTC GTA TAT TCC ACT CCA TCC T-5ʹ A general transcription factor that exhibits specifi c DNA binding to the TATA box. This factor is associated with RNA polymerase I, II and III activities. 9491LA HeLaScribe® Nuclear Extract in vitro Transcription System Product Size Cat.# HeLaScribe® Nuclear Extract in vitro Transcription System 40 reactions E3110 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The most well characterized cell-free system for in vitro transcription of eukaryotic genes is derived from HeLa cell nuclei. HeLa nuclear extracts can support accurate transcription initiation by RNA polymerase II and exhibit both basal and regulated patterns of RNA polymerase transcription. The nuclear extract is also a source for a variety of transcription factors, DNA-binding proteins and the enzymatic machinery involved in RNA processing. The HeLa Nuclear Extract included in the HeLaScribe® Nuclear Extract in vitro Transcription System is prepared by a modification of the method of Dignam et al. Extracts prepared by this method have been shown to allow transcription from the human transferrin gene promoter and the adenovirus 2 major late promoter. The system also includes all of the necessary components for in vitro transcription as well as a positive control template (CMV immediate early promoter DNA). Features: • Performance-Tested: Tested with cytomegalovirus immediate early gene (CMV) promoter. • Convenient: Available as a complete transcription system or extract alone. • Positive Control: System contains a CMV promoter-positive control template. Storage Conditions: Store at –70°C. Avoid multiple freeze-thaw cycles of the extract. In Vitro Transcription Systems Related Products Product Size Cat.# HeLaScribe® Nuclear Extract in vitro Transcription Grade 40 reactions E3091 160 reactions E3092 HeLaScribe® Nuclear Extract Positive Control DNA 300 ng E3621 rCTP, rATP, rUTP, rGTP, 100mM each 4 × 400 μl E6000 rATP, 100mM 400 μl E6011 rUTP, 100mM 400 μl E6021 rGTP, 100mM 400 μl E6031 rCTP, 100mM 400 μl E6041 E3091, E3092, E3621 For Research Use Only. Not for Use in Diagnostic Procedures. E6000, E6011, E6021, E6031, E6041 For Laboratory Use. Description: HeLaScribe® Nuclear Extract, in vitro Transcription Grade, derived from HeLa cell nuclei, provides a cell-free system for in vitro transcription of eukaryotic genes. Storage Conditions: Store HeLaScribe® Nuclear Extract and Positive Control DNA at –70°C. Store other components at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 167 10Nucleic Acid Quantitation and Analysis For complete and up-to-date product information visit: www.promega.com Primer Extension System—AMV Reverse Transcriptase Product Size Cat.# Primer Extension System—AMV Reverse Transcriptase 40 reactions E3030 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Primer Extension System—AMV Reverse Transcriptase can be used to quantitate specific mRNA transcripts and map the start sites of transcription. An end-labeled oligonucleotide is hybridized to RNA and is used as a primer by reverse transcriptase in the presence of deoxynucleotides. The RNA is thus reverse transcribed into cDNA and is analyzed on a denaturing polyacrylamide gel. The length of the cDNA reflects the number of bases between the labeled nucleotide of the primer and the 5´-end of the RNA; the quantity of cDNA product is related to the amount of targeted RNA. Features: • Convenient: System includes control RNA and primer as well as size markers ready for phosphorylation with T4 Polynucleotide Kinase. Storage Conditions: All components must be stored at –20°C, except for the control RNA, which must be stored at –70°C. Gel Shift Assay Systems Product Size Cat.# Gel Shift Assay Core System 100 reactions E3050 Gel Shift Assay System 100 reactions E3300 Available Separately HeLaScribe® Nuclear Extract, Gel Shift Assay Grade 3 × 40 μl E3521 Gel Shift Binding 5X Buffer 5 × 200 μl E3581 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The gel shift or electrophoretic mobility shift assay provides a simple and rapid method for detecting DNA-binding proteins. This method is widely used to study sequence-specific DNA-binding proteins such as transcription factors. The assay is based on the observation that complexes of protein and DNA migrate through a nondenaturing polyacrylamide gel more slowly than free DNA fragments or double-stranded oligonucleotides. The gel shift assay is performed by incubating a purified protein or a complex mixture of proteins (such as nuclear or cell extract preparations) with a 32P end-labeled DNA fragment containing the putative protein binding site. The reaction products are then analyzed on a nondenaturing polyacrylamide gel. The specificity of the DNA-binding protein for the putative binding site is established by competition experiments using unlabeled DNA fragments or oligonucleotides containing a binding site for the protein of interest or other unrelated DNA sequences. The Core System (Cat.# E3050) includes HeLa Nuclear Extract and SP1 and AP2 Consensus Oligos that can be used as positive controls and serve as a reliable system for obtaining experience with gel shift assays. In addition, the Core System contains T4 Polynucleotide Kinase and Kinase 10X Buffer for labeling oligonucleotides as well as Gel Shift Binding 5X Buffer. Cat.# E3300 contains all of the above plus consensus oligos for AP1, OCT1, CREB, NF-κB, and TFIID. Features: • Positive Controls: The Gel Shift Assay Core System includes a HeLa Nuclear Extract and consensus oligonucleotides for AP2 and SP1. • Versatile: Oligonucleotides can be 5´ end-labeled and used as proteinspecific probes or used as unlabeled oligonucleotides in competition assays. Storage Conditions: Store HeLa Nuclear Extract at –70°C. Store other components at –20°C. RNA Interference RNasin® Ribonuclease Inhibitors Product Size Conc. Cat.# RNasin® Ribonuclease Inhibitor 2,500 u 20–40 u/µl N2111 10,000 u 20–40 u/µl N2115 Recombinant RNasin® Ribonuclease Inhibitor 2,500 u 20–40 u/µl N2511 10,000 u 20–40 u/µl N2515 RNasin® Plus RNase Inhibitor 2,500 u 40 u/µl N2611 10,000 u 40 u/µl N2615 N2111, N2115 For Research Use Only. Not for Use in Diagnostic Procedures. N2511, N2515, N2611, N2615 For Laboratory Use. Description: RNases are ubiquitous and can cause RNA degradation and compromise RNA integrity. Native and Recombinant RNasin® Inhibitors are 50kDa proteins that inhibit RNase A family and human placental RNases by noncovalently binding to RNases in a 1:1 ratio. For downstream applications such as GoScript™ Reverse Transcriptase, AMV/M-MLV reverse transcriptases, SP6, T7/T3 RNA polymerase, and Taq DNA polymerases, Recombinant RNasin® Inhibitor does not inhibit RNase T1, S1 nuclease, RNase from Aspergillus, RNase H, RNase ONE™ Ribonuclease and enzymes. RNasin® Plus RNase Inhibitor is a recombinant mammalian RNase inhibitor that is expressed as a soluble protein in E. coli, allowing easy purification through a combination of ion exchange and hydrophobic interaction chromatography. The protein is capable of inhibiting eukaryotic RNases (e.g., RNase A and RNase B) similarly to human placental RNase inhibitor. RNasin® Plus RNase Inhibitor is tested in RT-PCR and compatible with enzymes such as AMV, M-MLV and ImProm-II™ Reverse Transcriptases or Taq and Tfl DNA Polymerases. RNasin® Plus RNase Inhibitor also is tested and compatible with quantitative, real-time RT-PCR in a TaqMan® assay. RNasin® Plus RNase Inhibitor offers increased resistance to oxidation over the human version of the protein. Two cysteines in the human protein have been identified as especially sensitive to oxidation and react by forming a disulfide bond that can block the active site of the inhibitor. RNasin® Plus, through natural amino acid diversity, lacks the ability to form this site-blocking disulfide. In addition, the new protein has characteristics never before realized, including continued inhibition of RNases above 50°C. Heating solutions of RNasin® Plus and RNase followed by cooling does not result in the reappearance of RNase activity—even when the solution is heated above the denaturation temperature of the RNasin® Plus protein alone. This allows RNasin® Plus to protect RNA species prior to, during and after heating, even at temperatures normally used during first-strand DNA synthesis in RT-PCR. Solutions heated up to 70°C for 15 minutes did not result in RNase reactivation. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 168 For complete and up-to-date product information visit: www.promega.com Features: • Achieve Broad-Spectrum RNase Inhibition: Inhibits common eukaryotic RNases. • Use with Many Enzymes: Does not inhibit SP6, T7 or T3 RNA Polymerase; GoScript™ Reverse Transcriptase, AMV or M-MLV Reverse Transcriptase; or Taq DNA polymerase. • Use in Many Downstream Assays: Functional across wide pH range (pH 5–8). • Choose Native or Recombinant Form: Recombinant form is made in bacteria, minimizing the chances of human nucleic acid contamination. RNasin® Plus RNase Inhibitor also can: • Improve Resistance to Oxidation: Due to natural amino acid diversity, RNasin® Plus lacks the capability to form the active site-blocking disulfide bond that can form in the human protein under oxidative conditions. • Improve Purification: RNasin® Plus is expressed by E. coli as a soluble protein, allowing easy purification by a combination of ion exchange and hydrophobic interaction chromatography. No direct affinity chromatography required. The new process yields a >90% pure protein with no E. coli RNase carryover. • Use with RT-PCR Systems: RNasin® Plus has proven compatible with the Access and AccessQuick™ RT-PCR Systems, M-MLV Reverse Transcriptase, ImProm-II™ Reverse Transcription System and the GoScript™ Reverse Transcription System. Also proven compatible with TaqMan®-based RT-PCR Systems. • Protect During RNA Template Denaturation: Heating mixtures of RNasin® Plus RNase Inhibitor and RNase does not lead to reactivation of the RNase at temperatures even as high as 70°C for 15 minutes. Many RT-PCR protocols call for RNA template denaturation (e.g., 65–70°C for 5–10 minutes) in the presence of the RT primers prior to full RT reaction assembly for maximum sensitivity. You can now include RNasin® Plus at this step. • Protect During Higher Temperature RT Reactions: Add RNasin® Plus RNase Inhibitor during RT reaction assembly and take the reaction to temperatures above 50°C with enzymes like the ImProm-II™ and AMV Reverse Transcriptases. RNases that may be present will not be reactivated at the higher temperature. Storage Conditions: Store at –20°C. T7 RiboMAX™ Express RNAi System Product Size Cat.# T7 RiboMAX™ Express RNAi System 50 × 20µl reactions P1700 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The T7 RiboMAX™ Express RNAi System is an in vitro transcription system designed for producing milligram amounts of double-stranded RNA (dsRNA) in a short amount of time. The dsRNA is free of protein and other contaminants and is suitable for use in RNA interference (RNAi) in both mammalian and nonmammalian systems. The T7 RiboMAX™ Express RNAi System can be used to synthesize short interfering RNAs (siRNAs) of 21bp for use in mammalian systems. siRNAs synthesized in vitro have been demonstrated to be as effective as chemically synthesized siRNAs for inducing RNAi in mammalian cells. In addition, the T7 RiboMAX™ Express RNAi System can be used for the synthesis of dsRNA molecules of approximately 200bp or greater, which can be applied to nonmammalian systems. Two complementary RNA strands are synthesized from DNA template (either plasmid or PCR product). The resulting RNA strands are annealed after the transcription reaction to form dsRNA. Any remaining single-stranded RNA and DNA template are removed with a nuclease digestion step. The dsRNA is then purified by isopropanol precipitation and can be introduced into the organism of choice for RNAi applications. Features: • Save Time: The T7 RiboMAX™ Express RNAi System produces milligram amounts of RNA in as little as 30 minutes. • Minimize Pipetting Errors: The four rNTPs and 2X transcription buffer have been combined, thus minimizing pipetting errors and setup time. Storage Conditions: Store all components at –20°C, except RNase A, which should be stored at 22–25°C after the initial thaw. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 169 10Nucleic Acid Quantitation and Analysis For complete and up-to-date product information visit: www.promega.com psiCHECK™-2 Vector Product Size Cat.# psiCHECK™-2 Vector 20 μg C8021 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The psiCHECK™-2 Vector is designed to provide a quantitative and rapid approach for initial optimization of RNA interference (RNAi). The vector enables monitoring of changes in expression of a target gene fused to a reporter gene. Renilla luciferase is used as the primary reporter gene, and the gene of interest is cloned into a multiple cloning region located downstream of the Renilla translational stop codon. Initiation of the RNAi process by synthetic siRNAs or in vivo-expressed shRNAs toward a gene of interest results in cleavage and subsequent degradation of the fusion mRNA. Measuring decreases in Renilla activity provides a convenient way of monitoring the RNAi effect. In comparison with other fusion approaches (e.g., GFP or flag-tags), the Renilla luciferase approach offers more convenient and rapid quantitation with higher sensitivity. The psiCHECK™-2 Vector contains a second reporter gene, firefly luciferase, and is designed for endpoint lytic assays. Introduction of firefly luciferase in the psiCHECK™-2 Vector allows normalization of Renilla luciferase expression, achieving robust and reproducible results. Features: • Save Money: Quantitation is performed with a common luminometer; no need to purchase expensive equipment. • Save Time: No requirement for labor-intensive, time-consuming assays or waiting for phenotypic changes. • Convenient: No requirement for transfection normalization when using the psiCHECK™-2 Vector. Storage Conditions: Store at –20°C. 4345MA10_3A T7 Promoter hRluc SV40 early enhancer/ promoter Ampr ori KpnI 58 BamHI 4451 Synthetic poly(A) HSV-TK promoter hluc+ SV40 Late poly(A) BglII 1 NheI 684 psiCHECK™-2 Vector (6273bp) 1640 SgfI 1643 XhoI 1663 PmeI 1674 NotI RT-PCR and RT-qPCR GoTaq® Real-Time qPCR and RT-qPCR Systems for Probe-Based Detection Product Size Cat.# GoTaq® Probe qPCR Master Mix 2 ml A6101 10 ml A6102 GoTaq® Probe 2-Step RT-qPCR System 2 ml A6110 GoTaq® Probe 1-Step RT-qPCR System 2 ml A6120 12.5 ml A6121 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GoTaq® Probe qPCR Master Mix is optimized for quantitative PCR assays in the hydrolysis probe detection format. The master mix is provided as a ready-to-use, stabilized 2X formulation that includes all components for qPCR (except template, primers and probe). This master mix does not contain a reference dye; however, a separate tube of carboxy-X-rhodamine (CXR) reference dye is included with this system, allowing users to add reference dye to amplification reactions if desired. The GoTaq® Probe qPCR Master Mix provides resistance to a wide range of PCR inhibitors. This formulation uses antibody-mediated hot-start chemistry, allowing reaction setup to be performed at room temperature. The master mix also employs rapid hot-start activation and processive enzymes, making it compatible with both standard and fast instrument cycling programs. The GoTaq® Probe 2-Step RT-qPCR System is optimized for quantitative PCR assays in the hydrolysis probe detection format. The system facilitates detection and relative quantification of RNA expression levels via a two-step RT-qPCR method using integrated components: • GoScript™ Reverse Transcription System • GoTaq® Probe qPCR Master Mix The GoScript™ Reverse Transcription System includes an optimized reaction buffer and reverse transcriptase that enable efficient synthesis of first-strand cDNA in preparation for PCR amplification. The cDNA product may be added directly to downstream qPCR amplification reactions. The GoTaq® Probe 1-Step RT-qPCR System is optimized for quantitative PCR assays in the hydrolysis probe detection format. The system enables detection and relative quantification of RNA expression levels using a one-step RT-qPCR method, combining GoScript™ Reverse Transcriptase and GoTaq® Probe qPCR Master Mix in single-step real-time amplification reactions. The GoScript™ RT Mix for 1-Step RT-qPCR (50X) combines optimized amounts of GoScript™ Reverse Transcriptase, RNasin® Plus RNase Inhibitor, dUTP and additives to enhance single-step reactions. Features: • Superior Performance: Sensitive detection on any real-time instrument. • Enhanced Stability: Room-temperature setup makes the system suitable for automation and high-throughput detection. • Versatility: Compatible with both fast and standard cycling methods. • Performance Guarantee: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. Storage Conditions: Store all components between –30°C and –10°C. Protect components from light at all times. For best results, mix thawed solutions gently to minimize aeration and foaming, and keep on ice. For short-term storage and frequent use, the GoTaq® qPCR Master Mix, 2X, may be kept at 2–8°C for up to 3 months if protected from light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 170 For complete and up-to-date product information visit: www.promega.com GoTaq® Real-Time qPCR and RT-qPCR Systems for Dye-Based Detection Product Size Cat.# GoTaq® qPCR Master Mix 5 ml A6001 25 ml A6002 GoTaq® 2-Step RT-qPCR System 5 ml A6010 GoTaq® 1-Step RT-qPCR System 5 ml A6020 Available Separately CXR Reference Dye 100 μl C5411 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GoTaq® qPCR Master Mix is a ready-to-use 2X master mix for use in real-time quantitative PCR (qPCR and RT-qPCR). The system contains BRYT Green® Dye, a novel fluorescent DNA-binding dye with minimal PCR inhibition for maximum PCR efficiency and greater fluorescence enhancement upon binding to double-stranded DNA than SYBR® Green I. Containing the GoTaq® Hot Start Polymerase, optimized buffer and proprietary dye, the GoTaq® qPCR Master Mix provides robust real-time PCR with earlier quantification cycle values and broad-range detection for increased reliability, reproducibility and sensitivity. The GoTaq® 2-Step RT-qPCR System is a reagent system for quantitative analysis of RNA using a two-step reverse transcription-quantitative PCR (RT-qPCR) protocol. The components and protocol allow robust, reliable cDNA synthesis of a full range of rare and abundant transcripts, even in the presence of inhibitors, using the GoScript™ Reverse Transcription System and quantification using the GoTaq® qPCR Master Mix. The GoTaq® 1-Step RT-qPCR System is a reagent system for quantitative analysis of RNA using a one-step reverse transcription-quantitative PCR (RT-qPCR) protocol in a single tube. The BRYT Green® Dye and optimized buffer formulations improve data accuracy and sensitivity of low-level targets. Features: • Brighter Signal: Sensitive detection for earlier quantification of low- and high-copy-number targets. • Enhanced Stability: Room-temperature setup makes the systems suitable for automation and high-throughput detection. • Versatility: Compatible with both fast and standard qPCR cycling methods. • Robustness: High-efficiency, full-length cDNA synthesis in the presence of inhibitors. • Performance Guarantee: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. Storage Conditions: Upon arrival, store all components at –30°C to –10°C, protected from light. For immediate use, components may be stored at 2–8°C, protected from light, for up to 3 months. M-MLV Reverse Transcriptase Product Size Conc. Cat.# M-MLV Reverse Transcriptase 10,000 u 200 u/µl M1701 50,000 u 200 u/µl M1705 M-MLV Reverse Transcriptase Buffer Pack 2 × 1 ml M5313 For Laboratory Use. Description: Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is an RNA-dependent DNA polymerase that can be used in cDNA synthesis with long messenger RNA templates (>5kb). The enzyme is a product of the pol gene of M-MLV and consists of a single subunit with a molecular weight of 71kDa. The RNase H activity of M-MLV RT is weaker than that of the commonly used Avian Myeloblastosis Virus (AMV) reverse transcriptase. Features: • Provided with 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 375mM KCl, 15mM MgCl2 , 50mM DTT. • Heat-Inactivated: M-MLV RT is inactivated by heating at 70°C for 10 minutes. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 171 10Nucleic Acid Quantitation and Analysis For complete and up-to-date product information visit: www.promega.com M-MLV Reverse Transcriptase, RNase H Minus Product Size Conc. Cat.# M-MLV Reverse Transcriptase, RNase H Minus 10,000 u 100–200 u/µl M5301 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Moloney Murine Leukemia Virus Reverse Transcriptase, RNase H Minus (M-MLV RT [H–]), is an RNA-dependent DNA polymerase that can be used in cDNA synthesis with long messenger RNA templates (>5kb). This form of M-MLV Reverse Transcriptase is genetically altered to remove the associated RNase H activity. Although many researchers are successful in using M-MLV RT (H+) for analytical and some preparative cDNA applications, reverse transcriptases lacking RNase H activity provide another option to prepare long cDNAs and libraries containing a high percentage of full-length cDNA. Features: • RNase H Minus: Provides optimal conditions to prepare full-length cDNA from long RNA templates. • Provided with 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 375mM KCl, 15mM MgCl2 , 50mM DTT. • Heat-Inactivated: M-MLV RT is inactivated by heating at 70°C for 10 minutes. Storage Conditions: Store at –20°C. M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Product Size Cat.# M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant 2,500 u M3681 10,000 u M3682 50,000 u M3683 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Moloney Murine Leukemia Virus Reverse Transcriptase, RNase H Minus (M-MLV RT [H–]), Point Mutant, is an RNA-dependent DNA polymerase that can be used for cDNA synthesis with long RNA templates (>5kb). The lack of RNase H activity is beneficial for this application, as RNase H can start to degrade templates when incubation times are long, as they may be when synthesizing long cDNAs. Although many researchers are successful in using M-MLV RT (H+) for analytical and some preparative cDNA applications, reverse transcriptases lacking RNase H activity provide another option to prepare long cDNAs and libraries containing a high percentage of full-length cDNA. Features: • RNase H Minus: Provides optimal conditions to prepare full-length cDNA from long RNA templates. • Temperature Stability: Thermostability of this point mutant minimizes problems associated with RNA secondary structure. • Increased Polymerase Activity: M-MLV RT (H–), Point Mutant, gives higher yields of cDNA compared with the deletion mutant (Cat.# M5301). • Provided with 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 375mM KCl, 15mM MgCl2 , 50mM DTT. • Broad Working Range: More tolerance to variations in enzyme and substrate concentrations means improved consistency in performance. Storage Conditions: Store at –20°C. AMV Reverse Transcriptase Product Size Conc. Cat.# AMV Reverse Transcriptase 300 u 10 u/µl M5101 1,000 u 10 u/µl M5108 AMV Reverse Transcriptase (HC) 600 u 20–25 u/µl M9004 For Laboratory Use. Description: Avian Myeloblastosis Virus Reverse Transcriptase (AMV RT) catalyzes DNA polymerization using template DNA, RNA or RNA:DNA hybrids. The enzyme requires a primer (DNA primers are more efficient than RNA primers) as well as Mg2+ or Mn2+. The enzyme possesses an intrinsic RNase H activity. Both nonionic detergents and sulfhydryl compounds stabilize the enzyme activity in vitro. Features: • High Concentration: Cat.# M9004 contains 600 units of AMV RT at 20–25u/μl. • 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 250mM KCl, 50mM MgCl2 , 2.5mM spermidine, 50mM DTT. • Temperature Stability: AMV RT is the preferred reverse transcriptase for templates with high secondary structure due to its stability at higher reaction temperatures (37–58°C). Storage Conditions: Store at –20°C. GoScript™ Reverse Transcription System Product Size Cat.# GoScript™ Reverse Transcription System 50 reactions A5000 100 reactions A5001 Available Separately GoScript™ Reverse Transcriptase 100 reactions A5003 500 reactions A5004 GoScript™ Reverse Transcription Mix, Oligo(dT) 50 reactions A2790 100 reactions A2791 GoScript™ Reverse Transcription Mix, Random Primers 50 reactions A2800 100 reactions A2801 A5000, A5001, A2790, A2791, A2800, A2801 For Research Use Only. Not for Use in Diagnostic Procedures. A5003, A5004 For Laboratory Use. Description: The GoScript™ Reverse Transcription System includes a reverse transcriptase and a specialized set of reagents for efficient synthesis of first-strand cDNA optimized for quantitative PCR amplification. GoScript™ Reverse Transcriptase uses M-MLV Reverse Transcriptase and state-of-the-art buffer technology to deliver robust, reliable cDNA synthesis of a full range of rare and abundant transcripts, even in the presence of inhibitors. GoScript™ Reverse Transcriptase is qualified for use in qPCR, including GoTaq® qPCR systems. Features: • Available as a standalone enzyme, a complete reverse transcription kit or as a master mix with Oligo(dT) or Random Primers. • Achieve sensitive transcription of both high-copy and low-copy messages. • Transcribe short and long transcripts; process through secondary structure. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 172 For complete and up-to-date product information visit: www.promega.com Reverse Transcription System Product Size Cat.# Reverse Transcription System 100 reactions A3500 Available Separately Size Conc. Cat.# Magnesium Chloride Solution 1.5 ml 25 mM A3511 Reverse Transcription 10X Buffer 1.4 ml A3561 A3500 For Research Use Only. Not for Use in Diagnostic Procedures. A3511, A3561 For Laboratory Use. Description: The Reverse Transcription System provides reagents to efficiently reverse transcribe RNA into cDNA in 15 minutes. The cDNA prepared from each reaction may be used directly in multiple PCR amplifications using Taq DNA polymerase. The AMV Reverse Transcriptase synthesizes single-stranded cDNA from total or poly(A)+ RNA. Both Oligo(dT)15 and Random Primers are included, allowing cDNA synthesis from virtually any RNA source. The system contains sufficient reagents for 100 cDNA synthesis reactions, processing 1μg of RNA per reaction. Each cDNA synthesis reaction can be divided and used in up to 20 separate PCR amplifications. A polyadenylated 1.2kb RNA transcript is provided as a control template for cDNA synthesis. Features: • Speed: Efficiently reverse transcribe poly(A)+ mRNA or total RNA in 15 minutes. • Convenience: PCR-compatible components are provided in optimized volumes for 100 reactions. • Positive Controls: A polyadenylated RNA transcript is provided to help troubleshoot RT-PCR parameters. Storage Conditions: Store at –20°C. Store Positive Control RNA at –70°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 173 11 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Epigenetics Research Kits and Reagents Methylation Analysis 174 Cell-Based and Biochemical Assays 176 Protein Analysis and Complex Purification 181 Epigenetics Research Kits and Reagents Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 174 For complete and up-to-date product information visit: www.promega.com Methylation Analysis MethylEdge™ Bisulfite Conversion System Product Size Cat.# MethylEdge™ Bisulfite Conversion System 50 reactions N1301 Available Separately Methylated Human Control 5 μg N1231 Converted Methylated Human Control 1 μg N1221 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MethylEdge™ Bisulfite Conversion System provides a rapid, efficient method to perform bisulfite conversion with minimal DNA fragmentation in less than two hours. The rapid protocol and complete conversion mean that you can produce completely converted DNA ready for downstream assays with minimal preparation and hands-on time. Features: • Effective Conversion Reagents: High-efficiency DNA conversion. • Rapid Protocol: Time savings compared to other conversion systems. • Intact DNA: Robust conversion of DNA with reduced DNA fragmentation. • Room-Temperature, Ready-to-Use Reagents: Convenient system configuration allows room-temperature storage and minimal up-front preparation. Storage Conditions: Store the MethylEdge™ Bisulfite Conversion System at 22–25°C (room temperature). Store the Methylated Human Control at 2–10°C. Store the Converted Methylated Human Control at –30 to –10°C. Succinate-Glo™ JmjC Demethylase/ Hydroxylase Assay Product Size Cat.# Succinate-Glo™ JmjC Demethylase/Hydroxylase Assay 1,000 assays V7990 10,000 assays V7991 For Research Use Only. Not for Use in Diagnostic Procedures. Description: JumonjiC domain-containing histone lysine demethylases (JMJCs) play a pivotal role in determining the epigenetic status of the genome by counteracting the activities of histone lysine methyltransferases. These enzymes act as erasers by catalyzing the removal of methyl marks from specific lysine sites in histones, leading to either transcriptional repression or activation of target genes. The Succinate-Glo™ JmjC Demethylase/Hydroxylase Assay rapidly detects succinate formation in JumonjiC histone demethylase and Fe(II)/α-ketoglutarate-dependent dioxygenase reactions. The assay uses the reaction product, succinate, to form ATP, which drives a bioluminescent reaction to produce a signal proportional to the original demethylase/ hydroxylase activity. Features: • Easy to use add-and-read assay format. • Universal assay can be used with any succinate-producing enzyme. • Optimized for screening applications; low false hits. Storage Conditions: Store complete kit at less than –65°C. Alternatively, store the Succinate-Glo™ Solution at less than –65°C and all other components at –30°C to –10°C. Minimize freeze-thaw cycles. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 175 11Epigenetics Research Kits and Reagents For complete and up-to-date product information visit: www.promega.com MTase-Glo™ Methyltransferase Assay Product Size Cat.# MTase-Glo™ Methyltransferase Assay 400 assays V7601 2,000 assays V7602 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MTase-Glo™ Assay is a bioluminescence-based assay that can be used to monitor the activities of methyltransferases (MTases) and their modulation by small molecules in a wide range of plate formats. The assay is well suited for high-throughput screening applications. The assay monitors formation of the reaction product S-adenosyl homocysteine (SAH) and can detect changes in activity of a broad range of methyltransferases, including DNA, protein, RNA and small molecule methyltransferases. The MTase-Glo™ Assay can be used for all classes of protein methyltransferases (lysine and arginine) and with different types of substrates (peptides, large proteins and even nucleosomes) to determine the specificity of these enzymes and their substrate requirements. After the methyltransferase reaction is complete, the MTase-Glo™ Reagent is added to convert SAH to ADP. The MTase-Glo™ Detection Solution is then added to convert ADP to ATP, which is detected via a coupled luciferase reaction. Luminescence is measured using a plate-reading luminometer and can be correlated to SAH concentration using an SAH standard curve. The half-life of the luminescent signal is greater than 4 hours. This extended signal half-life eliminates the need for luminometers with injectors and allows batch-mode processing of multiple plates. Features: • Easily Monitor Methyltransferase Activity: Simple add-and-read format makes it easy to monitor methyltransferase activity. • Use Any Methyltransferase: Can be used with any methyltransferase that uses S-adenosyl methionine (SAM) as the methyl group donor. • Experience Low False Hits: Bioluminescent assay optimized for screening applications; no concerns about fluorescence interference. • Use Less Enzyme: Low background and large dynamic range of assay produces excellent signal-to-noise ratios at low enzyme concentrations. • Use Natural Substrates: No need to modify substrates, which can lead to kinetic artifacts. • Enjoy Flexibility: No interference from high concentrations of SAM in assay. Storage Conditions: Store the MTase-Glo™ Methyltransferase Assay at –70°C. Before use, thaw all components completely at room temperature except for the 10X MTase-Glo™ Reagent, which should be thawed on ice. Mix thawed reagents thoroughly before use, but do not vortex. Store the thawed 10X MTase-Glo™ Reagent on ice until ready to use. After the first use, dispense the 10X MTase-Glo™ Reagent into single-use aliquots and store at –70°C. Prepare working dilutions of the MTase-Glo™ Reagent immediately before use, and prepare only enough for each experiment; do not freeze the diluted reagent. After the first use, dispense the thawed MTase-Glo™ Detection Solution into single-use aliquots and store at –20°C. See the product label for expiration date. Methylation-Specific Restriction Enzymes Product Size Conc. Cat.# HpaII 1,000 u 10 u/µl R6311 5,000 u 10 u/µl R6315 Mbol 200 u 8–12 u/µl R6711 Mspl 2,000 u 10 u/µl R6401 10,000 u 10 u/µl R6405 For Research Use Only. Not for Use in Diagnostic Procedures. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 176 For complete and up-to-date product information visit: www.promega.com Cell-Based and Biochemical Assays NanoBRET™ Target Engagement BET BRD Assays Product Size Cat.# NanoBRET™ TE Intracellular BET BRD Assay 100 assays N2130 1,000 assays N2131 NanoBRET™ TE Intracellular BET BRD Detection Reagents 10,000 assays N2140 NanoBRET™ TE BET BRD DNA Bundle 1 each N2150 NanoBRET™ TE Intracellular BET BRD Complete Kit 1,000 assays N2180 Available Separately Size Conc. Cat.# Intracellular TE Nano-Glo® Substrate/Inhibitor 1,000 assays N2160 10,000 assays N2161 Tracer Dilution Buffer 50 ml N2191 Transfection Carrier DNA 5 × 20 µg 1 µg/µl E4881 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The NanoBRET™ Target Engagement (TE) Intracellular BET BRD Assay measures compound binding at select BET bromodomain target proteins within intact cells. This target engagement assay is based on the NanoBRET™ System, an energy transfer technique designed to measure molecular proximity in living cells. The NanoBRET™ TE BET BRD Assay analyzes the apparent affinity of test compounds by competitive displacement of a NanoBRET™ tracer reversibly bound to a NanoLuc® BET BRD fusion protein in cells. The NanoBRET™ TE Assay uses four key components: An expressed cellular target protein that is fused to the bright NanoLuc® luciferase; a cell-permeable fluorescent tracer that specifically binds to the target protein; a substrate for NanoLuc® luciferase; and a cell-impermeable inhibitor for NanoLuc® luciferase. Bioluminescence resonance energy transfer (BRET) is achieved by transferring the luminescent energy from NanoLuc® luciferase to the fluorescent tracer that is bound to the target protein-NanoLuc® fusion. Compounds that are applied to the cells and specifically engage the intracellular target protein-NanoLuc® fusion will result in a decrease in BRET. To ensure accurate assessment of intracellular target engagement, a NanoLuc® inhibitor is used to mitigate any extracellular NanoLuc® signal that may arise from cells compromised during handling, while not adversely affecting NanoLuc® luciferase expressed within healthy living cells. Features: • Measure Target Engagement in Live Cells: Measure BET BRD-test compound affinity and residence time in live cells; more physiologically relevant information. • Directly Measure Residence Time: Compound and tracer compete directly for the binding site. • Use Full-Length Protein: Assays rely on full-length proteins that are similar to the native forms. • Express Target Proteins at Low Levels: Expression levels are comparable to endogenous proteins. • Enjoy Convenience: Fully optimized assays provide a sensitive method to assess compound affinity, permeability and duration of drug-target interactions; proven performance on GloMax® Discover System. Storage Conditions: Store the entire NanoBRET™ TE Intracellular BET BRD Assay at less than –65°C. Alternatively, store the NanoBRET™ Intracellular TE BET BRD Tracer, 0.1mM, at less than –65°C and all other components at less than –10°C. Avoid multiple freeze-thaw cycles of the vector components. Store NanoBRET™ Intracellular TE BET BRD Tracer, 0.1mM, NanoBRET™ Nano-Glo® Substrate and Extracellular NanoLuc® Inhibitor protected from light. NanoBRET™ Target Engagement HDAC Assays Product Size Cat.# NanoBRET™ TE Intracellular HDAC Assay 100 assays N2080 1,000 assays N2081 NanoBRET™ TE Intracellular HDAC Detection Reagents 10,000 assays N2090 NanoBRET™ TE HDAC DNA Bundle 1 each N2120 NanoBRET™ TE Intracellular HDAC Complete Kit 1,000 assays N2170 Available Separately Size Conc. Cat.# Intracellular TE Nano-Glo® Substrate/Inhibitor 1,000 assays N2160 10,000 assays N2161 Tracer Dilution Buffer 50 ml N2191 Transfection Carrier DNA 5 × 20 µg 1 µg/µl E4881 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The NanoBRET™ Target Engagement (TE) Intracellular HDAC Assay measures compound binding at select HDAC target proteins within intact cells. This target engagement assay is based on the NanoBRET™ System, an energy transfer technique designed to measure molecular proximity in living cells. The NanoBRET™ TE HDAC Assay analyzes the apparent affinity of test compounds by competitive displacement of a NanoBRET™ tracer reversibly bound to a NanoLuc® HDAC fusion protein in cells. The NanoBRET™ TE Assay uses four key components: An expressed cellular target protein that is fused to the bright NanoLuc® luciferase; a cell-permeable fluorescent tracer that specifically binds to the target protein; a substrate for NanoLuc® luciferase; and a cell-impermeable inhibitor for NanoLuc® luciferase. Bioluminescence resonance energy transfer (BRET) is achieved by transferring the luminescent energy from NanoLuc® luciferase to the fluorescent tracer that is bound to the target protein-NanoLuc® fusion. Compounds that are applied to the cells and specifically engage the intracellular target protein-NanoLuc® fusion will result in a decrease in BRET. To ensure accurate assessment of intracellular target engagement, a NanoLuc® inhibitor is used to mitigate any extracellular NanoLuc® signal that may arise from cells compromised during handling, while not adversely affecting NanoLuc® luciferase expressed within healthy living cells. Features: • Measure Target Engagement in Live Cells: Measure HDAC-test compound affinity and residence time in live cells; more physiologically relevant information. • Directly Measure Residence Time: Compound and tracer compete directly for the binding site. • Use Full-Length Protein: Assays rely on full-length proteins that are similar to the native forms. • Express Target Proteins at Low Levels: Expression levels are comparable to endogenous proteins. • Enjoy Convenience: Fully optimized assays provide a sensitive method to assess compound affinity, permeability and duration of drug-target interactions; proven performance on GloMax® Discover System. Storage Conditions: Store the entire NanoBRET™ TE Intracellular HDAC Assay at less than –65°C. Alternatively, store the NanoBRET™ Intracellular TE HDAC Tracer, 0.1mM, at less than –65°C and all other components at less than –10°C. Avoid multiple freeze-thaw cycles of the vector components. Store NanoBRET™ Intracellular TE HDAC Tracer, 0.1mM, NanoBRET™ Nano-Glo® Substrate and Extracellular NanoLuc® Inhibitor protected from light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 177 11Epigenetics Research Kits and Reagents For complete and up-to-date product information visit: www.promega.com HDAC-Glo™ Class IIa and HDAC-Glo™ 2 Assays Product Size Cat.# HDAC-Glo™ Class IIa Assay 10 ml G9560 HDAC-Glo™ 2 Assay 10 ml G9590 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HDAC-Glo™ Class IIa and HDAC-Glo™ 2 Assays are single-reagent-addition, homogeneous, luminescent assays that measure the relative activity of histone deacetylase (HDAC) Class IIa and Class I enzyme 2, respectively, from cells, extracts or purified enzyme sources. The assays use an acetylated, live-cell-permeant, luminogenic peptide substrate that can be deacetylated by HDAC activities. Deacetylation of the peptide aminoluciferin substrate is measured using a coupled enzymatic system in which a protease in the Developer Reagent cleaves the deacetylated peptide from the aminoluciferin substrate, releasing aminoluciferin, which is quantified in a reaction using Ultra-Glo™ Recombinant Luciferase (firefly). The signal from the assay reaction can be measured within 15–45 minutes after reagent addition with no sample manipulation. The HDAC-mediated luminescent signal is persistent, with a half-life of greater than 2 hours, allowing batch processing of multiwell plates. Features: • Provide Relevant Insight into Compound Effects in Biological Setting: Make better decisions about your compound library early in drug screening. • Panel of Screening Tools Allows Comprehensive Screening of HDAC Activity: Easy detection of Class IIa or Isozyme 2 in the same, convenient platform. • Highly Sensitive: Dynamic range 10- to 100-fold higher than comparable fluorescence methods. • Flexible Format: Determine inhibitor performance in both biochemical and predictive cell-based formats using viable cells or in vitro with cell extracts or purified recombinant enzymes. • Simple Measurement of Deacetylating Activities: Easy implementation from benchtop to screening with a single-reagent-addition, homogeneous, add-mix-measure protocol. • Fast Data Acquisition in as Little as 15 Minutes: Achieve maximum signal in as little as 15 minutes with persistent glow-type steady-state signal, making the protocol amenable to automation in high-throughput formats and compatible with luminometers without injectors. • Robust Detection: Minimize assay interference often encountered with fluorescent assays with robust, bioluminescence-based detection. This technology also allows you to multiplex with cell-health assays, offering more biologically relevant data within a predictive, cell-based context. Storage Conditions: Store at –30°C to –10°C protected from light. HDAC-Glo™ I/II Assays and Screening Systems Product Size Cat.# HDAC-Glo™ I/II Assay 10 ml G6420 5 × 10 ml G6421 100 ml G6422 HDAC-Glo™ I/II Screening System 10 ml G6430 5 × 10 ml G6431 Available Separately Size Conc. Cat.# HeLa Nuclear Extract 10 μl 5 mg/ml G6570 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HDAC-Glo™ I/II Assays and Screening Systems are singlereagent-addition, homogeneous, luminescent assays that measure the relative activity of histone deacetylase (HDAC) class I and II enzymes from cells, extracts or purified enzyme sources. The assays use an acetylated, live-cell-permeant, luminogenic peptide substrate that can be deacetylated by HDAC activities. Deacetylation of the peptide aminoluciferin substrate is measured using a coupled enzymatic system in which a protease in the Developer Reagent cleaves the deacetylated peptide from the aminoluciferin substrate, releasing aminoluciferin, which is quantified in a reaction using Ultra-Glo™ recombinant firefly luciferase. The assay reaction is typically complete within 15–45 minutes with no sample manipulation. The HDAC-mediated luminescent signal is persistent, with a halflife of greater than 3 hours, allowing batch processing of multiwell plates. The HDAC assay is broadly useful for class I and II enzymes. The Trichostatin A, included in the HDAC-Glo™ I/II Screening Systems, is a known pan HDAC inhibitor that may be used as a positive control inhibitor. The Trichostatin A is supplied at a concentration of 10mM in DMSO. The HeLa Nuclear Extract, included in the HDAC-Glo™ I/II Screening Systems or available separately, may be used as a source of histone deacetylase activity. The diluted extract also can be used as an HDAC-Glo™ I/II Assay chemistry control. Features: • Simple Measurement of Deacetylating Activities: Use a singlereagent-addition, homogeneous, add-mix-measure protocol for easy implementation from benchtop to screening. • Highly Sensitive: Obtain 10- to 100-fold higher sensitivity than comparable fluorescence methods. • Fast Data Acquisition: Achieve maximum signal in as little as 15 minutes with persistent glow-type steady-state signal, making the protocol amenable to automation in high-throughput formats and compatible with luminometers without injectors. • Flexible to Sample Type: Use with viable cells, extracts or purified recombinant enzyme sources. Storage Conditions: Store the HDAC-Glo™ Assay components at –30°C to –10°C protected from light. Store HeLa Nuclear Extract at –70°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 178 For complete and up-to-date product information visit: www.promega.com SIRT-Glo™ Assays and Screening Systems Product Size Cat.# SIRT-Glo™ Assay 10 ml G6450 Available Separately Size Conc. Cat.# HeLa Nuclear Extract 10 μl 5 mg/ml G6570 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The SIRT-Glo™ Assay is a single-reagent-addition, homogeneous, luminescent assay that measures the relative activity of the NAD+-dependent histone deacetylase (HDAC) class III enzymes (sirtuins; SIRTs) from purified enzyme sources. The assay uses an acetylated, luminogenic peptide substrate that can be deacetylated by SIRT activities. Deacetylation of the peptide aminoluciferin substrate is measured using a coupled enzymatic system in which a protease in the Developer Reagent cleaves the deacetylated peptide from the aminoluciferin substrate, releasing aminoluciferin, which is quantified in a reaction using Ultra-Glo™ recombinant firefly luciferase. The assay reaction is typically complete within 15–45 minutes with no sample manipulation. The SIRT-mediated luminescent signal is persistent with a halflife of greater than 3 hours, allowing batch processing of multiwell plates. The SIRT-Glo™ Assay is broadly useful for NAD+-dependent Sirtuin enzymes. Nicotinamide, included in the SIRT-Glo™ Screening Systems, is a known inhibitor of SIRTs and used as a positive control inhibitor. Nicotinamide is supplied at a concentration of 1M in SIRT-Glo™ Buffer. The HeLa Nuclear Extract, included in the SIRT-Glo™ Screening Systems or available separately, may be used as an assay chemistry control. HeLa Nuclear Extract is supplied at a concentration of 5mg/ml. Features: • Simple Measurement of Deacetylating Activities: Use a singlereagent-addition, homogeneous, add-mix-measure protocol for easy implementation from benchtop to screening. • Highly Sensitive: Achieve 10- to 100-fold higher sensitivity than comparable fluorescence methods. • Fast Data Acquisition: Measure maximum signal in as little as 10–15 minutes with persistent glow-type steady-state signal. Storage Conditions: Store the SIRT-Glo™ Assay components at –20°C. Store HeLa Nuclear Extract at –70°C. RealTime-Glo™ MT Cell Viability Assay Product Size Cat.# RealTime-Glo™ MT Cell Viability Assay 100 reactions G9711 10 × 100 reactions G9712 1,000 reactions G9713 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The RealTime-Glo™ MT Cell Viability Assay is a nonlytic, homogeneous, bioluminescent method to determine in real time the number of viable cells in culture by measuring reducing potential and thus metabolism (MT). The assay involves adding NanoLuc® luciferase and a cell-permeant proNanoLuc® substrate to cells in culture. Viable cells reduce the pro-substrate to generate a substrate for NanoLuc® luciferase. This substrate diffuses from cells into the surrounding culture medium, where it is rapidly used by the NanoLuc® enzyme to produce a luminescent signal. The signal correlates with the number of viable cells, making the assay well suited for cytotoxicity studies. The reagent is stable and nontoxic to cells for up to 72 hours. No cell washing, removal of medium or further reagent addition is required to determine the number of viable cells. The nonlytic nature of this assay enables cells to be monitored over time in the same well, reducing the amount of cells used and cell culture costs, and allowing downstream applications, including assay multiplexing and nucleic acid analysis. Features: • Real-Time Cell Viability Measurements: Monitor cell viability in real time to determine onset of toxicity, analyze potency versus efficacy over time and analyze differential cell growth with a simple, plate-based protocol. • Superior Sensitivity: The bioluminescent assay provides a greater signal-to-background ratio and higher sensitivity in less time compared to colorimetric or fluorometric viability assays based on reducing potential. • Assay Setup Flexibility: Perform real-time measurements by adding reagents when cells are plated, when test compound is added to the cells or at any time point when cell viability measurements are needed. Alternatively, set up the assay for an endpoint cell viability determination. • Nonlytic Assay Format: The RealTime-Glo™ MT Cell Viability Assay does not require cell lysis. Use cells to multiplex with other luminescent or fluorescent assays without the need for special filters or use cells later in a variety of downstream applications. This means you will use less sample and obtain more informative data points per sample. • Well Established Marker of Cell Viability: The assay chemistry is based on the reducing potential of the cell, which is a trusted metabolic marker of cell viability. • Compatibility with Automation: The assay is compatible with automated and high-throughput protocols. Reactions are scalable and can be performed at low volumes in 96-, 384- and 1,536-well plates. Storage Conditions: Store the RealTime-Glo™ MT Cell Viability Assay reagents at –20°C, protected from light. Avoid prolonged exposure to light of the MT Cell Viability Substrate, 1,000X. Avoid multiple freeze-thaw cycles. See product label for expiration date. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 179 11Epigenetics Research Kits and Reagents For complete and up-to-date product information visit: www.promega.com ApoTox-Glo™ Triplex Assay Product Size Cat.# ApoTox-Glo™ Triplex Assay 10 ml G6320 5 × 10 ml G6321 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ApoTox-Glo™ Triplex Assay combines three assay chemistries to easily assess viability, cytotoxicity and apoptosis events in the same assay well. First, viability and cytotoxicity are determined by measuring two differential protease biomarkers simultaneously with the addition of a single nonlytic reagent containing two peptide substrates. The live-cell protease activity is restricted to intact viable cells and is measured using a fluorogenic, cell-permeant peptide substrate (GF-AFC Substrate). The substrate enters intact cells, where it is cleaved to generate a fluorescent signal proportional to the number of living cells. This live-cell protease activity marker becomes inactive upon loss of membrane integrity and leakage into the surrounding culture medium. A second, cell-impermeant, fluorogenic peptide substrate (bis-AAF-R110 Substrate) is used simultaneously to measure dead-cell protease activity that has been released from cells that have lost membrane integrity. This results in ratiometric, inversely correlated measures of cell viability and cytotoxicity. The ratio of viable cells to dead cells is independent of cell number and, therefore, can be used to normalize data. A second reagent containing luminogenic DEVD-peptide substrate for caspase-3/7 and UltraGlo™ Recombinant Thermostable Luciferase is added. Caspase-3/7 cleavage of the substrate releases luciferin, which is a substrate for luciferase and generates light. The light output, measured with a luminometer, correlates with caspase-3/7 activation as a key indicator of apoptosis. Features: • Measure Viability, Cytotoxicity and Apoptosis in the Same Sample Well: Determine mechanism of cell death for cells in the same well. • Easily Implement: Simple sequential “add-mix-measure” format. • Normalize Data with a Built-In Control: The ratio of the number of live cells/number of dead cells is independent of cell number and normalizes data. This normalization makes results more comparable well-to-well, plate-to-plate and day-to-day. • Easily Automate this Flexible Assay: Component volumes can be scaled to meet throughput needs. Amenable to automation in 96- and 384-well plates. • Improve Efficiency and Save Lab Budget: Reduce cell culture and labor costs by performing three assays in a single well. Storage Conditions: Store all components at –20°C protected from light. MultiTox-Glo Multiplex Cytotoxicity Assay Product Size Cat.# MultiTox-Glo Multiplex Cytotoxicity Assay 10 ml G9270 5 × 10 ml G9271 2 × 50 ml G9272 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MultiTox-Glo Multiplex Cytotoxicity Assay is a sequentialreagent-addition fluorescent and luminescent assay that measures the relative number of live and dead cells in cell populations. The MultiTox-Glo Assay sequentially measures two protease activities; one is a marker of viability, and the other is a marker of cytotoxicity. The live-cell protease activity is restricted to intact viable cells and is measured using a fluorogenic, cell-permeant, peptide substrate (GF-AFC). This substrate enters intact cells, where it is cleaved by the live cell protease activity to release AFC and generate a fluorescent signal that is proportional to the number of viable cells. The live-cell protease becomes inactive upon loss of membrane integrity and leakage into the surrounding culture medium. A second, luminogenic cell-impermeant peptide substrate (AAF-aminoluciferin) is used to measure dead-cell protease activity, which is released from cells that have lost membrane integrity. The liberated aminoluciferin product is measured as “glow type” luminescence generated by Ultra-Glo™ Recombinant Luciferase provided in the assay reagent. The MultiTox-Glo Assay gives ratiometric, inversely correlated measures of cell viability and cytotoxicity, which correlate with established methods for measuring viability and cytotoxicity. The ratio of viable cells to dead cells is independent of cell number and, therefore, can be used to normalize data. Having complementary cell viability and cytotoxicity measures reduces errors associated with pipetting and cell clumping, as well as serving as an internal control to allow identification of errors resulting from chemical interference from test compounds or media components. Features: • Measure the Number of Live Cells and Dead Cells in Culture: Sequential-reagent-addition assay with a homogeneous “add-mixmeasure” protocol. • Normalize Data with a Built-In Internal Control: The ratio of the number of live cells/number of dead cells is independent of cell number and can be used to normalize data. This normalization makes results more comparable well-to-well, plate-to-plate and day-to-day. • Immediately Identify More False-Positives and False-Negatives: Independent cell viability and cytotoxicity measurements serve as controls for each other. If test compounds interfere with one assay chemistry, the other serves as an internal control. • Improve your Data: Reduce statistical probability of false-positives (or false-negatives), and eliminate fluorescence interference issues by luminescence readout. Storage Conditions: Store at –20°C, protected from light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 180 For complete and up-to-date product information visit: www.promega.com IdeS Protease and IdeZ Protease Product Size Conc. Cat.# IdeS Protease 5,000 units V7511 IdeS Protease 25,000 units V7515 IdeZ Protease 5,000 units V8341 IdeZ Protease, Frozen 2,000 units 50 u/µl V8342 IdeZ Protease 25,000 units V8345 For Research Use Only. Not for Use in Diagnostic Procedures. Description: IdeS Protease IdeS Protease is an immunoglobulin-degrading enzyme from Streptococcus pyogenes (IdeS). It is an engineered recombinant protease overexpressed in E. coli that cleaves Immunoglobulin G (IgG) with high specificity at a single site below the hinge region, yielding F(ab´)2 and Fc fragments. The protocol for a standard reaction is to add the IdeS Protease to the IgG sample, add 1 unit of IdeS Protease per 1µg of IgG to be digested and incubate the sample at 37°C for 30–60 minutes in a neutral pH buffer. IdeZ Protease IdeZ Protease is an immunoglobulin-degrading enzyme from Streptococcus equi subspecies zooepidemicus. It is an engineered recombinant protease overexpressed in E. coli. Like IdeS Protease, IdeZ Protease specifically cleaves IgG molecules below the hinge region to yield F(ab´) 2 and Fc fragments. However, IdeZ Protease has significantly improved activity against mouse IgG2a and IgG3 subclasses compared to IdeS Protease. Features: • See Digestion in 30 Minutes with No Optimization: Fast and easy to use. • Cleave Exclusively at a Single Site Below the Hinge to Produce F(ab´)2 and Fc Fragments: Highly reproducible and specific. • Expect High Performance: Essentially 100% complete digestion. • Effectively Cleave Many IgG Molecules: Both IdeS and IdeZ Proteases effectively cleave human IgG1, IgG2, IgG3 and IgG4, monkey, sheep, rabbit, humanized and chimeric IgGs as well as Fc-fusion proteins. However, mouse IgG2a and IgG3 are cleaved by IdeZ Protease only. Storage Conditions: Store IdeS Protease at –30°C to –10°C. Store IdeZ Protease at –30°C to –10°C. 6 × 5 LC-MS/MS Peptide Reference Mix Product Size Cat.# 6 × 5 LC-MS/MS Peptide Reference Mix 50 μl V7491 200 pmol V7495 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The 6 × 5 LC-MS/MS Peptide Reference Mix is a unique reagent designed to monitor liquid chromatography (LC) and mass spectrometry (MS) instrument performance and assist in method development and optimization. The product is a mixture of 30 peptides; 6 sets of 5 isotopologues of the same peptide sequence. The isotopologues differ only by the number of stable, heavy-labeled amino acids incorporated into the sequence. The labels consist of uniform 13C and 15N atoms. Chromatographically, each of the isotopologues is indistinguishable; however, since they differ in mass, they are clearly resolved by mass spectrometry. The isotopologues of each peptide are present in a series of tenfold dilutions. This format allows assessment of instrument dynamic range and sensitivity from a single run. Peptides with a wide range of hydrophobicities were chosen to enable reporting of LC column performance. In addition, the peptides were chosen for maximal stability. Amino acids prone to artificial post-translational modification (i.e., methionine, asparagine, etc.) were excluded from the sequences. None of the peptides have internal lysines or arginines and will therefore not be affected by trypsin or Lys-C. In addition there is a mass separation of at least 4 Daltons between the isotopologues, so that even low-resolution instruments can distinguish the masses. PReMiS™ Software Tool The 6 x 5 LC-MS/MS Peptide Reference Mix is accompanied by a complementary PReMiS™ Software tool (available by download) that reports on key liquid chromatography and mass spec parameters. The parameter reports can be exported to CSV or saved as .pdf files. In addition to the general reporting feature, performance parameters can be tracked over time, allowing a clear assessment of trends to pinpoint poor performance and maintenance needs. For those laboratories that have multiple instruments, the ability to compare parameters across instruments will also be available. Thermo (.raw) and ABSCIEX (.wiff) formats are available for direct importing. Other vendor formats can be imported after conversion to .mzml format. Data reports are rapidly generated (usually in less than 2 minutes), with clear presentation of the XIC of all 30 masses available for immediate viewing. Features: • Save Time: Unique peptide formulation allows assessment of LC and MS parameters in one run with a single reagent. • Eliminate Manual Calculations: Complementary software provides routine analysis. • Ensure Consistent Instrument Performance Over Time: Complementary software provides historical monitoring. • Accurately Report Instrument Sensitivity and Dynamic Range: Peptides are AAA-qualified. • Use with Neat or Complex Mixture Analysis: Compatible with multiple applications. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 181 11Epigenetics Research Kits and Reagents For complete and up-to-date product information visit: www.promega.com Protein Analysis and Complex Purification HaloTag® Mammalian Protein Purification System Product Size Cat.# HaloTag® Mammalian Protein Detection and Purification System 1 each G6795 HaloTag® Mammalian Protein Purification System 1 each G6790 HaloTag® Mammalian Protein Detection and Purification System Sample Pack 1 each G6799 Available Separately Size Conc. Cat.# HaloTEV Protease 200 μl 5 u/µl G6601 800 μl 5 u/µl G6602 HaloTag® TMRDirect™ Ligand 30 μl 0.1 mM G2991 Protease Inhibitor Cocktail, 50X 1 ml G6521 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Mammalian Protein Purification System (Cat.# G6790) is an optimized kit for purification of HaloTag® fusion proteins from mammalian cell culture lysates. HaloTag® fusion proteins form a highly specific and covalent bond with the HaloLink™ Resin. The covalent binding coupled with the low nonspecific binding of the HaloLink™ Resin provides superior purity and recovery of recombinant proteins from cultured mammalian cells, even at low expression levels. The HaloTag® Mammalian Protein Detection and Purification System (Cat.# G6795) also includes HaloTag® TMRDirect™ Ligand. The simple-to-use fluorescent detection of the HaloTag® fusion facilitates rapid optimization of expression and purification conditions. Features: • Purify More Protein: HaloLink™ Resin covalently binds >7mg/ml of HaloTag® fusion protein (10X more capacity compared to FLAG®). Recovery is highly efficient, commonly >75%. • Higher Purity: Covalent capture allows extensive and/or stringent washes without loss of bound protein, resulting in very low (<0.1%) nonspecific binding and a highly pure protein. • Easily Scalable: Scale up and down, important for obtaining mg-plus quantities. • Optimized for Mammalian Protein Expression: The HaloTag® platform allows flexibility to move between purification, pull-downs and cellular imaging with a single construct. Storage Conditions: Store Spin Columns at room temperature. Store HaloLink™ Resin at 4°C. Store HaloTEV Protease below –65°C. Store HaloTag® TMRDirect™ Ligand and powdered Protease Inhibitor Cocktail at –30 to –10°C. Reconstituted Protease Inhibitor Cocktail can be stored at 2–10°C for 12 months. HaloTag® Protein Purification System Product Size Cat.# HaloTag® Protein Purification System 1 each G6280 HaloTag® Protein Purification System Sample Pack 1 each G6270 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Protein Purification System is designed to purify proteins fused to the HaloTag® protein tag that enhances the expression and solubility of recombinant proteins. HaloTag® Technology enables the covalent, efficient and specific capture of a protein of interest onto HaloLink™ Resin, thus overcoming the equilibrium-based limitations associated with affinity tags (i.e., poor capture of proteins expressed at low levels and protein loss during washing of the purification resin). HaloTag® technology offers a quick and convenient way to test expression of HaloTag® fusion proteins as well as monitor the efficiency of immobilization to HaloLink™ Resin by labeling with fluorescent HaloTag® TMR Ligand followed by SDS-PAGE analysis. Guidelines can be found in the HaloLink™ Resin Technical Manual #TM250, the HaloLink™ Protein Array Technical Manual #TM310 and the HaloCHIP™ System Technical Manual #TM075. Outline of Procedure The HaloTag® protein, a 34kDa mutated hydrolase, covalently attaches to HaloLink™ Resin via an immobilized chloroalkane ligand. TEV Protease cleaves the target protein from the HaloLink™ Resin. The TEV Protease, which has an N-terminal (HQ) tag, is removed from the protein of interest using HisLink™ Resin, and the purified protein of interest is recovered. The appropriate vector that encodes the HaloTag® protein and expresses protein optimally in E. coli is pFN18A HaloTag® T7 Flexi® Vector (G2751) or pFN18K HaloTag® T7 Flexi® Vector (G2681). These vectors can be purchased separately. Features: • Experience Superior Yield, Purity and Specific Activity of Soluble, Functional Proteins Compared to His-Tag, GST and MBP Affinity Tags: Specific and covalent HaloTag® fusion protein capture and immobilization on HaloLink™ Resin. • Achieve Enhanced Target Protein Expression in Prokaryotic, Mammalian and Cell-Free Systems: Proteins are expressed as HaloTag® fusion proteins. • Purify Poorly Expressed Fusion Proteins: Rapid, specific and covalent capture of HaloTag® protein onto HaloLink™ Resin is a nonequilibrium process. • Efficiently Recover Tag-Free Target Protein using TEV Protease Cleavage: Optimized TEV protease recognition site within the interconnecting polypeptide separating the HaloTag® protein and the fusion partner. HaloTag® protein remains immobilized on the resin due to covalent capture. • Save Time: One buffer compatible with downstream applications for all purification steps. • Perform Easy In-Gel Detection and Quantification of Protein Expression Levels with Fluorescent HaloTag® Ligands: Highly stable HaloTag® protein-ligand interaction permits boiling with SDS sample buffer followed by resolving on SDS-PAGE. Storage Conditions: Store the HaloLink™ Resin and HisLink™ Resin at 4°C. Do not freeze the resins. Store the TEV Protease at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 182 For complete and up-to-date product information visit: www.promega.com MagneGST™ Pull-Down System Product Size Cat.# MagneGST™ Pull-Down System 80 reactions V8870 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagneGST™ Pull-Down System is designed for detection of protein interactions between GST-fusion proteins expressed in bacterial lysates and prey proteins expressed in the TnT® Systems. Prey protein synthesized in the TnT® Quick Coupled Transcription/Translation Reaction is captured using bait protein (GST-fusion protein) immobilized on MagneGST™ Particles. Nonspecifically bound proteins are then washed away, and the prey protein is analyzed. Prey proteins can be detected by incorporating radioactively labeled methionine in the TnT® Quick reaction, followed by SDS-PAGE and autoradiography or by incorporating the supplied non-radioactive methionine in the TnT® reaction and detecting by Western blotting with protein-specific antibodies. Storage Conditions: Store the TnT® T7 Quick Master Mix and Methionine at –70°C. Store the RQ1 RNase-Free DNase at –20°C. Store the Nuclease-Free Water, MagneGST™ Glutathione Particles, MagneGST™ Binding/Wash Buffer and Cell Lysis Reagent at 4°C. HaloCHIP™ System Product Size Cat.# HaloCHIP™ System 20 reactions G9410 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloCHIP™ System is a novel method designed for the covalent capture of intracellular protein:DNA complexes without the use of antibodies and offers an efficient and robust alternative to the standard chromatin immunoprecipitation (ChIP) method. Proteins of interest are expressed in cells as HaloTag® fusion proteins, crosslinked to DNA with formaldehyde and then captured on HaloLink™ Resin, which forms a highly specific, covalent interaction with the HaloTag® portion of the fusion protein. Stringent washing removes nonspecific proteins and DNA, and heating reverses the crosslinks between the DNA and the fusion protein and releases the captured DNA fragment, which subsequently can be purified. Features: • No Requirement for Antibody: No need to make your own or purchase expensive, qualified antibodies. • Obtain Results Faster: Obtain data in 24–48 hours with fewer steps to minimize potential experimental errors. • Improved Signal-to-Noise Ratios: Enables detection of small changes in protein binding patterns using a minimal number of cells. Storage Conditions: The TE Buffer (pH 8.0), Reversal Buffer and Nuclease-Free Water may be stored at room temperature. Store the HaloLink™ Resin, Mammalian Lysis Buffer and High Salt Wash Buffer at 4°C. Store the HaloCHIP™ Blocking Ligand at –20°C. HaloTag® Mammalian Pull-Down Systems Product Size Cat.# HaloTag® Complete Pull-Down System 1 each G6509 HaloTag® Mammalian Pull-Down and Labeling System 24 reactions G6500 HaloTag® Mammalian Pull-Down System 24 reactions G6504 HaloTag® Control Vector 20 μg G6591 Available Separately Protease Inhibitor Cocktail, 50X 1 ml G6521 Mammalian Lysis Buffer 40 ml G9381 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Mammalian Pull-Down Systems (Cat.# G6500, G6504 and G6509) are designed to capture and purify intracellular binary and higher order protein complexes, including transient or weakly interacting partners. HaloTag® Mammalian Pull-Down System (Cat.# G6504) includes buffers and resin necessary to perform a HaloTag® pull-down. HaloTag® Mammalian Pull-Down and Labeling System (Cat.# G6500) includes everything in G6504 plus the HaloTag® TMRDirect™ Ligand, which allows correlative cellular localization and real-time imaging studies. HaloTag® Complete Pull-Down System (Cat.# G6509) includes everything in G6500 plus a starter cloning system, Wizard® SV Gel and PCR Clean-Up System, and FuGENE® HD Transfection Reagent. The HaloTag® Control Vector provides protein expression of the HaloTag® protein in mammalian cells, E. coli or in vitro expression systems dependent on human cytomegalovirus (CMV) intermediate early enhancer, T7 or SP6 RNA polymerase promoters. It can be used as a control for any HaloTag® experimental system and can be used for both stable and transient HaloTag® expression in mammalian cells; for stable expression, co-transfection with a vector containing a selectable marker is required. The Protease Inhibitor Cocktail, 50X, is a mixture of six different protease inhibitors with different target protease specificities. This product is provided in a freeze-dried format and can be reconstituted using either 100% ethanol or DMSO. The Mammalian Lysis Buffer is designed for use with HaloTag® Mammalianbased expression systems such as the HaloTag® Mammalian Pull-Down and Labeling Systems (referenced here) as well as the HaloCHIP™ System (Cat.# G9410). Formulation consists of 50mM Tris-HCl, 150mM NaCl, 1% Triton® X-100 and 0.1% sodium deoxycholate (pH 7.5). Related Services: Mass Spec Services. Features: • Rapid, Efficient and Covalent Capture of Binary and Higher Order Complexes Directly from Lysates: Improved capture of protein partners, including transient interactions. • High Purity and Low Background: Improved accuracy in identification of proteins; covalent attachment allows bait protein to remain behind if desired. • Ability to Fluorescently Label the Same Genetic Fusion: Correlate complex capture with cellular localization. • Compatibility with All Downstream Methods of Analysis: Freedom to identify complexes in variety of applications including mass spectrometry. Storage Conditions: Store the 10X TBS Buffer and SDS Elution Buffer at room temperature. Store the HaloLink™ Resin and Mammalian Lysis Buffer at 4°C. Store the HaloTag® TMRDirect™ Ligand and powdered Protease Inhibitor Cocktail at –30 to –10°C. Reconstituted Protease Inhibitor Cocktail can be stored at 2–10°C for 12 months. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 183 12 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix PCR Taq Polymerase and Endpoint PCR 184 qPCR and RT-qPCR 190 RT-PCR 191 PCR Cloning 197 PCR Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 184 For complete and up-to-date product information visit: www.promega.com Taq Polymerase and Endpoint PCR GoTaq® G2 Hot Start Polymerase and Master Mixes Product Size Conc. Cat.# GoTaq® G2 Hot Start Polymerase 100 u 5 u/µl M7401 500 u 5 u/µl M7405 2,500 u 5 u/µl M7406 10,000 u 5 u/µl M7408 GoTaq® G2 Hot Start Green Master Mix 100 reactions M7422 1,000 reactions M7423 GoTaq® G2 Hot Start Colorless Master Mix 100 reactions M7432 1,000 reactions M7433 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GoTaq® G2 Polymerase is the second generation of GoTaq® products. The enzyme comes in a variety of formats designed to provide maximum flexibility, control and convenience. For superior convenience and improved yield, sensitivity and specificity, choose GoTaq® G2 Hot Start Polymerase, which is bound to a proprietary antibody that blocks activity. Activity is restored during initial denaturation, allowing hot-start PCR. Available as a master mix or standalone enzyme. GoTaq® G2 Hot Start Polymerase is supplied with 5X Green GoTaq® Flexi Buffer, 5X Colorless GoTaq® Flexi Buffer and 25mM MgCl2 . The high-performance GoTaq® G2 DNA Polymerase is bound to a proprietary antibody that blocks polymerase activity. Polymerase activity is restored during the initial denaturation step, when amplification reactions are heated at 94–95°C for two minutes, allowing hot-start PCR in which polymerase activity is inhibited at temperatures below 70°C for convenient, room-temperature reaction setup. Hot-start PCR is advantageous for some amplification targets because it may eliminate or minimize primer-dimer and nonspecific products. In some cases, hot-start PCR may improve yields. GoTaq® G2 Hot Start Polymerase exhibits 5´→3´ exonuclease activity. The GoTaq® G2 Hot Start Master Mixes are ready-to-use mixes containing all necessary components (GoTaq® G2 Hot Start Polymerase, buffer, dNTPs and optimized magnesium)—you only need to add primer and template and go! The GoTaq® G2 Hot Start Green Master Mix also contains a gel loading dye to facilitate downstream gel analysis. The GoTaq® G2 Hot Start Colorless Master Mix contains no gel loading dye for use when downstream applications require fluorescence or absorbance readings without purification. Features: • Simplify reaction setup and save time with a ready-to-use master mix. • Prepare your reaction at room temperature, not on ice. • Eliminate nonspecific amplification with hot-start enzyme. • Use at no risk—backed by the Promega PCR Satisfaction Guarantee. Storage Conditions: Store at –30°C to –10°C. GoTaq® Hot Start Polymerase Product Size Conc. Cat.# GoTaq® Hot Start Polymerase 100 u 5 u/µl M5001 500 u 5 u/µl M5005 2,500 u 5 u/µl M5006 10,000 u 5 u/µl M5008 GoTaq® Hot Start Green Master Mix 100 reactions M5122 1,000 reactions M5123 GoTaq® Hot Start Colorless Master Mix 100 reactions M5132 1,000 reactions M5133 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GoTaq® Hot Start Polymerase contains the high-performance GoTaq® DNA Polymerase bound to a proprietary antibody that blocks polymerase activity. The polymerase activity is restored during the initial denaturation step when the amplification reactions are heated at 94–95°C for two minutes. This enables hot-start PCR, where polymerase activity is eliminated or minimized at temperatures below 70°C. GoTaq® Hot Start Polymerase exhibits 5´→3´ exonuclease activity. The enzyme is supplied with a tube of 25mM MgCl2 to optimize the magnesium concentration in your reactions. It is also supplied with 5X Green GoTaq® Flexi Buffer and 5X Colorless GoTaq® Flexi Buffer. The buffers contain a compound that increases sample density so that samples sink easily into wells of an agarose gel. The green buffer also contains two dyes (yellow and blue) that separate to allow easy monitoring during electrophoresis. Use the green reaction buffer for direct-to-gel analysis after amplification and the colorless reaction buffer for amplifications where the dyes may interfere with post-amplification analysis such as fluorescence or absorbance testing. GoTaq® Hot Start Master Mixes are premixed, ready-to-use solutions containing GoTaq® Hot Start Polymerase, magnesium, dNTPs and buffer. Reactions can be set up in less than a minute at room temperature; simply add your template, water and primers. Available with either green or colorless reaction buffers, which also serve as loading buffers, allowing you to go directly from thermal cycler to gel analysis. GoTaq® Hot Start Master Mixes offer the specificity and sensitivity of an antibody-based hot-start polymerase in a convenient, easy-to-use, time-saving format. Features: • Enhanced Yield, Sensitivity and Specificity: The proven, robust amplification and sensitivity of GoTaq® DNA Polymerase now with built-in hot start to deliver even more superior results. • Ease of Use: Set up your reaction at room temperature—no need to set up on ice. • Higher Yield: Two-minute activation saves time and ensures maximum enzyme activity. • Higher Specificity: Minimize nonspecific amplification and primer-dimers. • Improve Productivity: Go directly from PCR to gel analysis. Green GoTaq® Reaction Buffer serves as both reaction buffer and gel-loading solution. • Convenience: One tube, one pipetting step. Only add template and primers when using the master mixes. • Optimization: Control the magnesium concentration in your reaction for specialized templates when using the standalone polymerase. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 185 12PCR For complete and up-to-date product information visit: www.promega.com GoTaq® Long PCR Master Mix Product Size Cat.# GoTaq® Long PCR Master Mix 100 reactions M4021 For Research Use Only. Not for Use in Diagnostic Procedures. Description: GoTaq® Long PCR Master Mix contains the high-performance GoTaq® Hot Start Polymerase in a specially formulated mixture with a proprietary thermostable proofreading polymerase. This optimized enzyme mixture allows efficient amplification of up to 40kb from lambda DNA or 30kb from human genomic DNA. The presence of a proofreading enzyme to repair DNA mismatches and a highly processive polymerase allows the polymerase to continue to elongate the DNA much further, resulting in longer DNA amplification. The optimized formulation of the GoTaq® Long PCR Master Mix components enables simple reaction setup and provides consistently efficient, accurate and robust amplification of long DNA amplicons. Features: • Easy: Hot-start master mix for convenient handling and simple setup. • Enhanced: Yield, sensitivity and specificity with optimized components. • Accurate: Blend of thermostable DNA polymerases with enhanced processivity and proofreading. • Confident: Control primer pair and human genomic DNA template to perform control reactions and test template quality. • Efficient: Perfect for cloning genes, mutational analysis and DNA sequencing. Storage Conditions: Upon arrival, store all components at –30°C to –10°C, protected from light. For immediate use, components may be stored at 2–8°C, protected from light, for up to 3 months. GoTaq® G2 Polymerase and Master Mixes Product Size Conc. Cat.# GoTaq® G2 Flexi DNA Polymerase 100 u 5 u/µl M7801 500 u 5 u/µl M7805 2,500 u 5 u/µl M7806 10,000 u 5 u/µl M7808 GoTaq® G2 DNA Polymerase 100 u 5 u/µl M7841 500 u 5 u/µl M7845 2,500 u 5 u/µl M7848 GoTaq® G2 Green Master Mix 100 reactions M7822 1,000 reactions M7823 GoTaq® G2 Colorless Master Mix 100 reactions M7832 1,000 reactions M7833 For Laboratory Use. Description: The second generation of GoTaq® products, GoTaq® G2 DNA Polymerase reliably amplifies a wide range of PCR templates and provides high-performance results due to improved manufacturing processes, increased reliability and consistency. The product is available in many formats to give you maximum flexibility, control and convenience for your PCR. For robust, routine PCR choose a standalone enzyme and buffer with or without magnesium, or for maximum convenience, choose an all-in-one master mix. GoTaq® G2 DNA Polymerase is supplied with 5X Green GoTaq® Reaction Buffer and 5X Colorless GoTaq® Reaction Buffer. Both buffers contain MgCl2 at a concentration of 7.5mM for a final concentration of 1.5mM in the 1X reaction. GoTaq® G2 Flexi DNA Polymerase is supplied with 5X Green GoTaq® Flexi Buffer and 5X Colorless GoTaq® Flexi Buffer and 25mM MgCl2 . GoTaq® G2 Green and Colorless Master Mixes are ready-to-use. The green and colorless 2X master mixes contain all necessary components for robust, reliable PCR, including GoTaq® G2 DNA Polymerase. Add template, primers and go. The GoTaq® G2 and G2 Flexi DNA Polymerases are supplied in a proprietary formulation containing 50% glycerol, with buffers designed for enhanced amplification. The enzyme is a full-length form of Taq DNA polymerase that exhibits 5´→3´ exonuclease activity. The 5X Green GoTaq® Reaction and Flexi Buffers contain two dyes (blue and yellow) that separate during electrophoresis to indicate migration progress. The colorless buffer is used when direct fluorescence or absorbance readings are required without prior purification of amplified DNA from the PCR. Features: • Direct-to-gel amplification buffer. • Two buffer systems available to match your needs: • Reaction buffer with MgCl2 to simplify reaction setup. • Flexi buffer and separate MgCl2 to enable optimization. • Risk-Free: Backed by the Promega PCR Satisfaction Guarantee. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 186 For complete and up-to-date product information visit: www.promega.com GoTaq® Amplification Family Product Size Conc. Cat.# GoTaq® Flexi DNA Polymerase 100 u 5 u/µl M8291 500 u 5 u/µl M8295 2,500 u 5 u/µl M8296 5,000 u 5 u/µl M8297 10,000 u 5 u/µl M8298 GoTaq® DNA Polymerase 100 u 5 u/µl M3001 500 u 5 u/µl M3005 2,500 u 5 u/µl M3008 GoTaq® Green Master Mix 100 reactions M7122 1,000 reactions M7123 GoTaq® Colorless Master Mix 100 reactions M7132 1,000 reactions M7133 For Laboratory Use. Description: Experience improved PCR performance with GoTaq® DNA Polymerase products. GoTaq® DNA Polymerase is a proprietary formulation of Taq DNA polymerase that gives robust amplification equal to and in some cases superior to that of standard Taq DNA polymerase. GoTaq® DNA Polymerase comes in a variety of formulations to give you maximum flexibility, control and convenience. GoTaq® Flexi DNA Polymerase allows you to optimize enzyme and magnesium concentration in your PCR. The supplied 5X Green and Colorless Flexi Reaction Buffers do not contain magnesium. A separate tube of 25mM MgCl2 is supplied, giving you maximum control over your reaction conditions. MgCl2 is also available separately. GoTaq® DNA Polymerase provides improved amplification with the convenience of reaction buffers containing magnesium. The 5X GoTaq® Green and Colorless Reaction Buffers supplied with GoTaq® DNA Polymerase contain MgCl2 at a concentration of 7.5mM, for a final concentration of 1.5mM in the 1X reaction. The 5X Green and 5X Colorless Reaction Buffers supplied with GoTaq® enzymes allow you to go directly from thermal cycler to gel analysis. These buffers contain a compound that increases sample density so that samples sink easily into wells of an agarose gel. The green buffer also contains two dyes (yellow and blue) that separate to allow easy monitoring during electrophoresis. The blue dye comigrates at the same rate as 3–5kb DNA fragments in a 1% agarose gel. The yellow dye migrates ahead of primers (<50bp). Use the green reaction buffer for direct-to-gel analysis after amplification and the colorless reaction buffer for post-amplification analysis by fluorescence or absorbance without prior DNA purification. For ultimate convenience, choose GoTaq® Colorless Master Mix or GoTaq® Green Master Mix. Both are premixed, ready-to-use 2X solutions that contain GoTaq® DNA Polymerase, dNTPs, MgCl2 and reaction buffer at optimal concentrations for efficient amplification of DNA templates by PCR. GoTaq® Green Master Mix also includes two dyes (blue and yellow) that allow monitoring of progress during electrophoresis. GoTaq® Colorless Master Mix has the same formulation as the GoTaq® Green Master Mix but does not include the dyes. Both include Nuclease-Free Water. Reactions assembled with the GoTaq® Master Mixes have sufficient density for direct loading onto agarose gels. Features: • Improve Performance: Experience better PCR performance with this buffer and enzyme formulation. With GoTaq® Flexi DNA Polymerase, you have the option to titrate Mg2+ concentration in your reactions. • Improve Productivity: Go directly from PCR to gel analysis. Green GoTaq® Reaction Buffer serves as both reaction buffer and gel-loading solution. • Keep Your Cycling Conditions: Directly substitute GoTaq® products, with either Colorless or Green Reaction Buffer, in your current PCR application— no need to change cycling parameters. • Use With PCR Enhancers: GoTaq® DNA Polymerase is compatible with PCR enhancers such as betaine and DMSO. Neither compound affects the color or characteristics of the GoTaq® Green Reaction Buffer. • Fast and Convenient: GoTaq® Green Master Mix offers the ultimate in convenience. Reactions can be set up in less than a minute; simply add your template, water and primers and go! Storage Conditions: Store enzymes at –30°C to –10°C. GoTaq® Green Master Mix can be stored at 4°C for 6 weeks. GoTaq® Reaction Buffers and Magnesium Chloride Product Size Conc. Cat.# 5X Green GoTaq® Reaction Buffer 20 ml M7911 5X Colorless GoTaq® Reaction Buffer 20 ml M7921 5X Colorless GoTaq® Flexi Reaction Buffer 20 ml M8901 5X Green GoTaq® Flexi Reaction Buffer 20 ml M8911 Magnesium Chloride Solution 1.5 ml 25 mM A3511 25 ml 25 mM A3513 For Laboratory Use. Description: The 5X Green GoTaq® Reaction Buffer contains two dyes (a blue dye and a yellow dye) that separate during electrophoresis to show migration progress. The buffer also contains a compound that increases sample density. This means that samples can be loaded directly onto gels without the need for loading dye. The blue dye migrates at the same rate as a 3–5kb DNA fragment in a 1% agarose gel. The yellow dye migrates at a rate faster than primers (<50bp) in a 1% agarose gel. The 5X Colorless GoTaq® Reaction Buffer has the same formulation as the 5X Green GoTaq® Reaction Buffer but does not contain dyes and is recommended for any applications where absorbance or fluorescence measurements are necessary prior to PCR cleanup. Both buffers are supplied at pH 8.5. Cat.# M7911 and M7921 contain MgCl2 at a concentration of 7.5mM for a final concentration of 1.5mM in the 1X reaction. Cat.# M8901 and M8911 do not contain magnesium. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 187 12PCR For complete and up-to-date product information visit: www.promega.com GoTaq® PCR Core System Product Size Cat.# GoTaq® PCR Core System I 200 reactions M7660 For Laboratory Use. Description: The GoTaq® PCR Core System I is designed for exponential amplification of specific regions of DNA using the polymerase chain reaction. The system includes GoTaq® DNA polymerase and PCR Nucleotide Mix, along with high-performance buffers and magnesium chloride. All components are performance-tested in PCR and are sufficient for 200 reactions. Features: • Convenience: PCR-tested components are provided in optimized volumes for 200 reactions. • Flexibility: Optimization tools are provided for reaction flexibility. • Performance Guarantee: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. Storage Conditions: Store all components at –30°C to –10°C. PCR Master Mix Product Size Conc. Cat.# PCR Master Mix 10 reactions 2 X M7501 100 reactions 2 X M7502 1,000 reactions 2 X M7505 For Laboratory Use. Description: PCR Master Mix is a premixed, ready-to-use solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffer at optimal concentrations for efficient amplification of DNA templates by PCR. The PCR Master Mix is optimized for use in routine PCR for amplifying DNA templates in the range of 0.2–2kb. Features: • Fast: Set up reactions in less than a minute. • Sensitive: Amplify as few as two copies of target template. • Convenient: One tube, one pipetting step. • Complete: Reagents, including Taq DNA polymerase, MgCl2 , dNTPs and buffers, in one tube. • Scalable: Set up 10μl, 25μl or 50μl reactions. • Stable: Store at 4°C for up to 3 months. • Performance Guaranteed: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. PCR Master Mix can be stored at 4°C for up to 3 months. Pfu DNA Polymerase Product Size Conc. Cat.# Pfu DNA Polymerase 100 u 2–3 u/µl M7741 500 u 2–3 u/µl M7745 For Research Use Only. Not for Use in Diagnostic Procedures. Product may not be available in all countries. Please contact your local representative for more information. Description: Pfu DNA Polymerase is a thermostable enzyme of approximately 90kDa isolated from Pyrococcus furiosus. The enzyme replicates DNA at 75°C, catalyzing the polymerization of nucleotides into duplex DNA in the 5´→3´ direction in the presence of magnesium. Pfu DNA Polymerase also possesses 3´→5´ exonuclease (proofreading) activity. Base misinsertions that may occur during polymerization are rapidly excised by the proofreading activity of the polymerase. Consequently, Pfu DNA Polymerase is recommended for use in PCR and primer extension reactions that require high-fidelity synthesis. Pfu DNA Polymerase-generated PCR fragments are blunt-ended. Pfu DNA Polymerase 10X Reaction Buffer with MgSO4 : 200mM Tris-HCl (pH 8.8 at 25°C), 100mM KCl, 100mM (NH4 ) 2 SO4 , 20mM MgSO4 , 1.0% Triton® X-100 and 1mg/ml nuclease-free BSA. Features: • High Fidelity: Pfu DNA Polymerase exhibits the lowest error rate of any thermostable DNA polymerase. • Complete: Provided with 10X buffer containing 20mM MgSO4 . • Performance Guarantee: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 188 For complete and up-to-date product information visit: www.promega.com PCR Nucleotide Mix Product Size Conc. Cat.# PCR Nucleotide Mix 200 μl 10 mM C1141 1,000 μl 10 mM C1145 200 μl 25mM U1431 1,000 μl 25mM U1432 For Laboratory Use. Description: High-quality deoxynucleotide triphosphates (dNTPs) are critical for PCR efficacy. The PCR Nucleotide Mix is a premixed solution containing the sodium salts of dATP, dCTP, dGTP and dTTP. PCR Nucleotide Mix is manufactured under cGMP conditions and has equimolar amounts of each dNTP to ensure optimal PCR. Adding dNTPs as a mix also simplifies pipetting steps and reduces the risk of contamination. There are two ready-to-use formulations available: • A premixed solution with each nucleotide at a concentration of 10mM in water at pH 7.5; the total concentration of nucleotides is 40mM. • A premixed solution with each nucleotide at a concentration of 25mM in water at pH 7.5; the total concentration of nucleotides is 100mM. Features: • Optimized and Pretested in PCR: Equimolar amounts of each dNTP ensure optimal PCR. • Convenient: Add 1μl for 50μl PCR. • Easy to Use: Reduced pipetting steps contribute to ease-of-use and reduce the risk of contamination. • Performance Guaranteed: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ • cGMP-Manufactured: Achieve lot-to-lot product consistency. • Two Concentrations Available: 10mM and 25mM. Storage Conditions: Store at –30°C to –10°C. dNTP Mix Product Size Conc. Cat.# dNTP Mix 200 μl 10 mM U1511 1,000 μl 10 mM U1515 For Laboratory Use. Description: dNTP Mix is a premixed solution containing sodium salts of dATP, dCTP, dGTP and dTTP, each at 10mM in water at pH 7.5; the total concentration of nucleotides is 40mM. One microliter of the dNTP Mix in a 50μl reaction will give a final dNTP concentration of 200μM for each dNTP. Features: • High Purity: dNTPs are >99% triphosphate. • Easy to Use: Reduced pipetting steps contribute to ease of use and reduce the risk of contamination. Storage Conditions: Store at –20°C. Avoid exposure to frequent temperature changes. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 189 12PCR For complete and up-to-date product information visit: www.promega.com Deoxynucleotide Triphosphates (dNTPs) Product Size Conc. Cat.# dATP 25 μmol 100 mM U1205 40 μmol 100 mM U1201 200 μmol 100 mM U1202 dGTP 25 μmol 100 mM U1215 40 μmol 100 mM U1211 200 μmol 100 mM U1212 dCTP 25 μmol 100 mM U1225 40 μmol 100 mM U1221 200 μmol 100 mM U1222 dTTP 25 μmol 100 mM U1235 40 μmol 100 mM U1231 200 μmol 100 mM U1232 Set of dATP, dCTP, dGTP, dTTP 10µmol each 100 mM U1330 25 μmol each 100 mM U1420 40µmol each 100 mM U1240 200 μmol 100 mM U1410 For Laboratory Use. Description: High-quality deoxynucleotide triphosphates (dNTPs) are critical for the success of many key procedures such as cDNA synthesis, sequencing and labeling. Promega dNTPs have greater than 99% triphosphate content and are provided at a concentration of 100mM in water at pH 7.5. Features: • Dependable: PCR-tested deoxynucleotides ensure optimal performance with all Promega amplification enzymes. • Consistent: dNTPs are >99% pure, allowing highly consistent results. • Convenient: Supplied at a convenient concentration (100mM in water) for ease-of-use in PCR and other applications. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –30°C to –10°C. Avoid exposure to frequent temperature changes. PCR Amplifications From Each Size of Individual dNTPs. Each catalog number supplies each individual dNTP at 100mM. Reactions are based on 200µM each dNTP in a 50µl reaction. Cat.# Quantity Volume Reactions U1330, U1335 10 µmol each 100 µl each 1,000 U1420 25 µmol each 250 µl each 2,500 U1240, U1245 40 µmol each 400 µl each 4,000 U1410 200 µmol each 2 × 1,000 µl each 20,0009479LA Deoxyuridine Triphosphate (dUTP) Product Size Conc. Cat.# dUTP 40 μmol 100 mM U1191 Set of dATP, dCTP, dGTP, dUTP 10µmol each 100 mM U1335 40µmol each 100 mM U1245 For Laboratory Use. Description: High-quality deoxynucleotide triphosphates (dNTPs) are critical for the success of many key procedures such as cDNA synthesis, sequencing and labeling. Promega dNTPs have greater than 99% triphosphate content and are provided at a concentration of 100mM in water at pH 7.5. dUTP (2´-Deoxyuridine, 5´-Triphosphate) can be used in place of dTTP in PCR and RT-PCR protocols to prevent carryover from previous amplifications. The substitution of dUTP for dTTP in PCR results in uracil-containing PCR products that are suitable for most standard applications. The enzyme uracil-N-glycosylase (UNG, also referred to as UDG) can be added to a PCR premix to excise uracil from any contaminating PCR product, thereby preventing false positives. Each lot of dUTP is function-tested to ensure specific DNA amplification and the absence of nuclease activity. Features: • Dependable: PCR-tested deoxynucleotides ensure optimal performance with all Promega amplification enzymes. • Consistent: dUTP is ≥99% triphosphate, allowing highly consistent results. • Convenient: Supplied at a convenient concentration (100mM in water) for ease-of-use in PCR and other applications. Storage Conditions: Store at –20°C. Avoid exposure to frequent temperature changes. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 190 For complete and up-to-date product information visit: www.promega.com qPCR and RT-qPCR GoTaq® Real-Time qPCR and RT-qPCR Systems for Probe-Based Detection Product Size Cat.# GoTaq® Probe qPCR Master Mix 2 ml A6101 10 ml A6102 GoTaq® Probe 2-Step RT-qPCR System 2 ml A6110 GoTaq® Probe 1-Step RT-qPCR System 2 ml A6120 12.5 ml A6121 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GoTaq® Probe qPCR Master Mix is optimized for quantitative PCR assays in the hydrolysis probe detection format. The master mix is provided as a ready-to-use, stabilized 2X formulation that includes all components for qPCR (except template, primers and probe). This master mix does not contain a reference dye; however, a separate tube of carboxy-X-rhodamine (CXR) reference dye is included with this system, allowing users to add reference dye to amplification reactions if desired. The GoTaq® Probe qPCR Master Mix provides resistance to a wide range of PCR inhibitors. This formulation uses antibody-mediated hot-start chemistry, allowing reaction setup to be performed at room temperature. The master mix also employs rapid hot-start activation and processive enzymes, making it compatible with both standard and fast instrument cycling programs. The GoTaq® Probe 2-Step RT-qPCR System is optimized for quantitative PCR assays in the hydrolysis probe detection format. The system facilitates detection and relative quantification of RNA expression levels via a two-step RT-qPCR method using integrated components: • GoScript™ Reverse Transcription System • GoTaq® Probe qPCR Master Mix The GoScript™ Reverse Transcription System includes an optimized reaction buffer and reverse transcriptase that enable efficient synthesis of first-strand cDNA in preparation for PCR amplification. The cDNA product may be added directly to downstream qPCR amplification reactions. The GoTaq® Probe 1-Step RT-qPCR System is optimized for quantitative PCR assays in the hydrolysis probe detection format. The system enables detection and relative quantification of RNA expression levels using a one-step RT-qPCR method, combining GoScript™ Reverse Transcriptase and GoTaq® Probe qPCR Master Mix in single-step real-time amplification reactions. The GoScript™ RT Mix for 1-Step RT-qPCR (50X) combines optimized amounts of GoScript™ Reverse Transcriptase, RNasin® Plus RNase Inhibitor, dUTP and additives to enhance single-step reactions. Features: • Superior Performance: Sensitive detection on any real-time instrument. • Enhanced Stability: Room-temperature setup makes the system suitable for automation and high-throughput detection. • Versatility: Compatible with both fast and standard cycling methods. • Performance Guarantee: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. Storage Conditions: Store all components between –30°C and –10°C. Protect components from light at all times. For best results, mix thawed solutions gently to minimize aeration and foaming, and keep on ice. For short-term storage and frequent use, the GoTaq® qPCR Master Mix, 2X, may be kept at 2–8°C for up to 3 months if protected from light. GoTaq® Real-Time qPCR and RT-qPCR Systems for Dye-Based Detection Product Size Cat.# GoTaq® qPCR Master Mix 5 ml A6001 25 ml A6002 GoTaq® 2-Step RT-qPCR System 5 ml A6010 GoTaq® 1-Step RT-qPCR System 5 ml A6020 Available Separately CXR Reference Dye 100 μl C5411 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GoTaq® qPCR Master Mix is a ready-to-use 2X master mix for use in real-time quantitative PCR (qPCR and RT-qPCR). The system contains BRYT Green® Dye, a novel fluorescent DNA-binding dye with minimal PCR inhibition for maximum PCR efficiency and greater fluorescence enhancement upon binding to double-stranded DNA than SYBR® Green I. Containing the GoTaq® Hot Start Polymerase, optimized buffer and proprietary dye, the GoTaq® qPCR Master Mix provides robust real-time PCR with earlier quantification cycle values and broad-range detection for increased reliability, reproducibility and sensitivity. The GoTaq® 2-Step RT-qPCR System is a reagent system for quantitative analysis of RNA using a two-step reverse transcription-quantitative PCR (RT-qPCR) protocol. The components and protocol allow robust, reliable cDNA synthesis of a full range of rare and abundant transcripts, even in the presence of inhibitors, using the GoScript™ Reverse Transcription System and quantification using the GoTaq® qPCR Master Mix. The GoTaq® 1-Step RT-qPCR System is a reagent system for quantitative analysis of RNA using a one-step reverse transcription-quantitative PCR (RT-qPCR) protocol in a single tube. The BRYT Green® Dye and optimized buffer formulations improve data accuracy and sensitivity of low-level targets. Features: • Brighter Signal: Sensitive detection for earlier quantification of low- and high-copy-number targets. • Enhanced Stability: Room-temperature setup makes the systems suitable for automation and high-throughput detection. • Versatility: Compatible with both fast and standard qPCR cycling methods. • Robustness: High-efficiency, full-length cDNA synthesis in the presence of inhibitors. • Performance Guarantee: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. Storage Conditions: Upon arrival, store all components at –30°C to –10°C, protected from light. For immediate use, components may be stored at 2–8°C, protected from light, for up to 3 months. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 191 12PCR For complete and up-to-date product information visit: www.promega.com MOPS/EDTA Buffer Product Size Cat.# MOPS/EDTA Buffer 3 × 10 ml Y5101 For Research Use Only. Not for Use in Diagnostic Procedures. Description: MOPS/EDTA Buffer is provided at pH 7.4 for resuspending and diluting Iso-dC-containing primers and templates used in qPCR and RT-qPCR systems. Iso-dC-containing primers are sensitive to pH below 7.0. Storage Conditions: Store at any temperature. RT-PCR GoScript™ Reverse Transcription System Product Size Cat.# GoScript™ Reverse Transcription System 50 reactions A5000 100 reactions A5001 Available Separately GoScript™ Reverse Transcriptase 100 reactions A5003 500 reactions A5004 GoScript™ Reverse Transcription Mix, Oligo(dT) 50 reactions A2790 100 reactions A2791 GoScript™ Reverse Transcription Mix, Random Primers 50 reactions A2800 100 reactions A2801 A5000, A5001, A2790, A2791, A2800, A2801 For Research Use Only. Not for Use in Diagnostic Procedures. A5003, A5004 For Laboratory Use. Description: The GoScript™ Reverse Transcription System includes a reverse transcriptase and a specialized set of reagents for efficient synthesis of first-strand cDNA optimized for quantitative PCR amplification. GoScript™ Reverse Transcriptase uses M-MLV Reverse Transcriptase and state-of-the-art buffer technology to deliver robust, reliable cDNA synthesis of a full range of rare and abundant transcripts, even in the presence of inhibitors. GoScript™ Reverse Transcriptase is qualified for use in qPCR, including GoTaq® qPCR systems. Features: • Available as a standalone enzyme, a complete reverse transcription kit or as a master mix with Oligo(dT) or Random Primers. • Achieve sensitive transcription of both high-copy and low-copy messages. • Transcribe short and long transcripts; process through secondary structure. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 192 For complete and up-to-date product information visit: www.promega.com ImProm-II™ Reverse Transcription System Product Size Cat.# ImProm-II™ Reverse Transcription System 100 reactions A3800 Available Separately ImProm-II™ Reverse Transcriptase 10 reactions A3801 100 reactions A3802 500 reactions A3803 A3800 For Research Use Only. Not for Use in Diagnostic Procedures. A3801, A3802, A3803 For Laboratory Use. Description: The ImProm-II™ Reverse Transcription System produces efficient, robust synthesis of first-strand cDNA in preparation for PCR amplification. The components of the ImProm-II™ Reverse Transcription System can be used to reverse transcribe RNA templates starting with total RNA, poly(A)+ mRNA or synthetic transcript RNA. The optimized reaction buffer and powerful ImProm-II™ Reverse Transcriptase provided in the ImProm-II™ System together enable robust, full-length cDNA synthesis for the reproducible analysis of rare or long messages. The cDNA synthesis conditions were formulated for standalone applications or for easy transition to gene-specific target amplification. An aliquot of the reverse transcription reaction (1–20μl) can be amplified directly using Taq DNA polymerase in coupled or uncoupled PCR. Features: • Amenable to Full-Length RT-PCR: Reverse transcribe long RNA templates up to 8.9kb. • Microarray-Compatible: Can be used to incorporate regular, Cy®3-modified, Cy®5-modified and amino-allyl-modified nucleotides. • Easy to Use: System provides all reagents necessary for efficient reverse transcription. • Scalable and Flexible: 1–20μl of the initial reverse transcription reaction may be used in subsequent PCR, and the optimized buffer allows coupled RT-PCR. • RT Provided with 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 375mM KCl and 50mM DTT. A 25mM MgCl2 Solution is included. • Versatile: Use with your thermostable DNA polymerase of choice. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Store Positive Control RNA at –70°C. Reverse Transcription System Product Size Cat.# Reverse Transcription System 100 reactions A3500 Available Separately Size Conc. Cat.# Magnesium Chloride Solution 1.5 ml 25 mM A3511 Reverse Transcription 10X Buffer 1.4 ml A3561 A3500 For Research Use Only. Not for Use in Diagnostic Procedures. A3511, A3561 For Laboratory Use. Description: The Reverse Transcription System provides reagents to efficiently reverse transcribe RNA into cDNA in 15 minutes. The cDNA prepared from each reaction may be used directly in multiple PCR amplifications using Taq DNA polymerase. The AMV Reverse Transcriptase synthesizes single-stranded cDNA from total or poly(A)+ RNA. Both Oligo(dT)15 and Random Primers are included, allowing cDNA synthesis from virtually any RNA source. The system contains sufficient reagents for 100 cDNA synthesis reactions, processing 1μg of RNA per reaction. Each cDNA synthesis reaction can be divided and used in up to 20 separate PCR amplifications. A polyadenylated 1.2kb RNA transcript is provided as a control template for cDNA synthesis. Features: • Speed: Efficiently reverse transcribe poly(A)+ mRNA or total RNA in 15 minutes. • Convenience: PCR-compatible components are provided in optimized volumes for 100 reactions. • Positive Controls: A polyadenylated RNA transcript is provided to help troubleshoot RT-PCR parameters. Storage Conditions: Store at –20°C. Store Positive Control RNA at –70°C. AccessQuick™ RT-PCR System Product Size Cat.# AccessQuick™ RT-PCR System 20 reactions A1701 100 reactions A1702 500 reactions A1703 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The AccessQuick™ RT-PCR System is an easy and convenient master mix for one-tube RT-PCR. The system increases the convenience of performing RT-PCR by combining the following components in a single tube: Tfl DNA Polymerase, dNTPs, magnesium sulfate and reaction buffer. The AMV RT enzyme is provided in a separate tube to allow important no-RT control reactions. The AccessQuick™ Master Mix is simply added to RNA templates in reaction vials, followed by the AMV RT, primers and water. The AccessQuick™ RT-PCR Master Mix is intended for routine RT-PCR applications that have been previously optimized and do not require extreme conditions. Features: • Maximum Convenience: Save yourself four pipetting steps. Simply combine the AccessQuick™ Master Mix, AMV RT, your gene-specific primers, your RNA template and water. Separate AMV RT allows important no-RT control reactions. • Less Template: Amplify zeptomole (10–21mol) levels of RNA. • No Buffer Additions Required: Set up reactions in a single tube, place in the thermal cycler and come back later for results—no additions between the reverse transcription and DNA amplification steps. • Stability: System components are stable over many freeze-thaw cycles. Storage Conditions: Store all system components at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 193 12PCR For complete and up-to-date product information visit: www.promega.com Access RT-PCR System Product Size Cat.# Access RT-PCR Introductory System 20 reactions A1260 Access RT-PCR System 100 reactions A1250 500 reactions A1280 Available Separately Size Conc. Cat.# AMV Reverse Transcriptase 300 u 10 u/µl M5101 1,000 u 10 u/µl M5108 AMV Reverse Transcriptase (HC) 600 u 20–25 u/µl M9004 A1260, A1250, A1280 For Research Use Only. Not for Use in Diagnostic Procedures. M5101, M5108, M9004 For Laboratory Use. Description: The Access RT-PCR System is designed for reverse transcription (RT) and PCR amplification of a specific target RNA from total RNA or mRNA. This one-tube, two-enzyme system provides sensitive, quick and reproducible analysis of even rare RNAs. The system uses AMV Reverse Transcriptase (AMV RT) from Avian Myeloblastosis Virus for first-strand DNA synthesis and thermostable Tfl DNA polymerase from Thermus flavus for second-strand cDNA synthesis and DNA amplification. The Access RT-PCR System includes an optimized single-buffer system that permits extremely sensitive detection of RNA transcripts without buffer additions between the reverse transcription and PCR amplification steps. This simplifies the procedure and reduces the potential for contamination. In addition, the improved performance of AMV Reverse Transcriptase at elevated temperatures in the AMV/Tfl 5X Reaction Buffer minimizes problems encountered with RNA secondary structures. Features: • Maximum Control: Separate tubes of each component allow you to control every step of the reaction. You can optimize Mg2+ and perform no-reverse transcriptase control reactions. • Less Template: Detect message from as little as 1pg of total RNA or mRNA. • No Buffer Additions Required: The AMV/Tfl 5X Reaction Buffer results in optimal enzyme activity without buffer additions between the reverse transcription and DNA amplification steps. • Performance-Tested System: Promega PCR Systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store all system components at –20°C. For long-term storage, the Positive Control RNA with Carrier must be stored at –70°C. AMV Reverse Transcriptase Product Size Conc. Cat.# AMV Reverse Transcriptase 300 u 10 u/µl M5101 1,000 u 10 u/µl M5108 AMV Reverse Transcriptase (HC) 600 u 20–25 u/µl M9004 For Laboratory Use. Description: Avian Myeloblastosis Virus Reverse Transcriptase (AMV RT) catalyzes DNA polymerization using template DNA, RNA or RNA:DNA hybrids. The enzyme requires a primer (DNA primers are more efficient than RNA primers) as well as Mg2+ or Mn2+. The enzyme possesses an intrinsic RNase H activity. Both nonionic detergents and sulfhydryl compounds stabilize the enzyme activity in vitro. Features: • High Concentration: Cat.# M9004 contains 600 units of AMV RT at 20–25u/μl. • 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 250mM KCl, 50mM MgCl2 , 2.5mM spermidine, 50mM DTT. • Temperature Stability: AMV RT is the preferred reverse transcriptase for templates with high secondary structure due to its stability at higher reaction temperatures (37–58°C). Storage Conditions: Store at –20°C. M-MLV Reverse Transcriptase Product Size Conc. Cat.# M-MLV Reverse Transcriptase 10,000 u 200 u/µl M1701 50,000 u 200 u/µl M1705 M-MLV Reverse Transcriptase Buffer Pack 2 × 1 ml M5313 For Laboratory Use. Description: Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is an RNA-dependent DNA polymerase that can be used in cDNA synthesis with long messenger RNA templates (>5kb). The enzyme is a product of the pol gene of M-MLV and consists of a single subunit with a molecular weight of 71kDa. The RNase H activity of M-MLV RT is weaker than that of the commonly used Avian Myeloblastosis Virus (AMV) reverse transcriptase. Features: • Provided with 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 375mM KCl, 15mM MgCl2 , 50mM DTT. • Heat-Inactivated: M-MLV RT is inactivated by heating at 70°C for 10 minutes. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 194 For complete and up-to-date product information visit: www.promega.com M-MLV Reverse Transcriptase, RNase H Minus Product Size Conc. Cat.# M-MLV Reverse Transcriptase, RNase H Minus 10,000 u 100–200 u/µl M5301 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Moloney Murine Leukemia Virus Reverse Transcriptase, RNase H Minus (M-MLV RT [H–]), is an RNA-dependent DNA polymerase that can be used in cDNA synthesis with long messenger RNA templates (>5kb). This form of M-MLV Reverse Transcriptase is genetically altered to remove the associated RNase H activity. Although many researchers are successful in using M-MLV RT (H+) for analytical and some preparative cDNA applications, reverse transcriptases lacking RNase H activity provide another option to prepare long cDNAs and libraries containing a high percentage of full-length cDNA. Features: • RNase H Minus: Provides optimal conditions to prepare full-length cDNA from long RNA templates. • Provided with 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 375mM KCl, 15mM MgCl2 , 50mM DTT. • Heat-Inactivated: M-MLV RT is inactivated by heating at 70°C for 10 minutes. Storage Conditions: Store at –20°C. M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Product Size Cat.# M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant 2,500 u M3681 10,000 u M3682 50,000 u M3683 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Moloney Murine Leukemia Virus Reverse Transcriptase, RNase H Minus (M-MLV RT [H–]), Point Mutant, is an RNA-dependent DNA polymerase that can be used for cDNA synthesis with long RNA templates (>5kb). The lack of RNase H activity is beneficial for this application, as RNase H can start to degrade templates when incubation times are long, as they may be when synthesizing long cDNAs. Although many researchers are successful in using M-MLV RT (H+) for analytical and some preparative cDNA applications, reverse transcriptases lacking RNase H activity provide another option to prepare long cDNAs and libraries containing a high percentage of full-length cDNA. Features: • RNase H Minus: Provides optimal conditions to prepare full-length cDNA from long RNA templates. • Temperature Stability: Thermostability of this point mutant minimizes problems associated with RNA secondary structure. • Increased Polymerase Activity: M-MLV RT (H–), Point Mutant, gives higher yields of cDNA compared with the deletion mutant (Cat.# M5301). • Provided with 5X Reaction Buffer: 250mM Tris-HCl (pH 8.3 at 25°C), 375mM KCl, 15mM MgCl2 , 50mM DTT. • Broad Working Range: More tolerance to variations in enzyme and substrate concentrations means improved consistency in performance. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 195 12PCR For complete and up-to-date product information visit: www.promega.com Deoxynucleotide Triphosphates (dNTPs) Product Size Conc. Cat.# dATP 25 μmol 100 mM U1205 40 μmol 100 mM U1201 200 μmol 100 mM U1202 dGTP 25 μmol 100 mM U1215 40 μmol 100 mM U1211 200 μmol 100 mM U1212 dCTP 25 μmol 100 mM U1225 40 μmol 100 mM U1221 200 μmol 100 mM U1222 dTTP 25 μmol 100 mM U1235 40 μmol 100 mM U1231 200 μmol 100 mM U1232 Set of dATP, dCTP, dGTP, dTTP 10µmol each 100 mM U1330 25 μmol each 100 mM U1420 40µmol each 100 mM U1240 200 μmol 100 mM U1410 For Laboratory Use. Description: High-quality deoxynucleotide triphosphates (dNTPs) are critical for the success of many key procedures such as cDNA synthesis, sequencing and labeling. Promega dNTPs have greater than 99% triphosphate content and are provided at a concentration of 100mM in water at pH 7.5. Features: • Dependable: PCR-tested deoxynucleotides ensure optimal performance with all Promega amplification enzymes. • Consistent: dNTPs are >99% pure, allowing highly consistent results. • Convenient: Supplied at a convenient concentration (100mM in water) for ease-of-use in PCR and other applications. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –30°C to –10°C. Avoid exposure to frequent temperature changes. PCR Amplifications From Each Size of Individual dNTPs. Each catalog number supplies each individual dNTP at 100mM. Reactions are based on 200µM each dNTP in a 50µl reaction. Cat.# Quantity Volume Reactions U1330, U1335 10 µmol each 100 µl each 1,000 U1420 25 µmol each 250 µl each 2,500 U1240, U1245 40 µmol each 400 µl each 4,000 U1410 200 µmol each 2 × 1,000 µl each 20,0009479LA Ribonucleotide Triphosphates (rNTPs) Product Size Conc. Cat.# rATP, rCTP, rGTP, rUTP, each at 10mM in separate tubes 0.5 ml 10 mM P1221 rATP, 10mM 0.5 ml 10 mM P1132 rCTP, 10mM 0.5 ml 10 mM P1142 rGTP, 10mM 0.5 ml 10 mM P1152 rUTP, 10mM 0.5 ml 10 mM P1162 rATP, 100mM 400 μl E6011 rUTP, 100mM 400 μl E6021 rGTP, 100mM 400 μl E6031 rCTP, 100mM 400 μl E6041 rCTP, rATP, rUTP, rGTP, 100mM each 4 × 400 μl E6000 For Laboratory Use. Description: Ribonucleotide Triphosphates (rNTPs) are provided in individual tubes and qualified for use with the Riboprobe® and HeLaScribe® Systems. The rNTPs are supplied in nuclease-free water. Purity is verified by HPLC analysis. Features: • Pretested: rNTPs are tested for functionality with in vitro transcription reactions. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 196 For complete and up-to-date product information visit: www.promega.com Universal RiboClone® cDNA Synthesis System Product Size Cat.# Universal RiboClone® cDNA Synthesis System 1 system C4360 Available Separately Oligo(dT)15 Primer 20 μg C1101 Random Primers 20 μg C1181 Spin Columns 10 each C1281 EcoRI Adaptors 150 pmol C1291 1.2kb Kanamycin Positive Control RNA 5 μg C1381 Sephacryl® S-400 10 ml V3181 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Universal RiboClone® cDNA Synthesis System contains the reagents required for synthesis of double-stranded cDNA from mRNA and subsequent ligation into a suitable vector. The system is based on the method described by Okayama and Berg with modifications by Gubler and Hoffman. First-strand synthesis is driven by AMV (Avian Myeloblastosis Virus) Reverse Transcriptase and either Random Primers or Oligo(dT)15 Primer, followed directly by second-strand replacement synthesis using RNase H and DNA Polymerase I. After treatment with T4 DNA Polymerase to flush the ends, the double-stranded cDNA molecules are prepared for cloning by size fractionation and addition of EcoRI Adaptors. The resulting cDNA preparation then can be cloned into a suitable vector. Features: • Convenient: Contains all of the necessary reagents to synthesize double-stranded cDNA from RNA. • Flexible: Both Oligo(dT)15 Primer and Random Primers are included, providing you a choice of priming methods. Storage Conditions: Store control RNA at –70°C. Store Sephacryl® S-400 at 2–10°C and Spin Columns at room temperature. Store other components at –20°C. Oligonucleotides and Primers: cDNA Synthesis and Cloning Product Size Cat.# Oligo(dT)15 Primer 20 μg C1101 Random Primers 20 μg C1181 EcoRI Adaptors 150 pmol C1291 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Oligo(dT)15 Primer is suitable for use as a primer for first-strand cDNA synthesis with a reverse transcriptase. The primer hybridizes to the poly(A) tail of mRNA. Random Primers can be used for first-strand cDNA synthesis and cloning; they are also available as components of the Universal Riboclone® cDNA Synthesis System (Cat.# C4360) and Reverse Transcription System (Cat.# A3500). The primers are random hexadeoxynucleotides. The EcoRI Adaptors consist of two complementary oligonucleotides: a 16mer and a 12mer phosphorylated at the 5´-end. The oligonucleotides are provided annealed in equimolar concentrations in water. The EcoRI Adaptors attach EcoRI “sticky” ends to blunt-ended DNA. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 197 12PCR For complete and up-to-date product information visit: www.promega.com PCR Cloning pGEM®-T Vector Systems Product Size Cat.# pGEM®-T Vector System I 20 reactions A3600 pGEM®-T Vector System II 20 reactions A3610 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-T Vector Systems are convenient systems to clone PCR products. The pGEM®-T Vector is prepared by cutting the pGEM®-5Zf(+) Vector with EcoRV and adding a 3´ terminal thymidine to both ends. These single 3´-T overhangs at the insertion site greatly improve the ligation efficiency of a PCR product into the plasmid by preventing recircularization of the vector and providing a compatible overhang for ligation of PCR products generated by thermostable polymerases that add a single deoxyadenosine, in a template-independent fashion, to the 3´-ends of amplified fragments. The multiple cloning site is flanked by recognition sites for the restriction enzyme BstZI, allowing release of the insert by a single-enzyme digestion. Alternatively, a double digestion may be used to release the insert from the vector. The pGEM®-T Vector System II contains JM109 Competent Cells in addition to all of the pGEM®-T Vector System I components. Features: • Rapid Ligation: The provided 2X Rapid Ligation Buffer allows reactions to be completed in 1 hour at room temperature. • Blue/White Screening: T7 and SP6 RNA polymerase promoters flank a multiple cloning region within the α-peptide coding region for β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be directly identified by color screening on indicator plates. • f1 Origin of Replication: Allows preparation of single-stranded DNA. Storage Conditions: Store competent cells at –70°C; store all other components at –20°C. ScaI 1875 ori Ampr ApaI AatII SphI BstZI NcoI SacII SpeI NotI BstZI PstI SalI NdeI SacI BstXI NsiI T7 ➞ XmnI 1994 NaeI 2692 lacZ f1 ori 1 start 14 20 26 31 37 46 55 62 62 73 75 82 94 103 112 126 ➞SP6 T T pGEM®-T Vector (3000bp) 0356VA04_3A pGEM®-T Easy Vector Systems Product Size Cat.# pGEM®-T Easy Vector System I 20 reactions A1360 pGEM®-T Easy Vector System II 20 reactions A1380 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pGEM®-T Easy Vector Systems are convenient systems to clone PCR products. They offer all of the advantages of the pGEM®-T Vector Systems with the added convenience of recognition sites for EcoRI and NotI flanking the insertion site. Thus, several options exist to remove the desired insert DNA with a single restriction digestion. The pGEM®-T Easy Vector System II contains JM109 Competent Cells in addition to all of the pGEM®-T Easy Vector System I components. Features: • Flexibility: The multiple cloning site is flanked by restriction enzyme sites for BstZI, NotI and EcoRI, giving you three options to remove the insert with a single digest. • Rapid Ligation: The provided 2X Rapid Ligation Buffer allows reactions to be completed in 1 hour at room temperature. • Blue/White Screening: T7 and SP6 RNA polymerase promoters flank a multiple cloning region within the α-peptide coding region for β-galactosidase. Insertional inactivation of the α-peptide allows recombinant clones to be identified directly by color screening on indicator plates. • f1 Origin of Replication: Allows preparation of single-stranded DNA. Storage Conditions: Store competent cells at –70°C; store all other components at –20°C. ScaI 1890 ori pGEM-T Easy Vector (3015bp) Ampr SpeI EcoRI NotI BstZI PstI SalI NdeI SacI BstXI NsiI T7 XmnI 2009 ➞ NaeI 2707 lacZ f1 ori 1 start 14 20 26 31 37 43 43 49 52 64 70 77 77 88 90 97 109 118 127 141 ➞SP6 T T 1473VA05_6A ApaI AatII SphI BstZI NcoI BstZI NotI SacII EcoRI Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 198 For complete and up-to-date product information visit: www.promega.com pTARGET™ Mammalian Expression Vector System Product Size Cat.# pTARGET™ Mammalian Expression Vector System 20 reactions A1410 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pTARGET™ Mammalian Expression Vector System is a convenient system for cloning PCR products and expressing cloned PCR products in mammalian cells. The vector is prepared by digestion with EcoRV followed by addition of a 3´ terminal thymidine to each end. These single 3´-T overhangs at the insertion site greatly improve the ligation efficiency of a PCR product into the plasmid in two ways. First, the overhangs prevent recircularization of the vector; second, they provide a compatible overhang for PCR products generated by thermostable polymerases that add a single deoxyadenosine, in a template-independent fashion, to the 3´-ends of amplified fragments. The pTARGET™ Vector also contains a modified coding sequence of the α-peptide of β-galactosidase, which allows recombinants to be selected using blue/white screening. The pTARGET™ Vector carries the human cytomegalovirus (CMV) immediate-early enhancer/promoter region to promote constitutive expression of cloned DNA inserts in mammalian cells. This vector also contains the neomycin phosphotransferase gene, a selectable marker for mammalian cells. The pTARGET™ Vector can be used for transient expression or stable expression by selecting transfected cells with the antibiotic G-418. Features: • Simple PCR Cloning: “T” overhangs permit direct ligation of PCR products generated by thermostable enzymes such as Taq DNA polymerase. • Strong, Constitutive Expression: The CMV enhancer/promoter region allows strong, constitutive expression in many cell types. In transgenic mice, expression of the chloramphenicol acetyltransferase (CAT) gene under regulation of the CMV enhancer/promoter was observed in 24 of the 28 tissues examined. The vector is maintained as an episome in cells expressing the SV40 large T antigen, leading to even higher levels of expression. • Blue/White Screening: Allows easy identification of recombinant clones. A single digest removes the insert DNA. • Stable Transfectants: Select for stable transfectants using the neomycin phosphotransferase gene. Storage Conditions: Store competent cells at –70°C; store all other components at –20°C or –70°C. SgfI 664 I-PpoI 851 BglII 5665 SV40 Enhancer/ EarlyPromoter SV40 Late poly (A) Synthetic fl ori poly(A) Ampr ori CMV Enhancer/Promoter Intron Neo pTARGET™ Vector (5670bp) T T EcoRI BamHI NheI XhoI MluI lacZ lacZ SmaI KpnI SalI AccI NotI EcoRI T7 ➞ 1250 1256 1264 1270 1276 1293 1301 1303 1304 1311 1318 T overhangs 1505VA07_6A pTARGET™ Sequencing Primer Product Size Cat.# pTARGET™ Sequencing Primer 2 μg Q4461 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pTARGET™ Sequencing Primer is designed for sequencing inserts cloned into the pTARGET™ Mammalian Expression Vector (Cat.# A1410). The sequencing primer hybridizes to the region of the lacZ gene at nucleotides 1367–1344 on the pTARGET™ Vector. The primer can be used only for sequencing inserts cloned into the pTARGET™ Vector. The primer sequence is not a binding site for any RNA polymerases and cannot be used to generate in vitro transcripts. The sequence of the pTARGET™ Sequencing Primer is 5´-d(TTACGCCAAGTTATTTAGGTGACA)-3´. The primer is supplied at a concentration of 10ng/μl (1.25pmol/μl) in sterile water. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 199 13 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Sequencing DNA Extraction 200 Quantification for NGS 206 Library Preparation for NGS 208 Confirmatory Testing for NGS 209 Sequencing Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 200 For complete and up-to-date product information visit: www.promega.com DNA Extraction Maxwell® HT DNA FFPE Isolation System Product Size Cat.# Maxwell® HT DNA FFPE Isolation System 4 × 96 preps A6372 Available Separately Size Cat.# Buffer A (BWA) 125 ml A6371 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® HT DNA FFPE Isolation System provides a simple and reliable method for high-throughput, rapid isolation of genomic DNA from FFPE (formalin-fixed, paraffin-embedded) tissue samples. The purified DNA can be used directly in a variety of downstream applications, including PCR and next-generation sequencing. The Maxwell® HT DNA FFPE Isolation System purifies nucleic acid using paramagnetic particles, which provide a mobile solid phase to optimize sample capture, washing and purification of gDNA. The use of paramagnetic particles for DNA capture eliminates the need for centrifugation or vacuum manifolds, making the system suitable for full automation. In addition, the system does not require an organic solvent, making it safe and convenient. Features: • Robust, precipitation-free protocol, no chance of lost pellets • High yields of pure DNA from FFPE samples without using xylene or other hazardous chemicals • Ideal for use in downstream applications including qPCR and nextgeneration sequencing (NGS) Storage Conditions: Store at room temperature (15–30°C). Do not refrigerate or freeze any of the reagents. ReliaPrep™ Large Volume HT gDNA Isolation System Product Size Cat.# ReliaPrep™ Large Volume HT gDNA Isolation System 1 each A2751 HSM 2.0 Instrument 1 each A2715 Alkaline Protease (APA) 130 ml A1721 Cell Lysis Buffer (CLD) 1,400 ml A1731 160 ml A1732 Binding Buffer (BBA) 1,600 ml A1741 200 ml A1742 ReliaPrep™ Resin 115 ml A1752 5.5 ml A1753 Prepared Wash Buffer (WBC) 3,500 ml A2681 Proteinase K (PK) Solution 23 ml A5051 Nuclease-Free Water 500 ml P1197 Available Separately Size Conc. Cat.# RNase A Solution 5 ml 4 mg/ml A7974 20X TE Buffer (pH 7.5) 25 ml A2651 Tissue Lysis Buffer (TLA) 500 ml A5091 Nuclease-Free Water 1,000 ml P1199 Integrated Reagent Caps 4 /pk A2701 HSM 2.0 Instrument Cover 1 each A2712 HSM 2.0 Tube Rack 1 each A2713 HSM 2.0 Tube Rack Stand 1 each A2714 HSM 2.0 Instrument 1-Year Service Agreement 1 each SA1330 ReliaPrep™ LV 32 HSM Standard Service Agreement 1 each SA3070 Bottle for 50% Ethanol 1 each A2691 A2751, A7974, A2651, A2715, A1721, A5091, A1731, A1732, P1199, A1741, A1742, A2701, A1752, A1753, A2712, A2681, A2713, A2714, A5051, P1197, SA3070, A2691 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ Large Volume HT gDNA Isolation System isolates genomic DNA (gDNA) from 1–10ml of blood in a scalable format. The chemistry eliminates tedious centrifugation steps as well as the use of hazardous chemicals, which are inherent in precipitation-based chemistries. Each reagent kit provides enough reagents to process up to 96 × 10ml whole blood samples. The system has been automated on robotic liquid-handling workstations, allowing walkaway purification of genomic DNA from 1–10ml of whole blood, regardless of sample storage or shipping conditions. For low-throughput isolation of gDNA from up to 32 samples at one time, the HSM 2.0 can be used in a manual mode, where the user performs the pipetting functions. The HSM has software that controls the instrument and directs the user through the purification protocol. Features: • Decrease Hands-On Time: Automation reduces operator time spent on instrument setup and takedown by allowing walkaway operation for large numbers of samples at one time. • Remove Protocol Bottlenecks: Heater Shaker Magnet eliminates the need to move samples on the robot deck, reducing instrument failures; precipitation-free chemistry dramatically reduces purification failures. • Achieve Peace of Mind: Automated liquid level sensing with operator notification allows recovery of samples in case of error. • Isolate Pure DNA from All Samples: Purification chemistry is equally effective at recovering DNA from pristine as well as challenged (hemolysed or frozen) samples. • Save a Day or Two of Processing: Samples are eluted in buffer, ready for use in downstream assays or archiving, eliminating resuspension of pelleted DNA, which can take 24–48 hours. • Reduce Waste: Chemistry is automatically scaled for each sample and plastic use is conserved, reducing liquid and solid waste during sample runs. Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 201 13Sequencing For complete and up-to-date product information visit: www.promega.com Maxwell® HT 96 gDNA Blood Isolation System Product Size Cat.# Maxwell® HT 96 gDNA Blood Isolation System 1 × 96 preps A2670 4 × 96 preps A2671 Available Separately Size Conc. Cat.# Heat Block Adapter 1 each A2661 RNase A Solution 5 ml 4 mg/ml A7974 25mM Tris-HCl (pH 8.0) 60 ml A2641 10mM EDTA (pH 8.0) 10 ml A2631 20X TE Buffer (pH 7.5) 25 ml A2651 Wash Buffer (WBA) 500 ml A1761 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® HT 96 gDNA Blood Isolation System provides a simple and reliable method for the rapid isolation of gDNA in a multiwell format. gDNA may be purified from blood and Oragene®•Discover sample collection devices. The purified gDNA can be used directly in PCR assays, microarrays and next-generation sequencing applications. The use of paramagnetic particles for DNA capture eliminates the need for centrifugation or vacuum manifolds, making the system suitable for full automation. In addition, the system does not require an organic solvent, making it safe and convenient. DNA yields of up to 12µg are expected from input blood volumes of 350µl, depending on the WBC count of the sample. Saliva samples can have variable amounts of gDNA, and up to 18µg or more of DNA may be recovered from a 700µl Oragene® collection device sample. Features: • Improve Productivity: Walkaway automation of genomic DNA extraction. • Eliminate Sample Rework: Robust, precipitation-free protocol, no chance of “lost pellets”. • Simplify Workflow: High yields of pure DNA from pristine and challenged or hemolysed samples. • Reduce Time to Results: Pure gDNA ready for demanding applications; samples in solution; no resuspension required. Storage Conditions: Store at 15–30°C. ReliaPrep™ gDNA Tissue Miniprep System Product Size Cat.# ReliaPrep™ gDNA Tissue Miniprep System 100 preps A2051 250 preps A2052 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ gDNA Tissue Miniprep System provides a complete, ready-to-use method for purification of gDNA from up to 25mg of tissue, a buccal (cheek) swab, or a 1cm mouse tail snip, obtaining intact gDNA without the use of ethanol washes or precipitations. Features: • Easy to Use: Reagents are supplied “ready-to-use”; no additions required. • Save Time: Eluted DNA obtained in 30 minutes or less (hands-on time). • No Ethanol: Eliminates alcohol inhibition and carryover. • Pure gDNA: Improved A260/A230 ratios vs. the leading competitor. • Peace of Mind: Consistent results from run to run and between users. • Concentrated DNA: Good recovery and purity in as little as 50μl elution. Storage Conditions: Store at 15–30°C. MagaZorb® DNA Mini-Prep Kit Product Size Cat.# MagaZorb® DNA Mini-Prep Kit 200 preps MB1004 800 preps MB1008 Available Separately Size Conc. Cat.# Proteinase K (PK) Solution 16 ml 20 mg/ml MC5008 20-Position Microcentrifuge Tube Magnetic Separator 1.5 ml CD4002 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagaZorb® DNA Kit provides an easy, fast and cost-effective technique for isolating PCR-quality DNA. Using one simple protocol, a high yield of purified DNA can be isolated from a wide variety of sources including whole blood (fresh or frozen, citrate-, heparin- or EDTA-treated), buffy coat, leukocytes, milk, seminal fluid, dried blood spots, cultured cells, tissue (fresh, frozen or formalin-fixed paraffin-embedded), saliva, urine, stool, hair, buccal swabs and vaginal swabs. The 20-Position Microcentrifuge Tube Magnetic Separator (Cat.# CD4002) utilizes a microcentrifuge tube rack that can be removed from the high-strength magnets for wash steps or incubation in a water bath. The rack is designed to hold the microcentrifuge tubes so that they will not fall out even when turned upside down, and it can withstand temperatures of up to 80°C for convenient manipulation of sample tubes. Please note that the magnets in the 20-Position Microcentrifuge Tube Magnetic Separator are designed specifically for use with the MagaZorb® DNA Kit; separation may not work with other particles. Features: • Convenient: Contains all needed reagents so that no reagent preparation is required. • Efficient: Eliminates centrifugation, vacuum filtration or column separation, increasing sample throughput and improving reproducibility. • Safe: Does not require organic solvents, eliminating the need for special storage or waste disposal. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 202 For complete and up-to-date product information visit: www.promega.com Wizard® Magnetic 96 DNA Plant System Product Size Cat.# Wizard® Magnetic 96 DNA Plant System 2 × 96 preps FF3760 4 × 96 preps FF3761 Available Separately Wash Buffer, Plant 40 ml A3811 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® Magnetic 96 DNA Plant System is designed for manual or automated 96-well, high-throughput purification of DNA from plant leaf and seed tissue. The system has been validated with corn and tomato leaf, as well as with canola and sunflower seeds. The DNA purified from these samples can be used in PCR as well as more demanding applications such as RAPD analysis. Unlike column-based systems, the binding of nucleic acids to magnetic particles can occur in solution, enhancing contact with the wash buffer and increasing nucleic acid purity. Protocols are available for Beckman Coulter instruments. Features: • Improved Productivity: Manual and automated 96-well protocols cut purification time compared to CTAB extraction. • Ease of Handling: Eliminates organic extractions, multiple centrifugations and cumbersome filter plates. • Confidence in Applications Performance: Validated for both leaf and seed tissue by PCR and RAPD analysis. • Automation: Validated automated methods available at: www.promega.com/automethods/ • Your Choice of Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. Wizard® Magnetic DNA Purification System for Food Product Size Cat.# Wizard® Magnetic DNA Purification System for Food 200 preps FF3750 400 preps FF3751 Available Separately Lysis Buffer A, Food 100 ml A8191 Lysis Buffer B, Food 100 ml Z3191 Precipitation Solution, Food 150 ml Z3201 A8191, Z3191, Z3201 For Research Use Only. Not for Use in Diagnostic Procedures. FF3750, FF3751 For in vitro use only. Description: The Wizard® Magnetic DNA Purification System for Food is designed for purification of DNA from a variety of food samples including corn seeds, cornmeal, soybeans, soy flour and soy milk. Processed food, such as corn chips, chocolate and chocolate-containing foods, lecithin and vegetable oils may also be used with the suggested protocol variations. The DNA purified from these samples can be used in PCR-based testing for genetically modified organism (GMO) DNA sequences. Features: • Improved Productivity: Obtain results in one-third the time of current methods. • Ease of Handling: Requires minimal centrifugation and eliminates organic extractions. • Versatility and Robustness: Validated with a broad variety of foodstuffs, including difficult samples such as lecithin and vegetable oils. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 203 13Sequencing For complete and up-to-date product information visit: www.promega.com Maxwell® RSC System DNA Purification Kits Product Size Cat.# Maxwell® RSC Blood DNA Kit 48 preps AS1400 Maxwell® RSC Whole Blood DNA Kit 48 preps AS1520 Maxwell® RSC DNA FFPE Kit 48 preps AS1450 Maxwell® RSC FFPE Plus DNA Kit 48 preps AS1720 Maxwell® RSC Cell DNA Purification Kit 48 preps AS1370 Maxwell® RSC ccfDNA Plasma Kit 48 preps AS1480 Maxwell® RSC Buccal Swab DNA Kit 48 preps AS1640 Maxwell® RSC Stabilized Saliva DNA Kit 48 preps AS1630 Maxwell® RSC Tissue DNA Kit 48 preps AS1610 Maxwell® RSC Cultured Cells DNA Kit 48 preps AS1620 Maxwell® RSC Buffy Coat DNA Kit 48 preps AS1540 Maxwell® RSC Plant DNA Kit 48 preps AS1490 Maxwell® RSC PureFood GMO and Authentication Kit 48 preps AS1600 Maxwell® RSC PureFood Pathogen Kit 48 preps AS1660 Available Separately Maxwell® RSC Instrument 1 each AS4500 RSC/CSC Deck Tray 1 each SP6019 Maxwell® Instrument Bar Code Reader 1 each AS3200 Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 CTAB Buffer 100 ml MC1411 AS1600, AS1660, MC1411 Not For Medical Diagnostic Use. All others For Research Use Only. Not for Use in Diagnostic Procedures. Description: These kits can be used for automated DNA purification with the Maxwell® RSC Instrument: Maxwell® RSC Blood DNA Kit • Extracts DNA from whole blood or buffy coat samples in 30–40 minutes. • Processes up to 400µl of whole blood. • Yields up to 15µg of gDNA, depending on white blood cell count. Maxwell® RSC Whole Blood DNA Kit • Extracts DNA from 50–500µl of whole blood in less than 40 minutes. • Simple, walkaway protocol with no preprocessing. • Compatible with blood stored in EDTA, heparin and citrate anticoagulants. Maxwell® RSC DNA FFPE Kit • Extracts amplifiable DNA from FFPE tissue sections. • Eliminates the use of hazardous organic solvents. • Purified DNA performs better in downstream applications. Maxwell® RSC FFPE Plus DNA Kit • Purifies DNA from 1–48 (5µm) FFPE samples • Faster digestion option without organic solvents • Sufficient yield for downstream amplification Maxwell® RSC Cell DNA Purification Kit • Extracts DNA from samples containing less than 10,000 cells. • Compatible with low-cell-number samples such as amniotic fluid, cerebral spinal fluid and cell supernatants. • Cells are collected and processed in up to 400μl volumes, and extraction is complete in about 30 minutes. Maxwell® RSC ccfDNA Plasma Kit • Simple, walkaway protocol with no preprocessing. • Provides high yields of pure and amplifiable ccfDNA. • Scalable protocol, process ccfDNA from 0.2–1ml of plasma. Maxwell® RSC Buccal Swab DNA Kit • Optimized reagents for buccal swab extraction. • Decreased hands-on time with simple protocol. • Consistent results with sufficient DNA for HLA assays. Maxwell® RSC Stabilized Saliva DNA Kit • Simple protocol with optimized reagents. • Consistent DNA yields. • DNA ready to use in downstream assays such as HLA typing. Maxwell® RSC Tissue DNA Kit • Extracts DNA from up to 50mg of mammalian tissue. • Purifies high yields of amplifiable DNA. • Automated protocol improves efficiency. Maxwell® RSC Cultured Cells DNA Kit • Extracts DNA from up to 5 × 106 mammalian tissue culture cells and 2 × 109 bacterial cells. • Simple, walkaway protocol requires no sample preprocessing. • Purified DNA is ready for analysis in about 45 minutes. Maxwell® RSC Buffy Coat DNA Kit • Purifies high yields of DNA from 50–250µl of buffy coat samples in about 50 minutes. • Simple walkaway protocol with no preprocessing. • Compatible with blood stored in EDTA, heparin and citrate anticoagulants. Maxwell® RSC Plant DNA Kit • Extracts DNA from a range of plant tissues, including soybean, corn and Arabidopsis. • Consistent purification, no organic extractions and minimal preprocessing. • Purified DNA is ready to use in downstream applications including amplification assays. Maxwell® RSC PureFood GMO and Authentication Kit • Purifies high-quality DNA from a range of food and feed samples. • Results in highly concentrated DNA that is ready to use in downstream assays. • Simple, five-step protocol saves time and eliminates organic extraction steps. Maxwell® RSC PureFood Pathogen Kit • Isolate DNA from raw or processed food samples • Works well with inhibiting sample types • No need for labor-intensive sample processing Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 204 For complete and up-to-date product information visit: www.promega.com ReliaPrep™ FFPE gDNA Miniprep System Product Size Cat.# ReliaPrep™ FFPE gDNA Miniprep System 10 reactions A2351 100 reactions A2352 Available Separately Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ FFPE gDNA Miniprep System provides a complete, all-inclusive method for purifying quality genomic DNA from formalin-fixed paraffin-embedded tissue without using hazardous solvents or overnight digestion. Genomic DNA can be isolated from FFPE tissue in approximately two and one-half hours with minimal hands-on time. Features: • Isolate Quality, Intact gDNA: Optimized lysis and binding conditions reverse modifications introduced by the fixation process, resulting in intact, amplifiable gDNA. • Safely Deparaffinize Your Sample: Deparaffinization step occurs without harsh organic solvents. • Save Time: Purify gDNA from FFPE tissue in less than two and one-half hours with minimal hands-on time. No overnight digestion required. • Easy to Use: Minimal preparation time; simply add ethanol and go! Storage Conditions: Store at room temperature. ReadyAmp™ Genomic DNA Purification System Product Size Cat.# ReadyAmp™ Genomic DNA Purification System 100 reactions A7710 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReadyAmp™ Genomic DNA Purification System yields single-stranded DNA (ssDNA) from whole blood or blood stains that may be used directly in amplification reactions without further manipulation. The process takes less than one hour and requires no organic extractions or ethanol precipitations. Features: • Simple and Effective: ReadyAmp™ resin removes PCR inhibitors. • Convenient: Isolated DNA can be used directly in PCR amplifications. Storage Conditions: Store at 22–25°C. ReliaPrep™ Blood gDNA Miniprep System Product Size Cat.# ReliaPrep™ Blood gDNA Miniprep System 100 preps A5081 250 preps A5082 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ Blood gDNA Miniprep System provides a complete, ready-to-use method for purification of gDNA from up to 200μl of blood or body fluid, consistently isolating pure, intact gDNA without the use of alcohol washes or precipitations. Genomic DNA can be prepared from fresh or frozen blood in less than 40 minutes with expected DNA yields of 4–10μg, depending on the white blood cell count of the blood sample. Features: • Easy to Use: Reagents are supplied “ready to go”; no additions required. • Save Time: Eluted DNA obtained in 30 minutes or less. • No Ethanol: Eliminates alcohol inhibition and carryover. • Pure gDNA: Improved A260/A230 ratios vs. the leading competitor. • Peace of Mind: Consistent results from run to run and between users even with hemolyzed samples. • Concentrated DNA: Good recovery and purity in as little as 50μl elution. Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 205 13Sequencing For complete and up-to-date product information visit: www.promega.com Wizard® SV 96 Genomic DNA Purification System Product Size Cat.# Wizard® SV 96 Genomic DNA Purification System 1 × 96 preps A2370 4 × 96 preps A2371 Available Separately Size Conc. Cat.# Wizard® SV Lysis Buffer 50 ml Z3052 Column Wash Solution (CWA) 185 ml A1311 Nuclei Lysis Solution 50 ml A7941 EDTA, 0.5M (pH 8.0), Molecular Biology Grade 100 ml V4231 RNase A Solution 1 ml 4 mg/ml A7973 Wizard® SV 96 Binding Plates 10 pack A2271 A2370, Z3052, A2371, A6780, A7941, A6782, V4231, A6784, A7973, A2271 For Research Use Only. Not for Use in Diagnostic Procedures. A1311 For Laboratory Use. Description: The Wizard® SV 96 Genomic DNA Purification System provides a high-throughput, membrane-based technique for consistent preparation of genomic DNA from cultured cells and tissue, including mouse tails. Amplifiable genomic DNA can be isolated from up to 5 × 106 cells, 20mg of tissue or up to 1.2cm of a mouse tail tip without a centrifugation clearing step. With the Wizard® SV Genomic DNA purification system, genomic DNA is purified from cell lysates using 96-well vacuum filtration. Washing the bound DNA requires no disassembly of the manifold, and filtrate waste products are delivered directly to a vacuum trap, eliminating the need to empty waste collection trays. The Wizard® SV Genomic DNA Purification System is designed for use either in a manual format or with Beckman Coulter or PerkinElmer automated instruments. Features: • Improve Productivity: Obtain genomic DNA from mouse tails in 45–60 minutes, genomic DNA from cultured cells in 30 minutes. No spins required. • Achieve High Yield: Purify 20–30μg of DNA per prep from 1.2cm of mouse tail. • Gain Confidence in Applications: Purified DNA ready for amplification. • Automate This Assay: Validated automated methods available at: www.promega.com/automethods/ • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 22–25°C. Wizard® SV Genomic DNA Purification System Product Size Cat.# Wizard® SV Genomic DNA Purification System 50 preps A2360 250 preps A2361 Available Separately Size Conc. Cat.# Wizard® SV Lysis Buffer 50 ml Z3052 Column Wash Solution (CWA) 185 ml A1311 Nuclei Lysis Solution 50 ml A7941 EDTA, 0.5M (pH 8.0), Molecular Biology Grade 100 ml V4231 RNase A Solution 1 ml 4 mg/ml A7973 Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 A2360, Z3052, A2361, A6770, A7941, A6772, V4231, A6774, A7973, V1231, V4741 For Research Use Only. Not for Use in Diagnostic Procedures. A1311 For Laboratory Use. Description: The Wizard® SV Genomic DNA Purification System provides a fast, simple, membrane-based technique for preparing genomic DNA from cultured cells and tissue, including mouse tails. Genomic DNA can be purified from cultured cells in about 20 minutes. Isolation from tissue or mouse tails requires an overnight digestion with Proteinase K (Cat.# V3021). Amplifiable genomic DNA can be isolated from up to 5 × 106 cells, 20mg of tissue or up to 1.2cm of a mouse tail tip without a centrifugation clearing step. The Wizard® SV Genomic DNA Purification System can be used in either a microcentrifuge (spin) or vacuum protocol. Up to 20 samples can be processed at once in the vacuum format with the Vac-Man® Laboratory Vacuum Manifold (Cat.# A7231) and the Vacuum Adapters (Cat.# A1331). Features: • Improved Productivity: Obtain genomic DNA approximately 20 minutes after lysis. • High Yield: Purify 20–30μg of DNA per prep from 1.2cm mouse tail. • Format Choice: Perform purification by either spin or vacuum formats. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 206 For complete and up-to-date product information visit: www.promega.com Quantification for NGS ProNex® NGS Library Quant Kit Product Size Cat.# ProNex® NGS Library Quant Kit 500 reactions NG1201 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ProNex® NGS Library Quant Kit contains reagents to determine the concentration of next-generation-sequencing libraries compatible with Illumina platforms using qPCR. Data generated using the ProNex® NGS Library Quant Kit can be used to normalize the DNA concentration for sequencing libraries to the desired concentration prior to multiplex pooling of samples. This is the most consistent NGS library quantitation kit you can get. Features: • Measure intact, functional library concentration • BRYT Green® dye-based qPCR system for maximum reproducibility • Ideal for multiplexed pooling of Illumina libraries Storage Conditions: Store at –30°C to –10°C in a nonfrost-free freezer protected from light. ProNex® DNA QC Assay Product Size Cat.# ProNex® DNA QC Assay BioRad CFX96™ 200 reactions NG1004 ProNex® DNA QC Assay BioRad CFX96™ 800 reactions NG1005 ProNex® DNA QC Assay ABI 7500/7500FAST 200 reactions NG1002 ProNex® DNA QC Assay ABI 7500/7500FAST 800 reactions NG1003 ProNex® DNA QC Assay Calibration Kit 1 each NG1001 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ProNex® DNA QC Assay evaluates the quality and quantity of genomic DNA extracted from formalin-fixed paraffin-embedded (FFPE) samples or other potentially degraded DNA sources. It is a human-specific, multiplexed, probe-based quantitative polymerase chain reaction (qPCR) assay that may also be used to evaluate the ratio of circulating cell-free DNA (ccfDNA) to higher molecular weight genomic DNA in plasma samples. The multiplex assay detects 75bp, 150bp and 300bp human genomic DNA sequences, and it includes an internal positive control (IPC) to test for false-negative results that may occur in the presence of PCR inhibitors. Features: • Integrated Instrumentation and Assay: The QuantiFluor® dyes are optimized for high sensitivity, broad dynamic range and target specificity on the Quantus™ Fluorometer. • Human-specific, multiplexed, probe-based qPCR assay with internal positive control. • Detect 75bp, 150bp and 300bp human genomic DNA sequences. • Evaluate your samples for amplifiability and predict downstream assay success. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 207 13Sequencing For complete and up-to-date product information visit: www.promega.com Quantus™ NGS Starter Package Product Size Cat.# Quantus™ NGS Starter Package 1 each E5150 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Quantus™ NGS Starter Package provides highly sensitive, easy-to-use DNA quantitation for NGS applications, all in one discounted bundle. Contents include a Quantus™ Fluorometer (Cat.# E6150); QuantiFluor® ONE dsDNA System (Cat.# E4870) and enough 0.5ml assay tubes for 500 reactions. The Quantus™ Fluorometer is a compact and easy-to-operate instrument designed for sensitive fluorescence detection of nucleic acids. The fluorometer is optimized with preprogrammed settings for Promega QuantiFluor® Dye Systems (QuantiFluor® dsDNA, RNA, ssDNA Systems) for nucleic acid quantitation and allows you the flexibility to create your own methods and quantitation settings for other dyes. The QuantiFluor® ONE dsDNA System provides a fluorescent double-stranded DNA-binding dye in an “add-and-read” format for both dye and standard, simplifying DNA quantitation and speeding up your workflow. It’s as easy to use as NanoDrop® absorbance-based methods but much more sensitive for low-concentration samples. Features: • Integrated Instrumentation and Assay: The QuantiFluor® dyes are optimized for high sensitivity, broad dynamic range and target specificity on the Quantus™ Fluorometer. • Easy to Use: Add-and-read format makes measuring low concentrations of dsDNA simple—no dilutions, no extra tubes. • Increased Sensitivity: Significantly increased sensitivity over absorbance at 260nm (NanoDrop spectrophotometer) for those samples that are low in concentration. • High Specificity to dsDNA: Minimal binding to ssDNA, RNA, protein and interfering compounds. • Cost Effective: Easily incorporate into your laboratory. • Used for Next-Gen Sequencing: Successfully used in several NGS systems including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. Storage Conditions: Store QuantiFluor® ONE dsDNA Dye and QuantiFluor® ONE Lambda DNA at –30°C to +10°C. Store 1X TE Buffer at –30°C to +30°C. QuantiFluor® ONE dsDNA System Product Size Cat.# QuantiFluor® ONE dsDNA System 100 reactions E4871 500 reactions E4870 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 160. QuantiFluor® dsDNA System Product Size Cat.# QuantiFluor® dsDNA System 1 ml E2670 QuantiFluor® dsDNA Sample Kit 1 each E2671 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 160. QuantiFluor® ssDNA System Product Size Cat.# QuantiFluor® ssDNA System 1 ml E3190 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 161. QuantiFluor® RNA System Product Size Cat.# QuantiFluor® RNA System 1 ml E3310 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 161. Quantus™ Fluorometer Product Size Cat.# Quantus™ Fluorometer 1 each E6150 E6150 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 297. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 208 For complete and up-to-date product information visit: www.promega.com Library Preparation for NGS ProNex® Size-Selective Purification System Product Size Cat.# ProNex® Size-Selective Purification System 10ml NG2001 125ml NG2002 500ml NG2003 Available Separately Size Cat.# Wash Buffer 340ml NG1051 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ProNex® Size-Selective Purification System enables the rapid and efficient magnetic resin-based purification of double-stranded DNA (dsDNA) for next-generation sequencing (NGS), polymerase chain reaction (PCR) and general molecular biology applications. The ProNex® System allows users to select the desired size of purified dsDNA fragments, from 100bp to 750bp. The novel reagent formulation provides significantly improved selectivity, reproducibility and yield relative to traditional dsDNA purification methods. In addition, the ProNex® System can be used in both manual and automated high-throughput workflows. Features: • High specificity of size selection with low carryover of unwanted DNA • Exceptional DNA recovery • Fast magnetic response time and low viscosity for accurate pipetting Storage Conditions: Upon receipt, remove the ProNex® Chemistry bottle(s) from the kit package and store at 2–10°C. Do not freeze. Do not allow ProNex® Chemistry to dry during storage. Store the remaining kit components at 15–30°C. Wizard® SV Gel and PCR Clean-Up System Product Size Cat.# Wizard® SV Gel and PCR Clean-Up System 50 preps A9281 250 preps A9282 1,000 preps A9285 Wizard® SV Gel and PCR Clean-Up System and x-tracta™ Gel Extractor Bundle 50 preps/25 extractors A9283 250 preps/100 extractors A9284 Available Separately Membrane Binding Solution 20 ml A9301 Vacuum Adapters 20 each A1331 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Wizard® SV Gel and PCR Clean-Up System is designed to extract and purify DNA fragments of 100bp to 10kb from standard or low-melting agarose gels or to purify products directly from PCR and other common reactions such as restriction digests. Up to 95% recovery is achieved depending upon the DNA fragment size. PCR products are commonly purified to remove excess nucleotides and primers. This membrane-based system, which can bind up to 40μg of DNA, allows recovery of isolated DNA fragments or PCR products in as little as 15 minutes, depending on the number of samples processed. The purified DNA can be used for automated fluorescent DNA sequencing, cloning, labeling, restriction enzyme digestion or in vitro transcription/translation without further manipulation. Features: • Improved Productivity: Purify DNA fragments or PCR products in as little as 15 minutes. • Enhanced Cloning Results: Up to 95% recovery eluted in as little as 15μl. • Confidence in Results: Purified DNA routinely achieves 700 bases with >98% accuracy in automated fluorescent sequencing. • Applications Tested: DNA is suitable for automated fluorescent sequencing, cloning, labeling, restriction enzyme digestion or in vitro transcription/ translation without further manipulation. • One System to Do It All: One system can replace up to four kits from other suppliers. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 209 13Sequencing For complete and up-to-date product information visit: www.promega.com RNasin® Ribonuclease Inhibitors Product Size Conc. Cat.# RNasin® Ribonuclease Inhibitor 2,500 u 20–40 u/µl N2111 10,000 u 20–40 u/µl N2115 Recombinant RNasin® Ribonuclease Inhibitor 2,500 u 20–40 u/µl N2511 10,000 u 20–40 u/µl N2515 RNasin® Plus RNase Inhibitor 2,500 u 40 u/µl N2611 10,000 u 40 u/µl N2615 N2111, N2115 For Research Use Only. Not for Use in Diagnostic Procedures. N2511, N2515, N2611, N2615 For Laboratory Use. For additional information see page 122. Genomic DNA Product Size Cat.# Human Genomic DNA: Male 100 μg G1471 Human Genomic DNA: Female 100 μg G1521 Human Genomic DNA 100 μg G3041 Mouse Genomic DNA 100 μg G3091 G1471, G1521, G3041 For Laboratory Use. G3091 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 281. Confirmatory Testing for NGS GoTaq® Real-Time qPCR and RT-qPCR Systems for Probe-Based Detection Product Size Cat.# GoTaq® Probe qPCR Master Mix 2 ml A6101 10 ml A6102 GoTaq® Probe 2-Step RT-qPCR System 2 ml A6110 GoTaq® Probe 1-Step RT-qPCR System 2 ml A6120 12.5 ml A6121 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GoTaq® Probe qPCR Master Mix is optimized for quantitative PCR assays in the hydrolysis probe detection format. It is provided as a ready-to-use, stabilized 2X formulation that includes all components for qPCR (except template, primers and probe). This master mix does not contain a reference dye; however, a separate tube of carboxy-X-rhodamine (CXR) reference dye is included with this system, allowing users to add reference dye to amplification reactions if desired. The GoTaq® Probe qPCR Master Mix provides resistance to a wide range of PCR inhibitors. This formulation uses antibody-mediated hot-start chemistry, allowing reaction setup to be performed at room temperature. The master mix also employs rapid hot-start activation and processive enzymes, making it compatible with both standard and fast instrument cycling programs. The GoTaq® Probe 2-Step RT-qPCR System is optimized for quantitative PCR assays in the hydrolysis probe detection format. The system protocol facilitates detection and relative quantification of RNA expression levels via a two-step RT-qPCR method using integrated components: • GoScript™ Reverse Transcription System • GoTaq® Probe qPCR Master Mix The GoScript™ Reverse Transcription System includes an optimized reaction buffer and reverse transcriptase that enable efficient synthesis of first-strand cDNA in preparation for PCR amplification. The cDNA product may be added directly to downstream qPCR amplification reactions. The GoTaq® Probe 1-Step RT-qPCR System is optimized for quantitative PCR assays in the hydrolysis probe detection format. The system enables detection and relative quantification of RNA expression levels using a one-step RT-qPCR method, combining GoScript™ Reverse Transcriptase and GoTaq® Probe qPCR Master Mix in single-step real-time amplification reactions. The GoScript™ RT Mix for 1-Step RT-qPCR (50X) combines optimized amounts of GoScript™ Reverse Transcriptase, RNasin® Plus RNase Inhibitor, dUTP and additives to enhance single-step reactions. Features: • Superior Performance: Sensitive detection on any real-time instrument. • Enhanced Stability: Exceptional room-temperature setup makes it suitable for automation and high-throughput detection. • Versatility: Compatible with both fast and standard cycling methods. • Confidence: The Promega PCR Performance Guarantee. Storage Conditions: Store all components between –30°C and –10°C. Protect components from light at all times. For best results, mix thawed solutions gently to minimize aeration and foaming, and keep on ice. For short-term storage and frequent use, the GoTaq® qPCR Master Mix, 2X, may be kept at 2–8°C for up to 3 months if protected from light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 210 For complete and up-to-date product information visit: www.promega.com GoTaq® Real-Time qPCR and RT-qPCR Systems for Dye-Based Detection Product Size Cat.# GoTaq® qPCR Master Mix 5 ml A6001 25 ml A6002 GoTaq® 2-Step RT-qPCR System 5 ml A6010 GoTaq® 1-Step RT-qPCR System 5 ml A6020 Available Separately CXR Reference Dye 100 μl C5411 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GoTaq® qPCR Master Mix is a ready-to-use 2X master mix for use in real-time quantitative PCR (qPCR and RT-qPCR). The system contains BRYT Green® dye, a novel fluorescent DNA-binding dye with minimal PCR inhibition for maximum PCR efficiency and greater fluorescence enhancement upon binding to double-stranded DNA (dsDNA) than SYBR® Green I. Containing the GoTaq® Hot Start Polymerase, optimized buffer and proprietary dye, the GoTaq® qPCR Master Mix provides robust real-time PCR with earlier quantification cycle values and broad range detection for increased reliability, reproducibility and sensitivity. The GoTaq® 2-Step RT-qPCR System is a reagent system for quantitative analysis of RNA using a two-step reverse transcription-quantitative PCR (RT-qPCR) protocol. The components and protocol allow robust, reliable cDNA synthesis of a full range of rare and abundant transcripts, even in the presence of inhibitors, using the GoScript™ Reverse Transcription System and quantification using the GoTaq® qPCR Master Mix. The GoTaq® 1-Step RT-qPCR System is a reagent system for quantitative analysis of RNA using a one-step reverse transcription-quantitative PCR (RT-qPCR) protocol in a single tube. The BRYT Green® Fluorescent Dye and optimized buffer formulations improve data accuracy and sensitivity of low-level targets. Features: • Brighter Signal: Sensitive detection for earlier quantitation of low- and high-copy-number targets. • Enhanced Stability: Exceptional room-temperature setup makes it suitable for automation and high-throughput detection. • Versatility: Compatible with both fast and standard qPCR cycling methods. • Robustness: High-efficiency, full-length cDNA synthesis in the presence of inhibitors. • Confidence: The Promega PCR Performance Guarantee. Storage Conditions: Upon arrival, store all components at –30 to –10°C, protected from light. For immediate use, components may be stored at 2–8°C, protected from light, for up to 3 months. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 211 14 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Vectors Cloning, Subcloning and Transcription Vectors 212 Protein Expression Vectors 216 Reporter Vectors 224 Vectors Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 212 For complete and up-to-date product information visit: www.promega.com Cloning, Subcloning and Transcription Vectors pBR322 Vector Product Size Conc. Cat.# pBR322 Vector 10 μg 1 µg/µl D1511 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The plasmid pBR322 Vector (4,361bp) carries the genes for tetracycline and ampicillin resistance. pBR322 DNA digests typically are used as molecular weight size markers in gel analysis of nucleic acids. Storage Conditions: Store at –20°C. 0270VA05_2A PvuII 2066 pBR322 Vector (4,361bp) Ampr ori PvuI 3736 ScaI 3846 SphI 566 Tet r EcoRI 4359 HindIII 29 EcoRV 187 BamHI 375 SalI 651 BstZI 939 StyI 1369 PstI 3611 pGEM®-3Z Vector Product Size Cat.# pGEM®-3Z Vector 20 μg P2151 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 127. 0278VA05_4A ScaI 1818 AatII 2260 NdeI 2509 ori pGEM-3Z Vector (2,743bp) Ampr EcoRI SacI KpnI AvaI XmaI SmaI BamHI XbaI SalI AccI HincII PstI SphI HindIII SP6 T7 1 start 5 15 21 21 21 23 26 32 38 39 40 48 54 56 69 ➞ ➞ XmnI 1937 SspI 2142 NarI 2561 lacZ pGEM®-3Zf(+/–) Vectors Product Size Cat.# pGEM®-3Zf(+) Vector 20 μg P2271 pGEM®-3Zf(–) Vector 20 μg P2261 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 127. 0282VC05_4A ScaI 1818 AatII 2260 NdeI 2509 ori pGEM®-3Zf(+) Vector (3,197bp) Ampr EcoRI SacI KpnI AvaI SmaI BamHI XbaI SalI AccI HincII PstI SphI HindIII SP6 T7 1 start 5 15 21 21 23 26 32 38 39 40 48 54 56 69 ➞ ➞ XmnI 1937 lacZ pGEM®-4Z Vector Product Size Cat.# pGEM®-4Z Vector 20 μg P2161 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 128. 0280VA05_4A ScaI 1820 AatII 2262 NdeI 2511 ori pGEM-4Z Vector (2,746bp) Ampr EcoRI SacI KpnI AvaI XmaI SmaI BamHI XbaI SalI AccI HincII PstI SphI HindIII SP6 T7 1 start 7 17 23 23 23 25 28 34 40 41 42 50 56 58 70 ➞ ➞ XmnI 1939 SspI 2144 NarI 2563 lacZ Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 213 14Vectors For complete and up-to-date product information visit: www.promega.com pGEM®-5Zf(+) Vector Product Size Cat.# pGEM®-5Zf(+) Vector 20 μg P2241 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 128. ori (3,000bp) Ampr ApaI AatII SphI NcoI SacII EcoRV SpeI NotI PstI SalI NdeI SacI BstXI NsiI T7 1 start 14 20 26 37 46 51 55 62 73 75 82 94 103 112 126 XmnI 1994 lacZ SP6 ScaI 1875 pGEM®-5Zf(+) Vector pGEM®-7Zf(+\–) Vectors Product Size Cat.# pGEM®-7Zf(+) Vector 20 μg P2251 pGEM®-7Zf(–) Vector 20 μg P2371 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 129. ScaI 1872 ori pGEM®-7Zf(+) Vector (2,997bp) Ampr SP6 T7 14 20 26 31 37 43 53 56 61 67 72 78 91 100 109 ➞ ➞ XmnI 1991 lacZ ApaI AatII SphI XbaI XhoI EcoRI KpnI SmaI Csp45I ClaI HindIII BamHI SacI BstXI NsiI 0286VC02_5A 1 start 123 pGEM®-9Zf(–) Vector Product Size Cat.# pGEM®-9Zf(–) Vector 20 μg P2391 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 129. ScaI 1816 ori (2,912bp) Ampr SP6 T7 82 XmnI 1935 NaeI 2382 lacZ NsiI SpeI HindIII XbaI EcoRI SalI SacI Tth111I NotI SfiI 2879 2887 9 12 18 27 36 42 52 pGEM®-9Zf(–) Vector 55 1 start pGEM®-11Zf(+) Vector Product Size Cat.# pGEM®-11Zf(+) Vector 20 μg P2411 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 130. ScaI 1842 ori pGEM®-11Zf(+) Vector (3,221bp) Ampr SP6 T7 1 start 17 27 29 35 41 47 57 59 67 76 78 80 93 ➞ ➞ XmnI 1961 lacZ SfiI SacI EcoRI SalI XhoI BamHI ApaI XbaI NotI SphI NsiI HindIII AatII 2284 NdeI 2533 0290VC05_4A Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 214 For complete and up-to-date product information visit: www.promega.com pSP64 Poly(A) Vector Product Size Cat.# pSP64 Poly(A) Vector 20 μg P1241 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 130. 0306VA05_2A PvuI 1704 AatII 2256 pSP64 Poly(A) Vector (3,030bp) Ampr ori HindIII PstI SalI AccI HincII XbaI BamHI AvaI SmaI SacI (dA:dT) 30 EcoRI SP6 1 start 7 20 22 23 24 28 34 39 41 50 86 ➞ PvuII 265 BglI 1454 FspI 1556 ScaI 1814 XmnI 1933 SspI 2138 SphI 2599 NaeI 2758 NheI 2789 pSP72 Vector Product Size Cat.# pSP72 Vector 20 μg P2191 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 131. 0298VA05_2A PvuI 1578 AatII 2130 pSP72 Vector (2,462bp) Ampr ori XhoI PvuII HindIII SphI PstI SalI AccI XbaI BamHI SmaI KpnI SacI EcoRI ClaI EcoRV BglII SP6 T7 1 start 4 12 16 26 32 34 35 40 46 53 59 65 67 74 81 85 101 ➞ ➞ HpaI 136 BglI 1328 FspI 430 ScaI 1688 XmnI 1807 SspI 2012 NdeI 2379 pSP73 Vector Product Size Cat.# pSP73 Vector 20 μg P2221 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 131. PvuI 1580 AatII 2132 pSP73 Vector (2,464bp) Ampr ori BglII EcoRV ClaI EcoRI SacI KpnI SmaI BamHI XbaI SalI AccI PstI SphI HindIII PvuII XhoI SP6 T7 1 start 6 14 19 24 34 40 42 45 51 57 58 67 73 75 83 87 103 ➞ ➞ HpaI 138 BglI 1330 FspI 1432 ScaI 1690 XmnI 1809 SspI 2014 NdeI 2381 0300VA05_2A pUC/M13 Sequencing Primers Product Size Conc. Cat.# pUC/M13 Primer, Reverse (17mer) 2 μg 10 µg/ml Q5401 pUC/M13 Primer, Forward (24mer) 2 μg 10 µg/ml Q5601 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids developed by Messing. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´ • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´ Storage Conditions: Store at –20°C. The primers are supplied in sterile water. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 215 14Vectors For complete and up-to-date product information visit: www.promega.com pGEM®-T Vector Systems Product Size Cat.# pGEM®-T Vector System I 20 reactions A3600 pGEM®-T Vector System II 20 reactions A3610 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 197. ScaI 1875 ori Ampr ApaI AatII SphI BstZI NcoI SacII SpeI NotI BstZI PstI SalI NdeI SacI BstXI NsiI T7 ➞ XmnI 1994 NaeI 2692 lacZ f1 ori 1 start 14 20 26 31 37 46 55 62 62 73 75 82 94 103 112 126 ➞SP6 T T pGEM®-T Vector (3000bp) 0356VA04_3A pGEM®-T Easy Vector Systems Product Size Cat.# pGEM®-T Easy Vector System I 20 reactions A1360 pGEM®-T Easy Vector System II 20 reactions A1380 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 197. ScaI 1890 ori pGEM-T Easy Vector (3015bp) Ampr SpeI EcoRI NotI BstZI PstI SalI NdeI SacI BstXI NsiI T7 XmnI 2009 ➞ NaeI 2707 lacZ f1 ori 1 start 14 20 26 31 37 43 43 49 52 64 70 77 77 88 90 97 109 118 127 141 ➞SP6 T T 1473VA05_6A ApaI AatII SphI BstZI NcoI BstZI NotI SacII EcoRI Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 216 For complete and up-to-date product information visit: www.promega.com Protein Expression Vectors HaloTag® Vectors for E. coli and Cell-Free Protein Expression Product Size Cat.# pH6HTN His6 HaloTag® T7 Vector 20 μg G7971 pH6HTC His6 HaloTag® T7 Vector 20 μg G8031 pF1A T7 Flexi® Vector 20 μg C8441 pF1K T7 Flexi® Vector 20 μg C8451 pFN18A HaloTag® T7 Flexi® Vector 20 μg G2751 pFN18K HaloTag® T7 Flexi® Vector 20 μg G2681 pFN19A HaloTag® T7 SP6 Flexi® Vector 20 μg G1891 pFN19K HaloTag® T7 SP6 Flexi® Vector 20 μg G1841 pFC20A HaloTag® T7 SP6 Flexi® Vector 20 μg G1681 pFC20K HaloTag® T7 SP6 Flexi® Vector 20 μg G1691 pFN29A His6 HaloTag® T7 Flexi® Vector 20 μg G8261 pFN29K His6 HaloTag® T7 Flexi® Vector 20 μg G8331 pFC30A His6 HaloTag® T7 Flexi® Vector 20 μg G8321 pFC30K His6 HaloTag® T7 Flexi® Vector 20 μg G8381 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 348. 4815MA pF1A T7 Flexi ® Vector (3455bp) ori cer Pme I Barnase T7 Terminator Ampr T7 Sgf I rrnB Terminator Untagged Flexi® Mammalian Expression Vectors Product Size Cat.# pF4A CMV Flexi® Vector 20 μg C8481 pF4K CMV Flexi® Vector 20 μg C8491 pF5A CMV-neo Flexi® Vector 20 μg C9401 pF5K CMV-neo Flexi® Vector 20 μg C9411 pF9A CMV hRluc-neo Flexi® Vector 20 μg C9361 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 124. HaloTag® Fusion (C-Terminal) Mammalian Expression Vectors Product Size Cat.# pHTC HaloTag® CMV-neo Vector 20 μg G7711 pFC27A HaloTag® CMV-neo Flexi® Vector 20 μg G8421 pFC27K HaloTag® CMV-neo Flexi® Vector 20 μg G8431 pFC14A HaloTag® CMV Flexi® Vector 20 μg G9651 pFC14K HaloTag® CMV Flexi® Vector 20 μg G9661 pFC15A HaloTag® CMVd1 Flexi® Vector 20 μg G1611 pFC15K HaloTag® CMVd1 Flexi® Vector 20 μg G1601 pFC16A HaloTag® CMVd2 Flexi® Vector 20 μg G1591 pFC16K HaloTag® CMVd2 Flexi® Vector 20 μg G1571 pFC17A HaloTag® CMVd3 Flexi® Vector 20 μg G1551 pFC17K HaloTag® CMVd3 Flexi® Vector 20 μg G1321 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 347. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 217 14Vectors For complete and up-to-date product information visit: www.promega.com PinPoint™ Xa Protein Purification System Product Size Cat.# PinPoint™ Xa Protein Purification System 1 system V2020 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PinPoint™ Xa Protein Purification System is designed for the production and purification of fusion proteins that are biotinylated in vivo. The DNA coding for the protein of interest is cloned into a PinPoint™ Vector downstream of a sequence encoding a peptide that becomes biotinylated in vivo. Biotinylated fusion proteins are produced in E. coli and are affinitypurified using the SoftLink™ Soft Release Avidin Resin. This proprietary resin allows elution of the fusion protein under nondenaturing conditions. The PinPoint™ Vectors feature the encoded endoproteinase Factor Xa (pronounced “ten a”) proteolytic site that provides a way to separate the purification tag from the native protein, and the vectors carry a convenient multiple cloning region for ease in construction of fusion proteins. The system contains vectors in all possible sense reading frames, an avidinconjugated resin, Streptavidin-Alkaline Phosphatase, a purification column and biotin. The PinPoint™ Xa Control Vector contains the chloramphenicol acetyltransferase (CAT) gene and is provided as a means of monitoring protein expression, purification and processing conditions. The system generally yields 1–5mg of protein per liter of culture. Features: • In vivo Biotinylation Tag: Allows purification of fusion proteins; many proteins produced have been soluble. • Easy to Use: Purification of biotinylated proteins with the SoftLink™ Resin can be performed by column or batch purification. • Easy Detection: Streptavidin Alkaline Phosphatase can be used to detect the biotinylated fusion protein in a pseudo-Western format to monitor purification. • Flexible: PinPoint™ Vectors are supplied for all reading frames. • Gentle Release Conditions: SoftLink™ Resin allows release of the fusion protein under nondenaturing conditions. • tac Promoter: Allows tightly regulated expression. Storage Conditions: Store the PinPoint™ Purification Column at room temperature. Store all remaining components at 4°C. The vectors may be stored at –20°C. pALTER®-MAX Vector Product Size Cat.# pALTER®-MAX Vector 20 μg Q5761 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pALTER®-MAX Vector is a 5,534bp plasmid. It contains the human cytomegalovirus (CMV) immediate-early enhancer/promoter region for strong, constitutive expression of cloned DNA inserts in a variety of mammalian cell types. The pALTER®-MAX Vector as supplied is chloramphenicol-resistant and ampicillin-sensitive. Storage Conditions: Store vector DNA at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 218 For complete and up-to-date product information visit: www.promega.com Regulated Mammalian Expression System Product Size Cat.# Regulated Mammalian Expression System 1 system C9470 Coumermycin A1 5 mg C9451 Novobiocin Sodium Salt 1 g C9461 Available Separately pReg neo Vector 20 μg C9421 pF12A RM Flexi® Vector 20 μg C9431 pF12K RM Flexi® Vector 20 μg C9441 C9421, C9470, C9431, C9451, C9441 For Research Use Only. Not for Use in Diagnostic Procedures. C9461 For Research Use Only. Not for Use in Therapeutic or Diagnostic Procedures. Description: The Regulated Mammalian Expression System features low basal levels, robust and rapid induction, and downregulation of gene expression in mammalian cells. The Regulated Mammalian Expression System is based on a novel on/off switch that relies on the rapid and sensitive modulation by coumerin-related compounds of a chimeric transactivator protein. Nanomolar concentrations of the antibiotic coumermycin promote homodimerization of a chimeric transactivator that, in turn, binds to lambda operator sequences located upstream of a minimal promoter driving transcription of coding sequences for a protein of interest. The levels of protein expression can be regulated by adjusting the coumermycin concentration. More significantly, this expression can be promptly and effectively switched off by adding novobiocin, which acts as an antagonist by dissociating the dimerized transactivator protein. The protein coding region of interest is cloned into either the pF12A RM Flexi® Vector or pF12K RM Flexi® Vector, both of which are specially designed for Regulated Mammalian (RM) protein expression. These vectors incorporate regulatory promoter sequences upstream of the protein-coding region and are compatible with the Flexi® Vector System. In transient transfection paradigms, the pF12A or pF12K RM Flexi® Vector containing the protein-coding region of interest is co-transfected into mammalian cells together with the pReg neo Vector. The pReg neo Vector is designed to express a chimeric transactivator protein that interacts with the regulatory promoter region in the pF12A and pF12K RM Flexi® Vectors in a regulated fashion in response to coumermycin and novobiocin. Additionally, the pReg neo Vector encodes a neomycin phosphotransferase gene that allows stable cell selection and generation with the antibiotic G-418. Features: • Enhanced Data: High level of controlled induction combined with low basal protein expression. • Regulated Expression: Dose-response induction of protein expression; rapid and sensitive on/off switch for protein expression. • Versatility: Compatible with other Flexi® Vectors. Storage Conditions: Store at –20°C. CheckMate™/Flexi® Vector Mammalian Two-Hybrid System Product Size Cat.# CheckMate™/Flexi® Vector Mammalian Two-Hybrid System 1 each C9360 Available Separately pFN10A (ACT) Flexi® Vector 20 μg C9331 pFN11A (BIND) Flexi® Vector 20 μg C9341 pGL4.31[luc2P/GAL4UAS/Hygro] Vector 20 μg C9351 CheckMate™ Positive Control Vectors 1 set C9370 CheckMate™ Negative Control Vectors 1 set C9380 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CheckMate™/Flexi® Vector Mammalian Two-Hybrid System provides a means to confirm, validate and study suspected interactions between two proteins or domains and can also be used to generate stable cell lines for cell-based assays. Developed primarily for mammalian proteins of interest, the system can allow protein expression and post-translational modifications in an environment mimicking the native cell milieu. It is patterned on the yeast two-hybrid system with one protein of interest (“X”) fused to a DNA-binding domain and the other protein (“Y”) fused to a transcriptional activation domain. The system relies upon three plasmids that are co-transfected into mammalian cells, each plasmid having unique features. The pFN10A (ACT) Flexi® Vector contains a herpes simplex virus VP16 transcriptional activation domain upstream of the cloning site, and the pFN11A (BIND) Flexi® Vector contains the yeast GAL4DNA-binding domain upstream of the cloning site. The pFN11A (BIND) Flexi® Vector also expresses the Renilla reniformis luciferase under the control of the SV40 promoter, allowing normalization for differences in transfection efficiency. The third vector, pGL4.31[luc2P/GAL4UAS/Hygro] Vector, contains five GAL4 binding sites upstream of a minimal TATA box, which is upstream of a firefly luciferase gene that acts as a reporter for interactions between proteins X and Y. This system differs from the original CheckMate™ Mammalian Two-Hybrid System in that the vectors are compatible with the Flexi® Vector System, which allows directional cloning and rapid, efficient and high-fidelity transfer of protein coding regions between a variety of Flexi® Vectors. Features: • Mammalian-Based System: Interactions can be studied in the cell line of choice. Proteins are more likely to be in their native conformation. Post-translational modifications, such as glycosylation, phosphorylation and acylation, are better maintained. • Versatile: Vectors are based on the Flexi® Cloning technology, enabling convenient transfer of protein-coding regions for additional functional proteomics applications. • Convenient: The Dual-Luciferase® Reporter Assay System is used for detection. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 219 14Vectors For complete and up-to-date product information visit: www.promega.com CheckMate™ Mammalian Two-Hybrid System Product Size Cat.# CheckMate™ Mammalian Two-Hybrid System 1 system E2440 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Two-hybrid systems are extremely powerful methods for detecting protein:protein interactions in vivo. The basis of two-hybrid systems is the modular domains found in some transcription factors: a DNA-binding domain, which binds to a specific DNA sequence, and a transcriptional activation domain, which interacts with the basal transcriptional machinery. A transcriptional activation domain in association with a DNA-binding domain will promote the assembly of RNA polymerase II complexes at the TATA box and increase transcription. In the CheckMate™ Mammalian Two-Hybrid System the DNA-binding domain and the transcriptional activation domain, produced by separate plasmids, are closely associated when one protein (“X”) fused to a DNA-binding domain interacts with a second protein (“Y”) fused to a transcriptional activation domain. In this system, interaction between proteins X and Y results in transcription of a reporter gene. Features: • Mammalian System: Interactions can be studied in the cell line of choice. Proteins are more likely to be in their native conformation. Posttranslational modifications, such as glycosylation, phosphorylation and acylation, are better maintained. • Convenient Quantitation: The Dual-Luciferase® Reporter Assay System is used for detection. • Internal Control: Renilla luciferase normalizes transfection efficiency. • Fast Transient Assay: Results obtained two days after transfection, as compared to 3–4 days with the yeast system. • Stable Transfectants: The pACT Vector contains the neomycin phosphotransferase gene, which allows selection of stable transfectants. Storage Conditions: Store at –20°C. HQ and GST Tag Flexi® Vectors for E. coli and Cell-Free Protein Expression Product Size Cat.# pFN2A (GST) Flexi® Vector 20 μg C8461 pFN2K (GST) Flexi® Vector 20 μg C8471 pFN6A (HQ) Flexi® Vector 20 μg C8511 pFN6K (HQ) Flexi® Vector 20 μg C8521 pFC7A (HQ) Flexi® Vector 20 μg C8531 pFC7K (HQ) Flexi® Vector 20 μg C8541 pF1A T7 Flexi® Vector 20 μg C8441 pF1K T7 Flexi® Vector 20 μg C8451 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These vectors are used for inducible expression of HQ- and GST-tagged fusion proteins in E. coli and cell-free systems using the T7 RNA polymerase promoter. The HQ tag and polyhistidine tag (His) are comparable in their affinity for Ni ions and will bind to all His-binding surfaces and resins. In certain cases the HQ-tagged proteins can be eluted from the affinity columns at lower concentrations of imidazole—a property useful for some downstream applications such as enzymatic reactions. As with His tag, proteins can be expressed from bacterial, insect and mammalian systems and purified under either native or denaturing conditions. The GST tag has been successfully used to boost tagged protein solubility during E. coli expression. pFN2A/K (GST) Flexi® Vectors are designed for protein expression with an N-terminal GST tag in E. coli and T7 cell-free expression systems. pFN6A/K (HQ) Flexi® Vectors are designed for protein expression with an N-terminal HQ tag in E. coli and T7 cell-free expression systems. pFC7A/K (HQ) Flexi® Vectors are designed for protein expression with an C-terminal HQ in E. coli and T7 cell-free expression systems. pF1A/K T7 Flexi® Vectors (Cat.# C8441, C8451) are designed for inducible expression of native untagged protein. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Easy to Implement and Reliable: Choose between traditional His-affinity and GST-affinity resins for standard protein purification and prokaryotic expression applications. • Cost-Effective: Technology for reusable and cost-efficient Ni (His-affinity) and gluthathione (GST-affinity) resins. • Versatile Cloning: Choose from a variety of expression systems and fusion tag orientations and then transfer to others as required (for Flexi® system). • Time Savings: Barnase insert (Flexi® system) decreases the number of background colonies, allowing efficient transfer of genetic constructs. Storage Conditions: Store vectors at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 220 For complete and up-to-date product information visit: www.promega.com HaloTag® Fusion (N-Terminal) Mammalian Expression Vectors Product Size Cat.# pHTN HaloTag® CMV-neo Vector 20 μg G7721 pFN28A HaloTag® CMV-neo Flexi® Vector 20 μg G8441 pFN28K HaloTag® CMV-neo Flexi® Vector 20 μg G8451 pFN21A HaloTag® CMV Flexi® Vector 20 μg G2821 pFN21K HaloTag® CMV Flexi® Vector 20 μg G2831 pFN22A HaloTag® CMVd1 Flexi® Vector 20 μg G2841 pFN22K HaloTag® CMVd1 Flexi® Vector 20 μg G2851 pFN23A HaloTag® CMVd2 Flexi® Vector 20 μg G2861 pFN23K HaloTag® CMVd2 Flexi® Vector 20 μg G2871 pFN24A HaloTag® CMVd3 Flexi® Vector 20 μg G2881 pFN24K HaloTag® CMVd3 Flexi® Vector 20 μg G2981 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 347. pAdVAntage™ Vector Product Size Cat.# pAdVAntage™ Vector 20 μg E1711 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Co-transfection of mammalian cells with the pAdVAntage™ Vector enhances transient protein expression in a variety of cell types by increasing translation initiation. Transfection of mammalian cells with an expression vector often results in suboptimal expression of the protein of interest. Double-stranded RNA (dsRNA) generated during transfection is thought to activate the dsRNA-activated inhibitor (DAI), one of several enzymes involved in the host cell’s antiviral defense system. DAI phosphorylates the translation initiation factor eIF-2, halting translation and therefore protein production. However, DAI translation inhibition can be overcome with the adenoviral Virus Associated I RNA (VAI RNA) produced by RNA polymerase III following co-transfection with the pAdVAntage™ Vector. The VAI RNA binds to DAI, preventing its activation, thereby allowing translation and protein expression. Features: • Increased Expression: Co-transfection of pAdVAntage™ Vector with luciferase constructs showed at least a tenfold increase in luciferase expression in 293 and HeLa cell lines over transfections performed with the construct DNA alone. • Flexible: Can be used in a variety of cell lines. Storage Conditions: Store at –20°C. pSI Mammalian Expression Vector Product Size Cat.# pSI Mammalian Expression Vector 20 μg E1721 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pSI Mammalian Expression Vector promotes constitutive expression of cloned DNA inserts in mammalian cells. The major difference between the pCI and pSI Mammalian Expression Vectors is the enhancer/ promoter region controlling expression of the inserted gene. The pSI Expression Vector contains the simian virus 40 (SV40) enhancer and early promoter region. This vector can be used for both transient and stable expression of genes. For stable expression, the pSI Vector must be co-transfected with an expression vector containing a selectable gene for mammalian cells. Features: • Strong, Constitutive Expression: The pSI Vector’s SV40 enhancer/ promoter region allows strong, constitutive expression in most cell lines. The vector is maintained as an episome in cells expressing the SV40 large T antigen, leading to even higher levels of expression. A β-globin/IgG chimeric intron located downstream from the enhancer/promoter region can further increase expression. • Increased Steady-State mRNA Levels: The late SV40 polyadenylation signal increases the steady-state level of RNA approximately fivefold more than the early SV40 polyadenylation signal. • Convenient: Multiple cloning sites exist for easy insertion of cDNA. • Versatile: Synthesize transcripts in vitro using the T7 RNA polymerase promoter or generate single-stranded DNA in E. coli using the f1 origin of replication. Storage Conditions: Store at –20°C. NheI XhoI EcoRI MluI XbaI SalI AccI SmaI BstZI NotI ➞ ori Intron f1 ori pSI Vector (3632bp) BglII BamHI PstI Bst98I Bst98I Ampr T7 678 684 689 695 707 713 714 720 724 724 0684VA06_4B SV40 Late poly(A) SV40 Enhancer/ Early Promoter Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 221 14Vectors For complete and up-to-date product information visit: www.promega.com pCI Mammalian Expression Vector Product Size Cat.# pCI Mammalian Expression Vector 20 μg E1731 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pCI Mammalian Expression Vector promotes constitutive expression of cloned DNA inserts in mammalian cells. The major difference between the pCI and pSI Mammalian Expression Vectors is the enhancer/ promoter region controlling expression of the inserted gene. The pCI Expression Vector contains the human cytomegalovirus (CMV) major immediate-early gene enhancer/promoter region. This vector can be used for both transient and stable expression of genes. For stable expression, the pCI Vector must be co-transfected with an expression vector containing a selectable gene for mammalian cells. Features: • Strong, Constitutive Expression: The pCI Vector’s CMV enhancer/ promoter region enables strong, constitutive expression in many cell types. A β-globin/IgG chimeric intron located downstream of the enhancer/ promoter region can further increase expression. • Increased Steady-State mRNA Levels: The late SV40 polyadenylation signal increases the steady-state level of RNA approximately fivefold more than the early SV40 polyadenylation signal. • Convenient: Multiple cloning sites exist for easy insertion of cDNA. • Versatile: Synthesize transcripts in vitro using the T7 RNA polymerase promoter or generate single-stranded DNA in E. coli using the f1 origin of replication. Storage Conditions: Store at –20°C. ➞ ori Intron f1 ori SV40 Late poly(A) pCI Vector (4006bp) BamHI PstI Bst98I Bst98I Ampr T7 NheI XhoI EcoRI MluI KpnI XbaI SalI AccI SmaI BstZI NotI BglII 0685VA06_4A 1052 1058 1063 1069 1079 1081 1087 1088 1094 1098 1098 CMV I. E. Enhancer/Promoter pCI-neo Mammalian Expression Vector Product Size Cat.# pCI-neo Mammalian Expression Vector 20 μg E1841 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pCI-neo Mammalian Expression Vector carries the human cytomegalovirus (CMV) immediate-early enhancer/promoter region to promote constitutive expression of cloned DNA inserts in mammalian cells. This vector also contains the neomycin phosphotransferase gene, a selectable marker for mammalian cells. The pCI-neo Vector can be used for transient or stable expression by selecting transfected cells with the antibiotic G-418. Features: • Strong, Constitutive Expression: The human cytomegalovirus (CMV) immediate-early enhancer/promoter region produces strong, constitutive expression. A β-globin/IgG chimeric intron located downstream from the enhancer/promoter region can further increase expression. The vector is maintained as an episome in cells expressing the SV40 large T antigen, leading to even higher levels of expression. • Transient or Stable Expression: The neomycin phosphotransferase gene allows selection of stable transfected cells. • Increased Steady-State mRNA Levels: The late SV40 polyadenylation signal increases the steady-state level of RNA approximately fivefold more than the early SV40 polyadenylation signal. • Convenient: Multiple cloning sites exist for easy insertion of cDNA. • Versatile: Synthesize transcripts in vitro using the T7 RNA polymerase promoter or generate single-stranded DNA in E. coli using the f1 origin of replication. Storage Conditions: Store at –20°C. I-PpoI SgfI BamHI Ampr T7 T3 BglII 1085 1091 1096 1102 1114 1120 1121 1127 1131 Intron CMV I.E. Enhancer/Promoter f1 ori neo SV40 Enhancer/ Early Promoter Synthetic poly(A) SV40 Late poly(A) pCI-neo Vector (5472bp) NheI XhoI EcoRI MluI XbaI SalI AccI SmaI NotI ori 0914VA01_5A Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 222 For complete and up-to-date product information visit: www.promega.com In Vitro Translation Specialty Vectors Product Size Cat.# pF3A WG (BYDV) Flexi® Vector 20 μg L5671 pF3K WG (BYDV) Flexi® Vector 20 μg L5681 pF25A ICE T7 Flexi® Vector 20 μg L1061 pF25K ICE T7 Flexi® Vector 20 μg L1081 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Flexi® Vector System is a simple, yet powerful, directional cloning method for protein-coding sequences. It is based on two rare-cutting restriction enzymes, SgfI and PmeI, and provides a rapid, efficient and highfidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence. The vectors are designed with special sequences for maximal cell-free protein expression in a specific system. The pF3A/K WG vectors were designed for use with Wheat Germ extracts and contain sequences from the barley yellow dwarf virus (BYDV), an RNA plant virus, upstream and downstream of the protein coding region of interest. The BYDV elements interact with each other, form a closed loop and act synergistically to stimulate translation in wheat germ extracts, bypassing mRNA cap and polyadenylation dependencies. The pF25A/K ICE Vectors were designed for use with Insect Cell Extracts and contain untranslated region (UTR) sequences at the 5´ and 3´ ends of the gene coding region to enhance translation efficiency. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Versatility: You can choose between a variety of initial applications (e.g., bacterial protein, mammalian, or cell-free protein expression) and then transfer to others as required. • Time Savings: Efficient transfer allows direct use of recombinant clones, minimizing time wasted screening background colonies. • Enhanced Productivity: Adaptable to high-throughput formats for large screening projects. • Easy Access: No licensing fees or complicated transfer restrictions. Storage Conditions: Store vectors at –20°C. pTnT™ Vector Product Size Cat.# pTnT™ Vector 20 μg L5610 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pTnT™ Vector is designed for the convenient in vitro expression of cloned genes. Both SP6 and T7 polymerase promoters lie in tandem adjacent to the multiple cloning site. This permits gene expression from either an SP6- or T7-based coupled in vitro transcription/translation system. The presence of RNA phage promoters also allows the highly efficient synthesis of RNA in vitro. The pTnT™ Vector also contains a 5´ β-globin leader sequence and synthetic poly(A)30 tail, both of which have been shown to enhance expression of certain genes. Features: • Flexible: The vector contains tandem SP6 and T7 phage promoters allowing use in the appropriate in vitro translation or transcription system. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 223 14Vectors For complete and up-to-date product information visit: www.promega.com pCMVTnT™ Vector Product Size Cat.# pCMVTnT™ Vector 20 μg L5620 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pCMVTnT™ Vector is designed for the convenient expression of cloned genes using both in vivo and in vitro expression systems. Both SP6 and T7 polymerase promoters lie in tandem adjacent to the multiple cloning site. This allows gene expression from either an SP6- or T7-based coupled in vitro transcription/translation system. The presence of RNA phage promoters also allows the highly efficient synthesis of RNA in vitro. The pCMVTnT™ Vector also contains a 5´ β-globin leader sequence that has been referenced for enhanced expression of certain genes in vitro. For in vivo expression, the vector contains a CMV enhancer/promoter region, which allows strong constitutive expression in many cell types. A β-globin/IgG chimeric intron is located downstream from the enhancer/promoter region. The late SV40 polyadenylation site is located downstream of the multiple cloning site. Features: • In Vivo Expression: The CMV enhancer/promoter region allows strong constitutive expression in many cell types. • Flexible: The vector contains tandem SP6 and T7 phage promoters allowing use in the appropriate in vitro translation or transcription system. • Convenient: Multiple cloning site provides a selection of restriction sites for cloning. Storage Conditions: Store at –20°C. pTargeT™ Mammalian Expression Vector System Product Size Cat.# pTargeT™ Mammalian Expression Vector System 20 reactions A1410 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 198. SgfI 664 I-PpoI 851 BglII 5665 SV40 Enhancer/ EarlyPromoter SV40 Late poly (A) Synthetic fl ori poly(A) Ampr ori CMV Enhancer/Promoter Intron Neo pTARGET™ Vector (5670bp) T T EcoRI BamHI NheI XhoI MluI lacZ lacZ SmaI KpnI SalI AccI NotI EcoRI T7 ➞ 1250 1256 1264 1270 1276 1293 1301 1303 1304 1311 1318 T overhangs 1505VA07_6A Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 224 For complete and up-to-date product information visit: www.promega.com Reporter Vectors NanoLuc® Genetic Reporter Vectors Product Size Conc. Cat.# pNL1.1[Nluc] Vector 20 μg N1001 pNL1.2[NlucP] Vector 20 μg N1011 pNL1.3[secNluc] Vector 20 μg N1021 pNL3.1[Nluc/minP] Vector 20 μg N1031 pNL3.2[NlucP/minP] Vector 20 μg N1041 pNL3.3[secNluc/minP] Vector 20 μg N1051 pNL2.1[Nluc/Hygro] Vector 20 μg N1061 pNL2.2[NlucP/Hygro] Vector 20 μg N1071 pNL2.3[secNluc/Hygro] Vector 20 μg N1081 pNL1.1.CMV[Nluc/CMV] Vector 20 μg N1091 pNL1.3.CMV[secNluc/CMV] Vector 20 μg N1101 pNL3.2.NF-κB-RE[NlucP/NF-κB-RE/Hygro] Vector 20 μg N1111 pNL3.2.CMV Vector 20 μg 1 µg/µl N1411 pNL1.1.PGK[Nluc/PGK] Vector 20 μg N1441 pNL1.1.TK[Nluc/TK] Vector 20 μg N1501 For Research Use Only. Not for Use in Diagnostic Procedures. Description: NanoLuc® (Nluc) luciferase is a small enzyme (19.1kDa) engineered for optimal performance as a luminescent reporter. The enzyme is about 100-fold brighter than either firefly (Photinus pyralis) or Renilla reniformis luciferase using a novel substrate, furimazine, to produce high intensity, glow-type luminescence. The luminescent reaction is ATP-independent and designed to suppress background luminescence for maximal assay sensitivity. For use as a genetic reporter, multiple forms of NanoLuc® luciferase have been configured to meet differing experimental objectives. Unfused Nluc offers maximal light output and sensitivity, NanoLuc®-PEST (NlucP) closely couples protein expression to changes in transcriptional activity and increased signal-to background ratios, and NanoLuc® luciferase fused to an N-terminal secretion signal (secNluc) is suitable when a secreted reporter is preferred. Luminescence is linearly proportional to the amount of NanoLuc® protein over a 1,000,000-fold concentration range, with a signal half-life ≥2 hours when detected with Nano-Glo® Luciferase Assay Reagent. NanoLuc® luciferase possesses a number of physical properties that make it an excellent reporter protein: • very small, monomeric enzyme (171 amino acids; 513bp) • high thermal stability (Tm = 60°C) • active over a broad pH range (pH 6–8) • no post-translational modifications or disulfide bonds • uniform distribution in cells • emission spectrum well suited for bioluminescence resonance energy transfer (BRET; λmax = 465nM). NanoLuc® luciferase is made available in a variety of plasmids designed for use in reporter gene assays of transcriptional control and with each of the NanoLuc® forms (unfused Nluc, PEST destabilized NlucP, and secreted secNluc). The different pNL variations are designed for the following: • pNL1: cloning of a known or putative promoter region • pNL2: cloning of a known or putative promoter region and establishment of a stable cell line through Hygromycin selection • pNL3: cloning of a binding site or response element not in need of a basic promoter (such as are present in the pNL3.2.NF-κB-RE vector) • Control plasmids for the unfused, PEST-destabilized and secreted Nluc forms also are available. The pNL vectors series use a pGL4-based backbone for easy sequence transfer from existing plasmids. This backbone design also reduces anomalous results by removing many transcription factor binding sites and other potential regulatory elements. The Nluc gene variations are codon optimized and have had many potential regulatory elements or other undesirable features removed (such as common restriction enzyme sites). Storage Conditions: Store at –20°C. 10321MA pNL1.1[Nluc] Vector (3110bp) Ampr ori BglI/SfiI Acc65I KpnI EcoICRI SacI NheI BmtI XhoI EcoRV BglII BglI/SfiI HindIII 9 15 19 24 26 28 32 34 42 47 60 66 SV40 late poly(A) signal Synthetic poly(A) signal/transcriptional pause site (for background reduction) Nluc 894 888 SalI BamHI Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 225 14Vectors For complete and up-to-date product information visit: www.promega.com NanoLuc® Protein Fusion Vectors Product Size Conc. Cat.# pFN31A Nluc CMV-Hygro Flexi® Vector 20 μg 1 µg/µl N1311 pFN31K Nluc CMV-neo Flexi® Vector 20 μg 1 µg/µl N1321 pFC32A Nluc CMV-Hygro Flexi® Vector 20 μg 1 µg/µl N1331 pFC32K Nluc CMV-neo Flexi® Vector 20 μg 1 µg/µl N1341 pNLF1-N [CMV/Hygro] Vector 20 μg 1 µg/µl N1351 pNLF1-C [CMV/Hygro] Vector 20 μg 1 µg/µl N1361 pNLF1-secN [CMV/Hygro] Vector 20 μg 1 µg/µl N1371 Transfection Carrier DNA 5 × 20 μg 1 µg/µl E4881 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The small size (19.1kDa) and extreme brightness (about 100-fold brighter than either firefly [Photinus pyralis] or Renilla reniformis) of NanoLuc® luciferase (Nluc) make it an ideal protein fusion partner. NanoLuc® fusion proteins can be used in a variety of applications including: reporters of protein stability, probes for bioluminescent cell imaging (BLI) or as the donor signal in bioluminescent resonance energy transfer (BRET) applications for protein:protein or protein:small-molecule interaction studies. The NanoLuc® protein fusion vectors enable simple generation of N or C terminal fusions of NanoLuc® luciferase with your protein of interest and are available in two formats to accommodate your cloning preferences: • pNLF Vector series: Generate N or C terminal fusions to the full-length Nluc protein or attach secreted Nluc to the N terminus of the protein of interest using traditional cloning with a multiple cloning site (MCS). • pF Vector series: Generate N or C terminal Nluc fusion proteins using the Flexi® Vector Cloning System—a directional cloning method based on two rare-cutting restriction enzymes, SgfI and PmeI, that provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence. Features: • Easily Quantify Changes in Protein Abundance: Use the singleaddition Nano-Glo® Luciferase Assay System to quantify the signal from NanoLuc® fusion proteins to measure intracellular protein levels. • Obtain Improved Biological Relevance: Bright NanoLuc® reporter allows endogenous expression levels of NanoLuc® fusion proteins to avoid overexpression artifacts. • Visualize Intracellular Protein Dynamics: Bright NanoLuc® reporter allows reduced imaging exposure times without the need for repeated sample excitation, which can result in cytotoxic artifacts. • Improve BRET Studies: The brighter signal and blue-shifted emission spectrum from NanoLuc® luciferase result in less spectral overlap with fluorescent acceptors, resulting in better signal:background and dynamic range for BRET applications. • Flexible Cloning Options: Easily attach NanoLuc® luciferase to the N or C terminus of your protein of interest using either traditional or Flexi® cloning systems. • Easily Transition from Transient to Stable Cells: All vectors contain a mammalian selectable marker to create a stable line. Storage Conditions: Store at –20°C. NanoLuc® Stability Sensors for Cell Signaling Product Size Conc. Cat.# pNLF1-HIF1A [CMV/neo] Vector 1 each 1 µg/µl N1381 pNLF1-NRF2 [CMV/neo] Vector 1 each 1 µg/µl N1391 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The rate of protein turnover is tightly regulated for many signaling proteins involved in oncogenesis and response to cellular stress. Protein stabilization and subsequent accumulation occurs in response to changing cellular conditions resulting in activation of downstream transcriptional events. The NanoLuc® Stability Sensors are ready-to-use vector systems that utilize the advantages of the NanoLuc® luciferase reporter to enable stability studies of two key signaling proteins, HIF1A and NRF2, providing a method to directly measure this primary signaling event. HIF1A Vector System: The HIF1A Vector System enables simple quantification of intracellular HIF1A protein levels to study the dynamics of this signaling protein in mediating cellular response to hypoxia. It contains a vector encoding NanoLuc® fused to the C terminus of the HIF1A protein under control of the CMV promoter plus Transfection Carrier DNA to allow titratable intracellular fusion protein expression. NRF2 Vector System: The NRF2 Vector System enables simple quantification of intracellular NRF2 protein levels to study the dynamics of this signaling protein in mediating cellular response to oxidative stress. It contains a vector encoding NanoLuc® fused to the C terminus of the NRF2 protein under the control of the CMV promoter, a pKEAP1-expressing vector for proper regulation of intracellular NRF2 levels and Transfection Carrier DNA for titratable intracellular fusion protein expression. Features: • Ready to Use: Constructs are predesigned, optimized and tested for low endotoxin levels. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 226 For complete and up-to-date product information visit: www.promega.com Coincidence Reporter Vectors Product Size Cat.# pNLCoI1[luc2-P2A-NlucP/Hygro] Vector 20 μg N1461 pNLCoI2[luc2-P2A-NlucP/minP/Hygro] Vector 20 μg N1471 pNLCoI3[luc2-P2A-NlucP/CMV/Hygro] Vector 20 μg N1481 pNLCoI4[luc2-P2A-NlucP/PGK/Hygro] Vector 20 μg N1491 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferase-based reporter-gene assays remain a useful and powerful method of high-throughput compound screening. However, false hits that result from direct interaction of compounds with the luciferase reporter can result in unnecessary follow-up efforts. The pNLCoI Vectors comprise a second-generation coincidence reporter vector system that allow expression of both firefly luciferase (luc2) and NanoLuc® Luciferase fused to a PEST destabilization domain (NlucP) from the same mRNA transcript. The stoichiometric expression of both luciferases is achieved by use of the P2A sequence from porcine teschovirus-1, which promotes a ribosomal skip and expression of the two unfused enzymes with distinct compound interaction profiles. When used in high-throughput compound screening, false hits caused by direct interaction with one or the other luciferases can be distinguished from true hits that show a similar response for both, reducing workload associated with follow-up screens. The pNLCoI Vectors are designed for use with the Nano-Glo® Dual-Luciferase® Reporter (NanoDLR™) Assay System, which allows sequential detection of firefly and NanoLuc® Luciferase in activity in the same sample. Both reagents provide stable glow-type luminescence signals with half-lives of approximately two hours allowing batch processing of samples and amenable to assays or screens in 96-, 384- or 1,536-well plate formats. Potent inhibition of firefly luciferase coupled with the high-intensity luminescence of NanoLuc® luciferase maximizes sensitivity for detection of both reporters. Features: • Improve Confidence and Save Time: Use of two different transcriptional reporters reduces false hit rates, increases the identification of true biological hits and eliminates time wasted on false-positive follow-up. • Employ Robust and Sensitive Reporter Pair: luc2 and NlucP provide a bright reporter combination compatible with low-copy-number and plate scale up, and provide greater signal-to-background compared to other reporters. • Efficiently Identify False Hits: Firefly and NanoLuc® luciferase have dissimilar profiles of compound interference, enabling the identification of more false-positives than when either reporter is used alone. • Use Simple Detection Format: Convenient “add-read-add-read” homogeneous format of NanoDLR™ assay is ideal for automation and HTS approaches. Storage Conditions: Store at –20°C. Signaling Pathway Analysis (Minimal PromoterDriven) Firefly Luciferase Vectors Product Size Cat.# pGL4.37[luc2P/ARE/Hygro] Vector 20 μg E3641 pGL4.38[luc2P/p53 RE/Hygro] Vector 20 μg E3651 pGL4.39[luc2P/ATF6 RE/Hygro] Vector 20 μg E3661 pGL4.40[luc2P/MRE/Hygro] Vector 20 μg E4131 pGL4.41[luc2P/HSE/Hygro] Vector 20 μg E3751 pGL4.42[luc2P/HRE/Hygro] Vector 20 μg E4001 pGL4.43[luc2P/XRE/Hygro] Vector 20 μg E4121 pGL4.44[luc2P/AP1 RE/Hygro] Vector 20 μg E4111 pGL4.45[luc2P/ISRE/Hygro] Vector 20 μg E4141 pGL4.47[luc2P/SIE/Hygro] Vector 20 μg E4041 pGL4.48[luc2P/SBE/Hygro] Vector 20 μg E3671 pGL4.49[luc2P/TCF-LEF RE/Hygro] Vector 20 μg E4611 pGL4.52[luc2P/STAT5RE/Hygro] Vector 20 μg E4651 pGL4.29[luc2P/CRE/Hygro] Vector 20 μg E8471 pGL4.30[luc2P/NFAT-RE/Hygro] Vector 20 μg E8481 pGL4.32[luc2P/NF-κB-RE/Hygro] Vector 20 μg E8491 pGL4.33[luc2P/SRE/Hygro] Vector 20 μg E1340 pGL4.34[luc2P/SRF-RE/Hygro] Vector 20 μg E1350 Available Separately pGL4.23[luc2/minP] Vector 20 μg E8411 pGL4.24[luc2P/minP] Vector 20 μg E8421 GloResponse™ NFAT-RE-luc2P HEK293 Cell Line 2 vials E8510 GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line 2 vials E8520 pGL4.25[luc2CP/minP] Vector 20 μg E8431 pGL4.26[luc2/minP/Hygro] Vector 20 μg E8441 pGL4.27[luc2P/minP/Hygro] Vector 20 μg E8451 pGL4.28[luc2CP/minP/Hygro] Vector 20 μg E8461 GloResponse™ CRE-luc2P HEK293 Cell Line 2 vials E8500 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Creating a cell line with an indicator of a functional signaling pathway is useful for deciphering the components in a signaling pathway. These tools are made by insertion of multiple repeats of a response element upstream of a minimal promoter (minP). Promega has designed vectors that report the activity of a variety of pathways using the optimized luc2 firefly luciferase gene in the pGL4 backbone. These vectors also have a hygromycin resistance selectable marker, allowing use either in transient transfection experiments or for selection of a stable cell line. Also available for construction of pathway reporters are minimal promoter (minP) vectors with three varieties of engineered firefly luciferase genes: luc2, luc2P or luc2CP. The luc2 gene is engineered to remove most cryptic transcription factor binding sites and improve mammalian expression through codon optimization. The luc2P and luc2CP and RapidResponse™ genes are luc2 genes appended with degradation sequences to influence the cellular half-life of the luc2 gene. The RapidResponse™ genes respond more rapidly to stimuli but at the expense of signal intensity. The luc2P (1-hour half-life) gene responds more rapidly than luc2 (3-hour half-life) with moderate signal intensity, and the luc2CP (0.4-hour half-life) responds more quickly with the lowest signal intensity. The minP vectors are available with or without selectable markers (hygromycin). To speed research, several pre-designed response element vectors are available already assembled in the pGL4.27 Vector. Some of these also are available stable cell lines (GloResponse™ Cell Lines). Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 227 14Vectors For complete and up-to-date product information visit: www.promega.com Features: • Pre-designed vectors remove the need to clone and validate an assay. • Increased Reporter Gene Expression: Codon optimization of synthetic genes for mammalian expression. • Reduced Background and Risk of Expression Artifacts: Removal of cryptic DNA regulatory elements and transcription factor binding sites. • Improved Temporal Response: Rapid Response™ technology using destabilized luciferase genes. • Easy Transition from Transient to Stable Cells: Choice of mammalian selectable markers. Storage Conditions: Store at –20°C. Promoter-Driven Control Firefly and Renilla Luciferase Vectors Product Size Cat.# pGL4.50[luc2/CMV/Hygro] Vector 20 μg E1310 pGL4.51[luc2/CMV/Neo] Vector 20 μg E1320 pGL4.13[luc2/SV40] Vector 20 μg E6681 pGL4.53[luc2/PGK] Vector 20 μg E5011 pGL4.54[luc2/TK] Vector 20 μg E5061 pGL4.73[hRluc/SV40] Vector 20 μg E6911 pGL4.74[hRluc/TK] Vector 20 μg E6921 pGL4.75[hRluc/CMV] Vector 20 μg E6931 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 87. Promoterless Firefly Luciferase Vectors Product Size Cat.# pGL4.10[luc2] Vector 20 μg E6651 pGL4.11[luc2P] Vector 20 μg E6661 pGL4.12[luc2CP] Vector 20 μg E6671 pGL4.14[luc2/Hygro] Vector 20 μg E6691 pGL4.15[luc2P/Hygro] Vector 20 μg E6701 pGL4.16[luc2CP/Hygro] Vector 20 μg E6711 pGL4.17[luc2/Neo] Vector 20 μg E6721 pGL4.18[luc2P/Neo] Vector 20 μg E6731 pGL4.19[luc2CP/Neo] Vector 20 μg E6741 pGL4.20[luc2/Puro] Vector 20 μg E6751 pGL4.21[luc2P/Puro] Vector 20 μg E6761 pGL4.22[luc2CP/Puro] Vector 20 μg E6771 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 87. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 228 For complete and up-to-date product information visit: www.promega.com Promoterless Renilla Luciferase Vectors Product Size Cat.# pGL4.70[hRluc] Vector 20 μg E6881 pGL4.71[hRlucP] Vector 20 μg E6891 pGL4.72[hRlucCP] Vector 20 μg E6901 pGL4.76[hRluc/Hygro] Vector 20 μg E6941 pGL4.77[hRlucP/Hygro] Vector 20 μg E6951 pGL4.78[hRlucCP/Hygro] Vector 20 μg E6961 pGL4.79[hRluc/Neo] Vector 20 μg E6971 pGL4.80[hRlucP/Neo] Vector 20 μg E6981 pGL4.81[hRlucCP/Neo] Vector 20 μg E6991 pGL4.82[hRluc/Puro] Vector 20 μg E7501 pGL4.83[hRlucP/Puro] Vector 20 μg E7511 pGL4.84[hRlucCP/Puro] Vector 20 μg E7521 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 88. Nuclear Receptor Analysis Luciferase Vectors Product Size Cat.# pGL4.36[luc2P/MMTV/Hygro] Vector 20 μg E1360 pFN26A (BIND) hRluc-neo Flexi® Vector 20 μg E1380 pBIND-ERα Vector 20 μg E1390 pBIND-GR Vector 20 μg E1581 pGL4.35[luc2P/9XGAL4UAS/Hygro] Vector 20 μg E1370 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 89. Selectable Marker • None • Hygror • Neor • Puror Luciferase Gene • Firefly (luc2) • Rapid Response™ (P, CP) • Renilla (hRluc) • Rapid Response™ (P, CP) Upstream Element • Multiple cloning region • Promoter/ response elements 4897MA Ampr pGL4 Vectors ori SV40 late poly(A) signal SV40 early enhancer/ promoter Synthetic poly(A) Poly(A) block (for background reduction) pGL3 Luciferase Reporter Vectors Product Size Cat.# pGL3-Basic Vector 20 μg E1751 pGL3-Control Vector 20 μg E1741 pGL3-Enhancer Vector 20 μg E1771 pGL3-Promoter Vector 20 μg E1761 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 91. SV40 Enhancer XbaI 1934 Ampr KpnI SacI MluI NheI SmaI XhoI BgIII 5 11 15 21 28 32 36 pGL3-Control Vector (5256bp) f1 ori ori SalI BamHI 2448 2442 NarI 313 NcoI 278 HindIII 245 luc+ SV40 Promoter SV40 late poly(A) signal (for luc+ reporter) HpaI 2094 Synthetic poly(A) signal / transcriptional pause site (for background reduction) 0747VA08_4A pGL2 Luciferase Reporter Vectors Product Size Cat.# pGL2-Basic Vector 20 μg E1641 pGL2-Control Vector 20 μg E1611 pGL2-Enhancer Vector 20 μg E1621 pGL2-Promoter Vector 20 μg E1631 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 91. SalI BamHI 3194 3188 SV40 Enhancer poly(A) signal (for luc reporter) 2236 PflMI SV40 luc HindIII 239 SV40 Promoter SmaI KpnI SacI MluI NheI XhoI BglII 3 12 18 22 28 33 37 poly(A) signal (for background reduction) f1 ori Ampr pGL2-Control Vector (6047bp) 0317VA03_3A Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 229 14Vectors For complete and up-to-date product information visit: www.promega.com pmirGLO Dual-Luciferase miRNA Target Expression Vector Product Size Cat.# pmirGLO Dual-Luciferase miRNA Target Expression Vector 20 μg E1330 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 90. pRL Renilla Luciferase Control Reporter Vectors Product Size Cat.# pRL-SV40 Vector 20 μg E2231 pRL-TK Vector 20 μg E2241 pRL-CMV Vector 20 μg E2261 pRL-null Vector 20 μg E2271 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 90. T7 Promoter Rluc SV40 late poly(A) Ampr ori 1247 XbaI Csp45I 315 NheI 299 BamHI 1499 pRL-null Vector (3320bp) 1 5 12 10 15 24 30 32 34 41 47 51 58 65 67 77 BglII XhoI SacI EcoICR I HindIII NdeI NsiI SphI SpeI NarI SalI MluI EcoRI XmaI SmaI PstI 1352VA01_6A pGEM®-luc DNA Product Size Cat.# pGEM®-luc DNA 20 μg E1541 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 92. EcoNI 135 ori Ampr f1 ori SP6 ➞ SfiI SacI (EcoRI) SalI XhoI StuI T7 17 27 29 35 41 47 ➞ BspMI 351 ClaI 386 EcoRV 415 PpuMI 571 KasI/NarI BstEII 1141 1717/1718 lacZ′ ScaI 3552 XmnI 3671 AatII 3994 NdeI 4243 NaeI 4423 DraIII 4529 HindIII luc NsiI NotI (XbaI) ApaI BamHI start 1803 1790 1788 1777 1769 1767 1757 (EcoRI) 1162 (XbaI) 1702 1 start pGEM-luc Vector (4931bp) Bsu36I 1137 0392VA05_3A pSP-luc+NF Fusion Vector Product Size Cat.# pSP-luc+NF Fusion Vector 20 μg E4471 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 93. ➞ BclI 628 BbuI 711 BanII 1072 HpaI 1777 AlwNI 2372 Csp45I 217 NarI 81 NdeI 4020 SspI 3653 AatII 3771 Ampr XhoI ClaI EcoRV EcoRI XbaI T7 SP6 1726 1721 1716 1708 1702 1700 15 17 24 30 36 43 45 luc+NF start 47 pSP-luc+NF Fusion Vector (4103bp) KpnI NheI BglII AvrII rbs HindIII NcoI BstEII 0752VA08_4A luc+ end ➞ Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 230 For complete and up-to-date product information visit: www.promega.com pSV-β-Galactosidase Control Vector Product Size Cat.# pSV-β-Galactosidase Control Vector 20 μg E1081 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 94. pSV-β-Galactosidase Vector (6820bp) Ampr ori lacZ EcoRI 3701 HindIII 414 BamHI 4151 SalI 4163 PstI 4173 EcoRI 6815 SV40 Promoter and Enhancer 0325VA03_3A Monster Green® Fluorescent Protein phMGFP Vector Product Size Cat.# Monster Green® Fluorescent Protein phMGFP Vector 20 μg E6421 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 94. ori Intron SV40 Late poly(A) phMGFP Vector (4707bp) EcoRV PstI Bst98I Bst98I Ampr BglII T7 NheI NotI XmaI/SmaI NcoI NcoI NaeI XbaI hMGFP CMV I. E. Enhancer/Promoter 3898MA11_2A Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 231 15 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Bioassays for Biologics Cytokine and Growth Factor Bioassays 232 Fc Effector Activity Bioassays 234 Immune Checkpoint Bioassays 237 T Cell Activation Bioassays 241 Antibody Characterization 242 Antibody Purification 246 Bioassays for Biologics Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 232 For complete and up-to-date product information visit: www.promega.com Cytokine and Growth Factor Bioassays IL-2 Bioassay Product Size Cat.# IL-2 Bioassay 1 each JA2201 IL-2 Bioassay 5X 5 each JA2205 IL-2 Bioassay, Korea 1 each JA3301 IL-2 Bioassay 5X, Korea 5 each JA3305 IL-2 Bioassay, Taiwan 1 each JA4401 IL-2 Bioassay 5X, Taiwan 5 each JA4405 Available Separately IL-2 Bioassay, Propagation Model 1 each J2952 Not for Medical Diagnostic Use. All products not available in all countries. Description: Interleukin-2 (IL-2), originally described as “T-cell growth factor” in 1976, is a small 15.5kDa monomer secreted by a variety of cell types including CD4+ and CD8+ T cells, natural killer (NK) cells and activated dendritic cells. IL-2 has pleiotropic effects on the immune system. It plays a critical role in the generation, maintenance and expansion of CD4+ regulatory T cells, promotes the cytotoxic activity of NK and CD8+ cells and governs homeostasis through the elimination of harmful autoreactive T cells via activation-induced cell death. The IL-2 Bioassay is a bioluminescent cell-based assay designed to measure IL-2 stimulation or inhibition using the STAT-5 response element as a readout. The IL-2 Bioassay is provided in a thaw-and-use format as cryopreserved cells that can be thawed, plated and used in an assay without the need for cell propagation. The IL-2 Bioassay is also available in a Cell Propagation Model (CPM) format, which includes cryopreserved cells that can be thawed, propagated and banked for long-term use (IL-2 Bioassay, Propagation Model. Features: • Prequalified according to ICH guidelines • Mechanism-of-action-based assay • No primary cell culture required Note: IL-2 Bioassay components are shipped separately because of differing temperature requirements. The IL-2 Bioassay Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay System and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium is shipped at ambient temperature. Storage Conditions: • Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will decrease cell viability and cell performance. • Store Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the serum. • For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. • Store RPMI Medium at 4°C protected from light. IL-15 Bioassay Product Size Cat.# IL-15 Bioassay 1 each JA2011 IL-15 Bioassay 5X 5 each JA2015 IL-15 Bioassay, Korea 1 each JA3011 IL-15 Bioassay 5X, Korea 5 each JA3015 IL-15 Bioassay, Taiwan 1 each JA4011 IL-15 Bioassay 5X, Taiwan 5 each JA4015 Available Separately IL-15 Bioassay, Propagation Model 1 each J2962 Not for Medical Diagnostic Use. All products not available in all countries. Description: Interleukin-15 (IL-15) is secreted by a variety of cell types including monocytes, macrophages, dendritic and epithelial cells. IL-15 promotes activation and expansion of natural killer (NK), natural killer T (NKT) and CD8+ memory T cells. Unlike IL-2, IL-15 doesn’t impact CD4+ regulatory T cells (Treg) or induce activation-induced cell death (AICD). Multiple pathways can be activated by IL-15 signaling. In lymphocytes, JAK/ STAT signaling begins with JAK1 and JAK3 tyrosine kinase recruitment and activation at the receptor cytoplasmic domains. These kinases recruit and activate STAT3 and 5 with phosphorylated dimer/tetramer translocation to the nucleus for transcriptional activation of a variety of proteins. These pathways impact cell proliferation, anti-apoptotic survival and cytotoxic effector functions. The IL-15 Bioassay is a bioluminescent cell-based assay designed to measure IL-15 stimulation or inhibition using the STAT-5 response element as a readout. The IL-15 Bioassay is provided in a thaw-and-use format as cryopreserved cells that can be thawed, plated and used in an assay without the need for cell propagation. The IL-15 Bioassay is also available in a Cell Propagation Model format, which includes cryopreserved cells that can be thawed, propagated and banked for long-term use. Features: • Prequalified according to ICH guidelines • Mechanism-of-action-based assay • No primary cell culture required Note: IL-15 Bioassay components are shipped separately because of differing temperature requirements. The IL-15 Bioassay Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay System and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium is shipped at ambient temperature. Storage Conditions: • Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will decrease cell viability and cell performance. • Store Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the serum. • For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. • Store RPMI 1640 Medium at 4°C protected from light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 233 15Bioassays for Biologics For complete and up-to-date product information visit: www.promega.com VEGF Bioassays Product Size Cat.# VEGF Bioassay 1 each GA2001 VEGF Bioassay 5X 5 each GA2005 VEGF Bioassay, Korea 1 each GA3001 VEGF Bioassay 5X, Korea 5 each GA3005 VEGF Bioassay, Taiwan 1 each GA4001 VEGF Bioassay 5X, Taiwan 5 each GA4005 Available Separately Size Cat.# VEGF Bioassay, Propagation Model 1 each GA1082 Recombinant VEGF 1 each J2371 Not for Medical Diagnostic Use. All products not available in all countries. Description: Vascular endothelial growth factor (VEGF) is an important signaling protein that is secreted from epithelial cells, tumor cells and macrophages. It has many functions, including stimulation of angiogenesis, increase of vascular permeability, enhancement of tumor invasion and survival, and inhibition of antitumor response in Treg cells. There are several VEGF receptor subtypes— VEGFR1, VEGFR2 and VEGFR3. VEGFR2 (also known as KDR) mediates almost all known receptor cellular responses to VEGF. VEGF occurs in four isoforms, including VEGF-121, VEGF-165, VEGF-189 and VEGF-206, of which VEGF-121 and -165 are diffusible forms. VEGF-165 is the predominant isoform in the body. All members of the VEGF family stimulate cellular response by binding to receptors of the receptor tyrosine kinase, namely VEGFR-1 (Flt-1) and VEGFR-2 (Flk-1/KDR). When VEGF binds to KDR, the receptor dimerizes and becomes activated through transphosphorylation. The VEGF Bioassay is a bioluminescent cell-based assay that measures VEGF stimulation and inhibition of KDR (VEGFR-2) using luciferase as a readout. This assay overcomes many of the limitations of current endothelial cell proliferation assays and can be used for discovery and development of novel biologic therapies aimed at either inducing or inhibiting the VEGF response. Recombinant VEGF ligand may be used as a positive control in the VEGF Bioassay. Human VEGF-165, amino acids Ala27–Arg191 (Accession# AAM03108), has a predicted molecular mass of 19kDa and is supplied in a solution of 5mM citric acid, 5mM NaHPO4, 0.15M NaCl (pH 4.0) and at a concentration of 200μg/ml. Features: • Prequalified according to ICH guidelines • Mechanism-of-action-based assay • No primary cell culture required Note: VEGF Bioassay components are shipped separately because of differing temperature requirements. The KDR/NFAT-RE HEK293 Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay System and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The DMEM Medium is shipped at ambient temperature. Storage Conditions: • Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will negatively impact cell viability and cell performance. • Store Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the serum. • For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. • Store DMEM Medium at 4°C protected from light. Minor variations in the color of the DMEM Medium may be observed. The color change will not impact assay performance. Bio-Glo™ Luciferase Assay System Product Size Cat.# Bio-Glo™ Luciferase Assay System 100 ml G7940 10 ml G7941 Not For Medical Diagnostic Use. Description: The Bio-Glo™ Luciferase Assay System provides a highly sensitive, robust, homogeneous reagent for the detection of firefly luciferase reporter gene expression in the ADCC Reporter Bioassay. Bio-Glo™ Luciferase Assay Reagent contains a new luciferase substrate, resulting in a reagent that is more stable and more tolerant to sample components than standard luciferase assay reagents. Bio-Glo™ Luciferase Assay Reagent is functionally tested for performance in the ADCC Reporter Bioassay and is intended for use with this or other bioassays. Features: • Simplified Assay Optimization: Robust performance, improved storage and convenient size. • Room Temperature or 4°C Storage: Extended stability of the Bio-Glo™ Reagent makes it more convenient for everyday use. • Improved Assay Precision: The Bio-Glo™ Reagent is less sensitive to mixing and dispensing conditions, enhancing reproducibility. Ideal for bioassay applications. • Brighter, Longer-Lasting Signal: Optimized for batch and continuousprocess handling, the extended bright light output allows high sensitivity, especially for extended incubations, such as 24 hours. • Reduced Unwanted Effects from Sample Components: The BioGlo™ Assay is less sensitive to culture media, phenol red and luciferase inhibitors than other luciferase assays. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 234 For complete and up-to-date product information visit: www.promega.com Fc Effector Activity Bioassays Mouse ADCC Bioassays Product Size Cat.# mFcγRIV ADCC Reporter Bioassay, Complete Kit 1 each M1201 mFcγRIV ADCC Reporter Bioassay, Core Kit 1 each M1211 mFcγRIV ADCC Reporter Bioassay, Core Kit, 5X 1 each M1215 mFcγRIV ADCC Reporter Bioassay, Complete Kit, Taiwan 1 each M1301 mFcγRIV ADCC Reporter Bioassay, Core Kit, Taiwan 1 each M1302 mFcγRIV ADCC Reporter Bioassay, Core Kit, 5X, Taiwan 1 each M1305 mFcγRIV ADCC Reporter Bioassay, Complete Kit, Korea 1 each M1401 mFcγRIV ADCC Reporter Bioassay, Core Kit, Korea 1 each M1402 mFcγRIV ADCC Reporter Bioassay, Core Kit, 5X, Korea 1 each M1405 mFcγRIV ADCC Bioassay Effector Cells, Propagation Model 1 each M1212 Not For Medical Diagnostic Use. All products not available in all countries. Description: Antibody-dependent cell-mediated cytotoxicity (ADCC) is an important mechanism of action (MOA) of antibodies that target virus-infected or diseased (e.g., tumor) cells for destruction by components of the cell-mediated immune system. Mouse FcγRIV (mFcγRIV) is the predominant receptor involved in ADCC in the mouse and is more closely related to human FcγRIIIa, the primary Fc receptor involved in ADCC in humans, than mFcγRIII. The mFcγRIV ADCC Reporter Bioassay is a biologically relevant MOA-based assay that can be used to measure the activity of mouse antibodies that specifically bind and activate FcγRIV. Mouse IgG2a, and to a lesser extent IgG2b, are known to mediate ADCC through the activation of mFcγRIV. In contrast, mouse IgG1 does not bind to mFcγIV. The bioassay overcomes the limitations of more labor-intensive and highly variable primary cell assays. The bioassay workflow is simple and robust, compatible with 96-well and 384-well plate formats and, unlike traditional primary cell-based assays, provides a quantitative measure of ADCC with low variability and high accuracy. mFcγRIV ADCC Bioassay Effector Cells, Propagation Model, allows propagation and banking of the mFcγRIV Effector Cells. Bio-Glo™ Luciferase Assay System is the required reagent for use with mFcγRIV ADCC Bioassay Effector Cells, Propagation Model. Features: • Available in two kit formats: Complete, with everything you need to get started, and Core, used with customer-defined Ab and target cells. • Propagation model allows and banking of mFcγRIV ADCC bioassay effector cells. Storage Conditions: Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will negatively affect cell viability and cell performance. Bio-Glo™ Luciferase Assay System Product Size Cat.# Bio-Glo™ Luciferase Assay System 100 ml G7940 10 ml G7941 Not For Medical Diagnostic Use. Description: The Bio-Glo™ Luciferase Assay System provides a highly sensitive, robust, homogeneous reagent for the detection of firefly luciferase reporter gene expression in the ADCC Reporter Bioassay. Bio-Glo™ Luciferase Assay Reagent contains a new luciferase substrate, resulting in a reagent that is more stable and more tolerant to sample components than standard luciferase assay reagents. Bio-Glo™ Luciferase Assay Reagent is functionally tested for performance in the ADCC Reporter Bioassay and is intended for use with this or other bioassays. Features: • Simplified Assay Optimization: Robust performance, improved storage and convenient size. • Room Temperature or 4°C Storage: Extended stability of the Bio-Glo™ Reagent makes it more convenient for everyday use. • Improved Assay Precision: The Bio-Glo™ Reagent is less sensitive to mixing and dispensing conditions, enhancing reproducibility. Ideal for bioassay applications. • Brighter, Longer-Lasting Signal: Optimized for batch and continuousprocess handling, the extended bright light output allows high sensitivity, especially for extended incubations, such as 24 hours. • Reduced Unwanted Effects from Sample Components: The BioGlo™ Assay is less sensitive to culture media, phenol red and luciferase inhibitors than other luciferase assays. Storage Conditions: Store the Bio-Glo™ Luciferase Assay System components at –30°C to –10°C. The Bio-Glo™ Luciferase Assay Buffer can be stored at below 30°C for up to three months with approximately a 10% change in reagent functionality. For optimal performance, reconstituted Bio-Glo™ Luciferase Assay Reagent should be used the day of preparation. However, once reconstituted, Bio-Glo™ Luciferase Assay Reagent can be stored at –20°C for up to 6 weeks. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 235 15Bioassays for Biologics For complete and up-to-date product information visit: www.promega.com ADCP Bioassays Product Size Cat.# FcγRIIa-H ADCP Reporter Bioassay, Complete Kit 1 each G9901 FcγRIIa-H ADCP Reporter Bioassay, Complete Kit, Korea 1 each G9902 FcγRIIa-H ADCP Reporter Bioassay, Complete Kit, Taiwan 1 each G9903 FcγRIIa-H ADCP Reporter Bioassay, Core Kit 1 each G9991 FcγRIIa-H ADCP Reporter Bioassay, Core Kit, Korea 1 each G9992 FcγRIIa-H ADCP Reporter Bioassay, Core Kit, Taiwan 1 each G9993 FcγRIIa-H ADCP Reporter Bioassay, Core Kit 5X 1 each G9995 FcγRIIa-H ADCP Reporter Bioassay, Core Kit 5X, Korea 1 each G9996 FcγRIIa-H ADCP Reporter Bioassay, Core Kit 5X, Taiwan 1 each G9997 FcγRIIa-H ADCP Bioassay Effector Cells, Propagation Model 1 each G9871 Not For Medical Diagnostic Use. All products not available in all countries. Description: Antibody-dependent cell-mediated phagocytosis (ADCP) is an important mechanism of action (MOA) of therapeutic antibodies. In vivo, ADCP can be mediated by monocytes, macrophages, neutrophils and dendritic cells via FcγRIIa, FcγRI and FcγRIIIa. While all three receptors can participate in ADCP, FcγRIIa is believed to be the predominant Fcγ receptor involved in this process. The FcγRIIa-H ADCP Reporter Bioassay is a biologically relevant MOA-based assay that can be used to measure the potency and stability of antibodies and other biologics that specifically bind and activate FcγRIIa. The assay consists of Jurkat cells stably expressing human FcγRIIa-H (the high-affinity H131 variant) and NFAT-induced luciferase. The bioassay is prequalified according to ICH guidelines and shows the precision, accuracy and linearity required for routine use in potency and stability studies. The bioassay workflow is simple and robust, compatible with 96-well and 384-well plate formats, and unlike traditional primary cell-based assays, amenable for use in quality-controlled drug development settings. Product Kit Formats The FcγRIIa-H ADCP Reporter Bioassay is available in multiple product kit formats: Complete Kit • Includes FcγRIIa-H Effector Cells, Target Cells (Raji), Control Antibody, Cell Culture Medium and Assay Reagents. • Recommended for use as a starter kit. Core Kits • Include FcγRIIa-H Effector Cells, Cell Culture Medium and Assay Reagents. • Recommended for routine use with customer-defined antibody and target cells. • Available in 1X and 5X sizes. Note: The FcγRIIa-H ADCP Reporter Bioassay components are shipped separately because of temperature requirements. The FcγRIIa-H Effector Cells and Target Cells (Raji) are shipped on dry ice. The Bio-Glo™ Luciferase Assay System, Low IgG Serum and ADCP Control Ab, Anti-CD20, are shipped on dry ice, separately from the cells. The RPMI 1640 Medium is shipped at ambient temperature. Storage Conditions: Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will negatively affect cell viability and cell performance. ADCP Control Ab, Anti-CD20, Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Low IgG Serum should be stored at –20°C. Avoid multiple freeze-thaw cycles of the serum. For optimal performance, reconstituted Bio-Glo™ Reagent should only be used on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. RPMI 1640 Medium should be stored at 4°C protected from fluorescent light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 236 For complete and up-to-date product information visit: www.promega.com ADCC Bioassays Product Size Cat.# ADCC Reporter Bioassay, Complete (Raji) 1 each G7015 ADCC Reporter Bioassay, Complete (WIL2-S) 1 each G7014 ADCC Reporter Bioassay, Core Kit 1 each G7010 ADCC Reporter Bioassay, Target (Raji) 1 each G7016 ADCC Reporter Bioassay, Target (WIL2-S) 1 each G7013 ADCC Reporter Bioassay, Core Kit 5X 1 each G7018 ADCC Bioassay Effector Cells, Propagation Model 1 each G7102 ADCC Reporter Bioassay, F Variant, Core Kit 1 each G9790 ADCC Reporter Bioassay, F Variant, Core Kit 5X 1 each G9798 ADCC Bioassay Effector Cells, F Variant, Propagation Model 1 each G9302 G7015, G7014, G7010, G7016, G7013, G7018 For Research Use Only. Not for Use in Diagnostic Procedures. G7102, G9790, G9798, G9302 Not For Medical Diagnostic Use. All products not available in all countries. Description: Fc receptor-mediated antibody-dependent cell-mediated cytotoxicity (ADCC) is an important mechanism of action (MOA) by which antibodies target disease cells for elimination. Classic methods used to measure ADCC use primary donor peripheral blood mononuclear cells (PBMCs) or purified natural killer (NK) cells that express Fc receptors on their cell surface. After engaging the Fc region of a relevant antibody bound to a target disease cell, Fc receptors transduce intracellular signals within the effector cell, resulting in elimination of the target cell. These primary cell-based assays are highly variable as a result of donor differences and the requirement for cell culture and expansion. The ADCC Reporter Bioassay provides a biologically relevant and specific MOA-based measure of ADCC without the complex workflow and variability inherent in primary cell-based assays. Specifically, primary donor PBMC or NK cells are replaced with a Jurkat cell stably expressing human FcγRIIIa (either the high-affinity V158 or low-affinity F158 receptor) and NFAT-induced luciferase. Importantly, the ADCC Reporter Bioassay demonstrates antibody activity ranking equivalent to classic LDH release ADCC bioassays. The bioassay also can be used to quantify effects of antibody glycosylation on Fc effector function. Product Kit Formats The ADCC Reporter Bioassay is available in multiple product kit formats: Complete Kits • Include ADCC Bioassay Effector Cells, Target Cells, Control Antibody, Cell Culture Medium and Assay Reagents. • Recommended for use as a starter kit. • Available with either Raji or WIL2-S Target Cells. Core Kits • Include ADCC Bioassay Effector Cells, Cell Culture Medium and Assay Reagents. • Recommended for routine use with customer-defined antibody and target cells. • Available in 1X and 5X sizes. Target Kits • Include ADCC Bioassay Target Cells and Control Antibody. • Recommended for use as a control with all Fc Effector Bioassay Core Kits. • Available with either Raji or WIL2-S Target Cells. Storage Conditions: The ADCC Reporter Bioassay components are shipped separately because of temperature requirements. The ADCC Bioassay Effector Cells and Target Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay System and Low IgG Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium is shipped at ambient temperature. The Control Ab, Anti-CD20, is shipped on gel ice. Upon arrival, immediately transfer the vials of ADCC Bioassay Effector Cells and Target Cells for long-term storage below –140°C (freezer or liquid nitrogen vapor phase). The cells are sensitive, and care should be taken when handling. For safety reasons, do not store cell vials submerged in liquid nitrogen. Store the Low IgG Serum at –20°C. Avoid multiple freeze-thaw cycles. Store the Control Ab, Anti-CD20, at 4°C. Store the Bio-Glo™ Luciferase Assay Buffer and Luciferase Assay Substrate at –20°C. For optimal performance, use reconstituted Bio-Glo™ Luciferase Assay Reagent on the day of preparation. However, once reconstituted, you can store Bio-Glo™ Luciferase Assay Reagent at –20°C for up to 6 weeks. Store RPMI 1640 Medium at 4°C protected from fluorescent light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 237 15Bioassays for Biologics For complete and up-to-date product information visit: www.promega.com Immune Checkpoint Bioassays LAG-3/MHCII Blockade Bioassay Product Size Cat.# LAG-3/MHCII Blockade Bioassay 1 each JA1111 LAG-3/MHCII Blockade Bioassay 5X 5 each JA1115 LAG-3/MHCII Blockade Bioassay, Korea 1 each JA2111 LAG-3/MHCII Blockade Bioassay 5X, Korea 5 each JA2115 LAG-3/MHCII Blockade Bioassay, Taiwan 1 each JA3111 LAG-3/MHCII Blockade Bioassay 5X, Taiwan 5 each JA3115 Available Separately LAG-3/MHCII Blockade Bioassay, Propagation Model 1 each JA1112 Control Ab, Anti-LAG-3 100µg K1150 TCR Activating Antigen Stock Solution 500µl K1201 Not For Medical Diagnostic Use. All products not available in all countries. Description: The LAG-3/MHCII Blockade Bioassay is a bioluminescent cell-based assay that measures potency and stability of antibodies and other biologics designed to block the interaction of LAG-3 with its best characterized ligand, major histocompatibility complex II (MHCII). LAG-3, also known as CD223, is an immune checkpoint receptor expressed on activated CD4+ and CD8+ T cells and natural killer (NK) cells. LAG-3 plays a critical role in regulating immune responses to tumor antigens and autoantigens. Engagement of LAG-3 by MHCII inhibits TCR signaling, cytokine production and proliferation of activated T cells. Therapeutic antibodies designed to block the LAG-3/MHCII interaction show promising results in clinical trials for the treatment of a variety of cancers. The LAG-3/MHCII Blockade Bioassay reflects the mechanism of action (MOA) of biologics designed to block the interaction of LAG-3 with its ligand, MHCII. The LAG-3/MHCII Blockade Bioassay, Propagation Model, overcomes the limitations of existing assays. The LAG-3 Effector Cells and MHCII APC Cells are provided in a Cell Propagation Model (CPM) format, which includes cryopreserved cells that can be thawed, propagated and banked for long-term use. Features: • Prequalified according to ICH guidelines • 96- and 384-well plate formats • No primary cell culture required Note: The LAG-3/MHCII Blockade Bioassay components are shipped separately due to differing temperature requirements. The LAG-3 Effector Cells and MHCII APC Cells are shipped on dry ice. The TCR Activating Antigen, Bio-Glo™ Luciferase Assay System and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium and DMEM Medium are shipped at ambient temperature. Storage Conditions: • Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will negatively impact cell viability and cell performance. • Store TCR Activating Antigen, Bio-Glo™ Luciferase Assay Substrate, BioGlo™ Luciferase Assay Buffer, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the antigen and serum. • For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. • Store RPMI 1640 Medium and DMEM Medium at 4°C protected from fluorescent light. 4-1BB Bioassay Product Size Cat.# 4-1BB Bioassay 1 each JA2351 4-1BB Bioassay 5X 5 each JA2355 4-1BB Bioassay, Korea 1 each JA3351 4-1BB Bioassay 5X, Korea 5 each JA3355 4-1BB Bioassay, Taiwan 1 each JA4411 4-1BB Bioassay 5X, Taiwan 5 each JA4415 Available Separately 4-1BB Bioassay, Propagation Model 1 each J2332 FcγRIIb CHO-K1 Cells 1 each JA2251 FcγRIIb CHO-K1 Cells 5X 5 each JA2255 FcγRIIb CHO-K1 Cells, Propagation Model 1 each J2232 Control Antibody, Anti-4-1BB 50µg K1161 Not For Medical Diagnostic Use. All products not available in all countries. Description: 4-1BB (CD137/TNFRSF9), a member of the tumor necrosis factor receptor superfamily, is an inducible co-stimulatory receptor expressed on T cells, NK cells and innate immune cell populations. When present on the cell surface, 4-1BB interacts with 4-1BB ligand (4-1BBL) and induces subsequent cell proliferation and production of interferon gamma (IFNγ) and IL-2, particularly in T and NK cells. Current methods used to measure the activity of biologic drugs targeting 4-1BB rely on primary human T cells and measurement of functional endpoints such as cell proliferation, cell surface marker expression, and IFNγ and interleukin-2 (IL-2) production. These assays are laborious and highly variable due to their reliance on donor primary cells, complex assay protocols and unqualified assay reagents. As a result, these assays are difficult to establish in a qualitycontrolled, drug-development setting. The 4-1BB Bioassay is a bioluminescent cell-based assay that overcomes the limitations of existing assays and can be used to measure the potency and stability of ligands or agonist antibodies that can bind and activate 4-1BB. The assay consists of a genetically engineered Jurkat T cell line that expresses human 4-1BB and a luciferase reporter driven by a response element that can respond to 4-1BB ligand/agonist antibody stimulation. The 4-1BB Effector Cells are provided in thaw-and-use format as cryopreserved cells that can be thawed, plated and used in an assay without the need for cell culture and propagation. The 4-1BB Bioassay is also available in a Cell Propagation Model (CPM) format, which includes cryopreserved cells that can be thawed, propagated and banked for long-term use. Features: • Prequalified according to ICH guidelines • Mechanism-of-action-based assay • No primary cell culture required Note: The 4-1BB Bioassay components are shipped separately because of different temperature requirements. The 4-1BB Effector Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay Substrate and Buffer and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium is shipped at ambient temperature. Storage Conditions: • Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will decrease cell viability and cell performance. • Store Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the serum. • For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. • Store RPMI 1640 Medium at 4°C protected from fluorescent light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 238 For complete and up-to-date product information visit: www.promega.com PD-1 + TIGIT Combination Bioassay Product Size Cat.# PD-1 + TIGIT Combination Bioassay 1 each J2211 PD-1 + TIGIT Combination Bioassay 5X 5 each J2215 PD-1 + TIGIT Combination Bioassay, Korea 1 each J2311 PD-1 + TIGIT Combination Bioassay 5X, Korea 5 each J2315 PD-1 + TIGIT Combination Bioassay, Taiwan 1 each J2411 PD-1 + TIGIT Combination Bioassay 5X, Taiwan 5 each J2415 Available Separately Size Cat.# PD-1 + TIGIT Combination Bioassay, Propagation Model 1 each J2102 Control Antibody, Anti-TIGIT 100µg J2051 Not for Medical Diagnostic Use. All products not available in all countries. Description: PD-1 and TIGIT are both immune inhibitory receptors that are expressed on T cells. Engagement of PD-1 by PD-L1 on an adjacent cell inhibits TCR signaling and TCR-mediated proliferation, transcriptional activation and cytokine production. The ligand for TIGIT is CD155. TIGIT negatively regulates NK cell killing and T cell activation by competing with CD226 for binding to CD155 and by directly interfering with CD226 homodimerization. Preclinical cancer studies suggest that targeted therapies that simultaneously block PD-1 and TIGIT are superior to those that block either pathway alone. The PD-1+TIGIT Combination Bioassay reflects the mechanism of action (MOA) of biologics designed to block the PD-1/PD-L1 and TIGIT/CD155 interactions. The PD-1 + TIGIT Combination Bioassay, Propagation Model, is a bioluminescent cell-based assay that overcomes the limitations of existing assays and can be used to measure the potency and stability of antibodies and other biologics targeting PD-1 and TIGIT. The assay consists of two genetically engineered cell lines: • PD-1 + TIGIT Effector Cells: Jurkat T cells engineered to express human PD-1 and human TIGIT with a luciferase reporter driven by a native promoter that can respond to both TCR activation and CD226 co-stimulation • PD-L1 + CD155 aAPC/CHO-K1 Cells: CHO-K1 cells engineered to express human PD-L1 and human CD155 with an engineered cell-surface protein designed to activate the T cell receptor (TCR) complex in an antigen-independent manner The PD-1 + TIGIT Effector Cells and PD-L1+CD155 aAPC/CHO-K1 Cells are provided in Cell Propagation Model (CPM) format, which includes cryopreserved cells that can be thawed, propagated and banked for long-term use. Features: • Prequalified according to ICH guidelines • 96- and 384-well plate formats • No primary cell culture required Note: The PD-1 + TIGIT Combination Bioassay components are shipped separately because of differing temperature requirements. The PD-1+TIGIT Effector Cells and PD-L1+CD155 aAPC/CHO-K1 Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay Substrate and Buffer and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium and Ham’s F-12 Medium are shipped at ambient temperature. Storage Conditions: • Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will negatively impact cell viability and cell performance. • Store Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the serum. • For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. • Store RPMI 1640 Medium and Ham’s F-12 Medium at 4°C, protected from fluorescent light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 239 15Bioassays for Biologics For complete and up-to-date product information visit: www.promega.com CTLA-4 Blockade Bioassay Product Size Cat.# CTLA-4 Blockade Bioassay 1 each JA3001 CTLA-4 Blockade Bioassay 5X 5 each JA3005 CTLA-4 Blockade Bioassay, Korea 1 each JA4001 CTLA-4 Blockade Bioassay 5X, Korea 5 each JA4005 CTLA-4 Blockade Bioassay, Taiwan 1 each JA5001 CTLA-4 Blockade Bioassay 5X, Taiwan 5 each JA5005 Available Separately Size Cat.# CTLA-4 Blockade Bioassay, Propagation Model 1 each JA1400 Control Antibody, Anti-CTLA-4 100µg JA1020 Not for Medical Diagnostic Use. All products not available in all countries. Description: CTLA-4, also known as CD152, is an immune inhibitory receptor constitutively expressed on regulatory T cells (Tregs) and upregulated in activated T cells. CTLA-4 plays a critical role in regulating immune responses to tumor antigens and autoantigens. When CTLA-4 expression is upregulated on the surface of T cells, the T cells bind B7 with a higher avidity, and thus outcompete the positive co-stimulatory signal from CD28. In addition, engagement of CTLA-4 by either of its ligands, CD80 (B7-1) or CD86 (B7-2) on an adjacent antigen presenting cell (APC) inhibits CD28 co-stimulation of T cell activation, cell proliferation and cytokine production. The CTLA-4 Blockade Bioassay reflects the mechanism of action (MOA) of biologics designed to block the interaction of CTLA-4 with its ligands, CD80 and CD86. CTLA-4 Blockade Bioassay, Propagation Model, allows propagation and banking of the CTLA-4 Effector Cells. Bio-Glo™ Luciferase Assay System (Cat.# G7940, G7941) is the required reagent for use with CTLA-4 Blockade Bioassay, Propagation Model. Features: • Prequalified according to ICH guidelines • 96- and 384-well plate formats • No primary cell culture required Note: The CTLA-4 Blockade Bioassay components are shipped separately because of differing temperature requirements. The CTLA-4 Effector Cells and aAPC/Raji Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay System and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium is shipped at ambient temperature. Storage Conditions: • Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will negatively impact cell viability and cell performance. • Store Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the serum. • For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. • Store RPMI 1640 Medium at 4°C, protected from fluorescent light. TIGIT/CD155 Blockade Bioassay Product Size Cat.# TIGIT/CD155 Blockade Bioassay 1 each J2201 TIGIT/CD155 Blockade Bioassay 5X 5 each J2205 TIGIT/CD155 Blockade Bioassay, Korea 1 each J2301 TIGIT/CD155 Blockade Bioassay 5X, Korea 5 each J2305 TIGIT/CD155 Blockade Bioassay, Taiwan 1 each J2401 TIGIT/CD155 Blockade Bioassay 5X, Taiwan 5 each J2405 Available Separately Size Cat.# TIGIT/CD155 Blockade Bioassay, Propagation Model 1 each J2092 Control Antibody, Anti-TIGIT 100µg J2051 Not for Medical Diagnostic Use. All products not available in all countries. Description: TIGIT, also known as WUCAM and Vstm3, is an immune checkpoint protein expressed on lymphocytes. Highest expression levels are observed on effector CD4+ and CD8+ T cells, regulatory T cells, and NK cells. TIGIT has several distinct mechanisms of action that inhibit lymphocyte activation. First, TIGIT is an inhibitory counterpart of the co-stimulatory receptor CD226. When TIGIT is present on the surface of lymphocytes, it outcompetes CD226 for CD155 binding and thus negates CD226 signaling. Second, TIGIT inhibits CD226 homodimerization in cis, preventing CD226 signaling. Third, the cytoplasmic tail of TIGIT contains an immunoreceptor tyrosine-based inhibitory motif (ITIM), which could potentially lead to inhibitory signaling. The TIGIT/CD155 Blockade Bioassay reflects the mechanism of action (MOA) of biologics designed to block the TIGIT/CD155 interaction. The TIGIT/CD155 Blockade Bioassay, Propagation Model, allows propagation and banking of the TIGIT Effector Cells as well as the CD155 aAPC/CHO-K1 Cells. Bio-Glo™ Luciferase Assay System (Cat.# G7940, G7941) is the required reagent for use with TIGIT/CD155 Blockade Bioassay, Propagation Model. Features: • Prequalified according to ICH guidelines • 96- and 384-well plate formats • No primary cell culture required Note: The TIGIT/CD155 Blockade Bioassay components are shipped separately because of differing temperature requirements. The TIGIT Effector Cells and CD155 aAPC/CHO-K1 Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay Substrate and Buffer and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium is shipped at ambient temperature. Storage Conditions: • Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will decrease cell viability and cell performance. • Store Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the serum. • For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. • Store RPMI 1640 Medium at 4°C protected from fluorescent light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 240 For complete and up-to-date product information visit: www.promega.com PD-1/PD-L1 Blockade Bioassays Product Size Cat.# PD-1/PD-L1 Blockade Bioassay 1 each J1250 PD-1/PD-L1 Blockade Bioassay, Propagation Model 1 each J1252 PD-1/PD-L1 Blockade Bioassay 5X 1 each J1255 Available Separately Size Cat.# PD-L1 Negative Cells 1 each J1191 PD-L1 Negative Cells 5X 1 each J1195 Control Ab, Anti-PD-1 1 each J1201 Not For Medical Diagnostic Use. All products not available in all countries. Description: PD-1 is an immune inhibitory receptor expressed on activated T cells and B cells and plays a critical role in regulating immune responses to tumor antigens and autoantigens. Engagement of PD-1 by either of its ligands, PD-L1 or PD-L2, on an adjacent cell inhibits TCR signaling and TCR-mediated proliferation, transcriptional activation and cytokine production. Therapeutic antibodies and Fc fusion proteins designed to block the PD-1/PD-L1 interaction show promising results in clinical trials for the treatment of a variety of cancers. The PD-1/PD-L1 Blockade Bioassay is a biologically relevant MOA-based assay that can be used to measure the potency and stability of antibodies and other biologics designed to block the PD-1/PD-L1 interaction. The assay consists of two genetically engineered cell lines: • PD-1 Effector Cells: Jurkat T cells stably expressing human PD-1 and NFAT-induced luciferase. • PD-L1 aAPC/CHO-K1 Cells: CHO-K1 cells stably expressing human PD-L1 and a cell surface protein designed to activate cognate TCRs in an antigen-independent manner. When the two cell types are co-cultured, the PD-1/PD-L1 interaction inhibits TCR signaling and NFAT-mediated luciferase activity. Addition of an antibody that blocks either PD-1 or PD-L1 releases the inhibitory signal and results in TCR signaling and NFAT-mediated luciferase activity. Product Kit Formats and Related Products • Kits are available in 1X and 5X sizes. • Control Ab, Anti-PD-1 is available separately. • PD-L1 Negative Cells are available separately. Features: • Use a Bioassay Prequalified According to ICH Guidelines: The bioassays demonstrate the precision, accuracy and linearity required for routine use in potency and stability studies. • Employ Simple and Robust Workflow: Easy to implement with no specialized skills or training required. • Run the Bioassay in 96-Well and 384-Well Plate Format: Amenable for antibody screening and drug discovery. • Choose Multiple Product Formats: Flexibility to meet your experimental and workflow needs. Note: The PD-1/PD-L1 Blockade Bioassay components are shipped separately because of temperature requirements. The PD-1 Effector Cells and PD-L1 aAPC/CHO-K1 Cells are shipped on dry ice. The Bio-Glo™ Luciferase Assay System and Fetal Bovine Serum are shipped on dry ice, separately from the cells. The RPMI 1640 Medium and Ham’s F12 Medium are shipped at ambient temperature. Storage Conditions: Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C because this will negatively impact cell viability and cell performance. Store Bio-Glo™ Luciferase Assay Substrate, Bio-Glo™ Luciferase Assay Buffer and Fetal Bovine Serum at –20°C. Avoid multiple freeze-thaw cycles of the serum. For optimal performance, use reconstituted Bio-Glo™ Reagent on the day of preparation. However, once reconstituted, Bio-Glo™ Reagent can be stored at –20°C for up to 6 weeks. Store RPMI 1640 Medium at 4°C protected from fluorescent light. Bio-Glo™ Luciferase Assay System Product Size Cat.# Bio-Glo™ Luciferase Assay System 100 ml G7940 10 ml G7941 Not For Medical Diagnostic Use. Description: The Bio-Glo™ Luciferase Assay System provides a highly sensitive, robust, homogeneous reagent for the detection of firefly luciferase reporter gene expression in the ADCC Reporter Bioassay. Bio-Glo™ Luciferase Assay Reagent contains a new luciferase substrate, resulting in a reagent that is more stable and more tolerant to sample components than standard luciferase assay reagents. Bio-Glo™ Luciferase Assay Reagent is functionally tested for performance in the ADCC Reporter Bioassay and is intended for use with this or other bioassays. Features: • Simplified Assay Optimization: Robust performance, improved storage and convenient size. • Room Temperature or 4°C Storage: Extended stability of the Bio-Glo™ Reagent makes it more convenient for everyday use. • Improved Assay Precision: The Bio-Glo™ Reagent is less sensitive to mixing and dispensing conditions, enhancing reproducibility. Ideal for bioassay applications. • Brighter, Longer-Lasting Signal: Optimized for batch and continuousprocess handling, the extended bright light output allows high sensitivity, especially for extended incubations, such as 24 hours. • Reduced Unwanted Effects from Sample Components: The BioGlo™ Assay is less sensitive to culture media, phenol red and luciferase inhibitors than other luciferase assays. Storage Conditions: Store the Bio-Glo™ Luciferase Assay System components at –30°C to –10°C. The Bio-Glo™ Luciferase Assay Buffer can be stored at below 30°C for up to three months with approximately a 10% change in reagent functionality. For optimal performance, reconstituted Bio-Glo™ Luciferase Assay Reagent should be used the day of preparation. However, once reconstituted, Bio-Glo™ Luciferase Assay Reagent can be stored at –20°C for up to 6 weeks. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 241 15Bioassays for Biologics For complete and up-to-date product information visit: www.promega.com T Cell Activation Bioassays T Cell Activation Bioassays Product Size Cat.# T Cell Activation Bioassay (NFAT) 1 each J1621 T Cell Activation Bioassay (NFAT) 5X 5 each J1625 T Cell Activation Bioassay (IL-2) 1 each J1651 T Cell Activation Bioassay (IL-2) 5X 5 each J1655 T Cell Activation Bioassay (NFAT), Korea 1 each J1622 T Cell Activation Bioassay (NFAT) 5X, Korea 5 each J1626 T Cell Activation Bioassay (IL-2), Korea 1 each J1652 T Cell Activation Bioassay (IL-2) 5X, Korea 5 each J1656 T Cell Activation Bioassay (NFAT), Taiwan 1 each J1623 T Cell Activation Bioassay (NFAT) 5X, Taiwan 5 each J1627 T Cell Activation Bioassay (IL-2), Taiwan 1 each J1653 T Cell Activation Bioassay (IL-2) 5X, Taiwan 5 each J1657 T Cell Activation Bioassay (NFAT), Propagation Model 1 each J1601 T Cell Activation Bioassay (IL-2), Propagation Model 1 each J1631 Not For Medical Diagnostic Use. All products not available in all countries. Description: The T Cell Activation Bioassays consist of a genetically engineered Jurkat T cell line that expresses a luciferase reporter (TCR/CD3 Effector Cells) driven by either an NFAT-response element (NFAT-RE) or an IL-2 promoter. When the TCR/CD3 Effector Cells (NFAT) are engaged with an appropriate TCR/ CD3 ligand or anti-TCR/CD3 antibody, the TCR transduces intracellular signals resulting in NFAT-RE-mediated luminescence. Similarly, when the TCR/CD3 Effector Cells (IL-2) are co-engaged with an anti-TCR/CD3 and an anti-CD28 stimulus, receptor-mediated signaling results in IL-2 promoter-mediated luminescence. The bioassay is prequalified according to ICH guidelines and shows the precision, accuracy and linearity required for routine use in potency and stability studies. The bioassay workflow is simple, robust and compatible with 96-well and 384-well plate formats used for antibody screening and drug discovery. Additionally, the bioassay is tolerant to human serum, indicating potential for further development into a neutralizing antibody bioassay. T Cell Activation Bioassay, Propagation Model, allows propagation and banking of the TCR/CD3 Effector Cells. Bio-Glo™ Luciferase Assay System (Cat.# G7940, G7941) is the required reagent for use with T Cell Activation Bioassay, Propagation Model. Features: • Prequalified according to ICH guidelines. • Amenable to high-throughput formats. • No cell culture required. • Propagation model allows and banking of TCR/CD3 effector cells for use in T Cell Activation Bioassay. Storage Conditions: Upon arrival, immediately transfer the cell vials to below –140°C (freezer or liquid nitrogen vapor phase) for long-term storage. Do not store cell vials submerged in liquid nitrogen. Do not store cell vials at –80°C as this will decrease cell viability and cell performance. Bio-Glo™ Luciferase Assay System Product Size Cat.# Bio-Glo™ Luciferase Assay System 100 ml G7940 10 ml G7941 Not For Medical Diagnostic Use. Description: The Bio-Glo™ Luciferase Assay System provides a highly sensitive, robust, homogeneous reagent for the detection of firefly luciferase reporter gene expression in the ADCC Reporter Bioassay. Bio-Glo™ Luciferase Assay Reagent contains a new luciferase substrate, resulting in a reagent that is more stable and more tolerant to sample components than standard luciferase assay reagents. Bio-Glo™ Luciferase Assay Reagent is functionally tested for performance in the ADCC Reporter Bioassay and is intended for use with this or other bioassays. Features: • Simplified Assay Optimization: Robust performance, improved storage and convenient size. • Room Temperature or 4°C Storage: Extended stability of the Bio-Glo™ Reagent makes it more convenient for everyday use. • Improved Assay Precision: The Bio-Glo™ Reagent is less sensitive to mixing and dispensing conditions, enhancing reproducibility. Ideal for bioassay applications. • Brighter, Longer-Lasting Signal: Optimized for batch and continuousprocess handling, the extended bright light output allows high sensitivity, especially for extended incubations, such as 24 hours. • Reduced Unwanted Effects from Sample Components: The BioGlo™ Assay is less sensitive to culture media, phenol red and luciferase inhibitors than other luciferase assays. Storage Conditions: Store the Bio-Glo™ Luciferase Assay System components at –30°C to –10°C. The Bio-Glo™ Luciferase Assay Buffer can be stored at below 30°C for up to three months with approximately a 10% change in reagent functionality. For optimal performance, reconstituted Bio-Glo™ Luciferase Assay Reagent should be used the day of preparation. However, once reconstituted, Bio-Glo™ Luciferase Assay Reagent can be stored at –20°C for up to 6 weeks. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 242 For complete and up-to-date product information visit: www.promega.com Antibody Characterization rAsp-N, Mass Spec Grade Product Size Cat.# rAsp-N, Mass Spec Grade 10µg VA1160 For Research Use Only. Not for Use in Diagnostic Procedures. Description: rAsp-N, Mass Spec Grade, is a recombinant protease that was cloned from Stenotrophomonas maltophilia and purified from E. coli. rAsp-N is a highly active protease suitable for proteomic analysis of complex mixtures as well as peptide mapping of purified proteins, such as therapeutic monoclonal antibodies. The protease is provided in 10µg aliquots in a conical vial for easy and consistent resuspension. Features: • Less expensive alternative to native Asp-N • Larger volume (5X more protease) for more consistent resuspension • Use in complex proteomic analyses and peptide mapping of purified proteins Storage Conditions: Store the lyophilized product at –30°C to –10°C. Lys-C, Mass Spec Grade, and Lys-N, Mass Spec Grade Product Size Cat.# Lys-C, Mass Spec Grade 20µg VA1170 Lys-N, Mass Spec Grade 20µg VA1180 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Endoproteinase Lys-C, Mass Spec Grade, is a highly-purified serine protease that hydrolyzes specifically at the carboxyl side of lysines. Lys-C retains proteolytic activity under strong protein denaturing conditions such as 8M urea, which can be used to improve digestion of proteolytically resistant proteins. Lys-C, Mass Spec Grade, has optimal activity in the range of pH 7.0– 9.0. This protease can be used alone or in combination with other proteases to produce protein digests for peptide mapping applications or protein identification by peptide mass fingerprinting or MS/MS spectral matching. Endoproteinase Lys-N, Mass Spec Grade, is a zinc metalloprotease that cleaves at the amino side of lysines. Lys-N, Mass Spec Grade, retains proteolytic activity under strong protein denaturing conditions such as 8M urea, which can be used to improve digestion of proteolytically resistant proteins. Charged amino-terminal peptide fragments generated by Lys-N, Mass Spec Grade, are useful for de novo sequencing with ETD fragmentation techniques. Features: • Active under strong denaturing conditions • Choice of N-terminal (Lys-N) or C-terminal (Lys-C) lysine cleavage • Generates longer peptides than with tryptic digests Storage Conditions: Store the lyophilized product at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 243 15Bioassays for Biologics For complete and up-to-date product information visit: www.promega.com AccuMAP™ Low pH Protein Digestion Kit Product Size Cat.# AccuMAP™ Low pH Protein Digestion Mini Kit 1 each VA1040 AccuMAP™ Low pH Protein Digestion Maxi Kit 1 each VA1050 Available Separately AccuMAP™ Denaturing Solution 1ml VA1000 AccuMAP™ 10X Low pH Reaction Buffer 1ml VA1010 AccuMAP™ 100X Oxidation Suppressant 50µl VA1020 AccuMAP™ Low pH Resistant rLys-C Solution 120µl VA1030 TCEP 15mg VB1000 Iodoacetamide 15mg VB1010 AccuMAP™ Modified Trypsin Solution 120µl V5285 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The AccuMap™ Low pH Protein Digestion Kit is designed for accurate, reproducible characterization of biotherapeutic proteins by peptide mapping using LC/MS or UV HPLC. The entire sample preparation procedure is performed at low (mildly acidic) pH to suppress artificial deamidation and disulfide bond scrambling. The kit also contains an optional agent for suppression of protein oxidation during sample preparation. Features: • Complete sample preparation in 4.5–5 hours. • Highly reproducible digestion results. • For reduced and nonreduced proteins. Storage Conditions: Store at less than –65°C. Magne™ Protein G and Magne™ Protein A Beads Product Size Cat.# Magne™ Protein G Beads, 20% Slurry 1 ml G7471 5 ml G7472 50 ml G7473 Magne™ Protein A Beads, 20% Slurry 1 ml G8781 5 ml G8782 50 ml G8783 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Magne™ Protein G and Magne™ Protein A Beads are magnetic affinity beads with high specificity and high capacity for purification of immunoglobulins from cell culture media, ascites and serum samples. These paramagnetic beads are composed of iron encapsulated in macroporous cellulose with low nonspecific binding. The magnetic beads use a novel attachment chemistry to immobilize recombinant Protein G or Protein A protein molecules in the same orientation on the surface of the bead. The oriented attachment is known to improve the functionality of immobilized proteins. These beads offer a convenient method for achieving high purity and high recovery of monoclonal and polyclonal antibodies from a variety of biological samples. The superb magnetic properties of Magne™ Protein G and Magne™ Protein A Beads allow rapid and efficient capture of antibodies either with manually processed samples or in a high-throughput manner using the Promega ReliaPrep™ LV 32 HSM Instrument or a robotic platform such as the Beckman Coulter Biomek® FX. Features: • High Capacity: Binding capacities in excess of 25mg per milliliter of settled beads are observed depending on antibody species and isotype. • Ease of Handling: Minimize losses during purification and increase sample throughput due to exceptional magnetic properties. • High Purity: Ensure high-quality purification because of low nonspecific binding on beads. • Optimized Performance: Use validated antibody purification methods for small (20µl) to medium (50ml) sample volumes. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 4°C. Do not freeze. Do not allow beads to dry during storage or use. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 244 For complete and up-to-date product information visit: www.promega.com pHAb Reactive Dyes Product Size Cat.# pHAb Amine Reactive Dye 1 × 250 μg G9841 4 × 250 μg G9845 pHAb Thiol Reactive Dye 1 × 250 μg G9831 4 × 250 μg G9835 For Research Use Only. Not for Use in Diagnostic Procedures. Description: pHAb Dyes are pH sensor dyes that have very low fluorescence at pH > 7 and a dramatic increase in fluorescence as the pH of the solution becomes acidic. pHAb Dyes have excitation maxima (Ex) at 532nm and emission maxima (Em) at 560nm. pHAb Dyes are designed specifically for antibody labeling and are available in two reactive forms suitable for antibody conjugations. pHAb Amine Reactive Dye has a succinimidyl ester group that reacts with primary amines available on the lysine amino acids on the antibodies. pHAb Thiol Reactive Dye has a maleimide group that reacts with thiols. This maleimide group is conjugated to the antibody after the cysteine disulfide bonds in the hinge region of the antibody are reduced to thiols using a reducing agent, such as DTT or TCEP. A key feature of pHAb Dyes is that they have two sulfonate groups per dye, which increases solubility and reduces the aggregation often seen with other non-sulfonated dyes. pHAb Dyes maintain their fluorescence response to pH change even after antibody conjugation. Even though antibody conjugation is the key application, any protein containing primary amines on lysine amino acids or thiols on cysteine amino acids can be conjugated with pHAb Dyes. Features: • Accurately Determine Antibody Internalization: Increase in fluorescence as the pH of the solution becomes acidic. • Conjugate Directly from Biological Samples on Expressing Antibodies (i.e., Cell Media): On-bead conjugation. • Measure Internalization in Real Time: Compatible with 96-well plate-based assay. • Know that Antibody Conjugated with pH-Sensitive Dye is Fluorescent Only when Internalized: pH profile of free and antibody conjugated dye is similar. • Get High Signal-to-Background Ratios: Individual dyes are cell-impermeable when unconjugated. Storage Conditions: Store at –30°C to –10°C for 1 month and below –65°C for long-term storage. IdeS Protease and IdeZ Protease Product Size Conc. Cat.# IdeS Protease 5,000 units V7511 IdeS Protease 25,000 units V7515 IdeZ Protease 5,000 units V8341 IdeZ Protease, Frozen 2,000 units 50 u/µl V8342 IdeZ Protease 25,000 units V8345 For Research Use Only. Not for Use in Diagnostic Procedures. Description: IdeS Protease IdeS Protease is an immunoglobulin-degrading enzyme from Streptococcus pyogenes (IdeS). It is an engineered recombinant protease overexpressed in E. coli that cleaves Immunoglobulin G (IgG) with high specificity at a single site below the hinge region, yielding F(ab′) 2 and Fc fragments. The protocol for a standard reaction is to add the IdeS Protease to the IgG sample, add 1 unit of IdeS Protease per 1µg of IgG to be digested, and incubate the sample at 37°C for 30–60 minutes in a neutral pH buffer. IdeZ Protease IdeZ Protease is an immunoglobulin-degrading enzyme from Streptococcus equi subspecies zooepidemicus. It is an engineered recombinant protease overexpressed in E. coli. Like IdeS Protease, IdeZ Protease specifically cleaves IgG molecules below the hinge region to yield F(ab′) 2 and Fc fragments. However, IdeZ Protease has significantly improved activity against mouse IgG2a and IgG3 subclasses compared to IdeS Protease. Features: • See Digestion in 30 Minutes with No Optimization: Fast and easy to use. • Cleave Exclusively at a Single Site Below the Hinge to Produce F(ab′) 2 and Fc Fragments: Highly reproducible and specific. • Expect High Performance: Essentially 100% complete digestion. • Effectively Cleave Many IgG Molecules: Both IdeS and IdeZ Proteases effectively cleave human IgG1, IgG2, IgG3 and IgG4, monkey, sheep, rabbit, humanized and chimeric IgGs as well as Fc-fusion proteins. However, mouse IgG2a and IgG3 are cleaved by IdeZ Protease only. Storage Conditions: Store IdeS Protease at –30°C to –10°C. Store IdeZ Protease at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 245 15Bioassays for Biologics For complete and up-to-date product information visit: www.promega.com PNGase F Product Size Conc. Cat.# PNGase F 500 units 10 u/µl V4831 For Research Use Only. Not for Use in Diagnostic Procedures. Description: PNGase F is a recombinant glycosidase cloned from Elizabethkingia miricola and overexpressed in E. coli. PNGase F has a molecular weight of 36kDa. PNGase F catalyzes the cleavage of N-linked oligosaccharides between the innermost GlcNAc and asparagine residues of high mannose, hybrid and complex oligosaccharides from N-linked glycoproteins. PNGase F will not remove oligosaccharides containing Alpha-(1,3)-linked core fucose commonly found on plant glycoproteins. Unit Definition: One unit of PNGase F will catalyze the deglycosylation of 1 nanomole of denatured Ribonuclease B (RNase B) in one minute at 37°C. One Promega unit is equal to 1 IUB milliunit. Molecular Weight: PNGase F has a molecular weight of approximately 36kDa. Physical Form: PNGase F is supplied as a liquid in 20mM Tris-HCl (pH 7.5 at 25°C), 50mM NaCl and 5mM EDTA at a concentration of 10,000u/ml. Storage Conditions: Store at 2–10°C. ISOQUANT® Isoaspartate Detection Kit Product Size Cat.# ISOQUANT® Isoaspartate Detection Kit 100 assays MA1010 Not For Medical Diagnostic Use. Description: The ISOQUANT® Isoaspartate Detection Kit is intended for quantitative detection of isoaspartic acid residues in proteins and peptides, which can result from the gradual, nonenzymatic deamidation of asparagine or rearrangement of aspartic acid residues during storage or handling. Because the kit does not depend on the monitoring of charge differences for detection, charge heterogeneity does not interfere with the assay. The ISOQUANT® Kit can be used on peptides or proteins such as monoclonal antibodies. Features: • Great Efficiency: Simple procedure with a test time of less than one hour. Automation possible with HPLC autosampler capability. • Economical: HPLC detection eliminates cost and inconvenience of radioactive materials handling. • Analytical: Quantitative results available. • Versatile: Perform individual samples or batches. Small sample size makes the assay suitable for research, analytical methods, formulations and process development work. • Robust: Not affected by common buffer components. • HPLC Detection Method: Fits with existing equipment and expertise. • Sensitive: Detects isoaspartate resulting from aspartic acid rearrangement as well as deamidation of asparagine. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 246 For complete and up-to-date product information visit: www.promega.com Antibody Purification High Capacity Magne® Streptavidin Beads and Goat Anti-Human Biotinylated IgG Product Size Cat.# High Capacity Magne® Streptavidin Beads 3 ml V7820 Goat Anti-Human Biotinylated IgG 4 ml V7830 For Research Use Only. Not for Use in Diagnostic Procedures. Description: High Capacity Magne® Streptavidin Beads are magnetic affinity beads with high specificity and high capacity for binding biotinylated antibodies and proteins. The magnetic beads are composed of iron encapsulated by macroporous cellulose, resulting in low nonspecific binding and making them ideal for use with complex biological samples. The beads also have excellent magnetic properties for rapid and efficient capture using a variety of magnetic stands. The affinity of biotin for streptavidin (Kd = 10–15) is one of the strongest and most stable interactions in biology; hence, the biotin-streptavidin interaction cannot be reversed under non-denaturing conditions. Therefore, we do not recommend the use of beads for applications in which the biotinylated molecules need to be recovered from the beads. High Capacity Magne® Streptavidin Beads are well suited for pharmacokinetics studies of therapeutic antibodies during preclinical studies. For example, biotinylated anti-human IgG bound to the High Capacity Magne® Streptavidin Beads can be used for enrichment of Human IgG from serum or plasma samples of non-primate animals and analyzed using mass spectrometry. The high capacity of the beads enables enrichment of antibodies over a wide concentration range using small amount of beads. Enrichment can be automated for high throughput and scaled up to handle various sample volumes. Goat Anti-Human Biotinylated IgG is provided at a concentration of 0.5mg/ml in phosphate-buffered saline (pH 7.4) with 0.1% sodium azide. Features: • Improve Your Results: High binding capacity and low non-specific binding. • Use in High-Throughput Formats with Robotics: Rapid magnetic response. • Characterize Large Dynamic Range: High binding capacity. Storage Conditions: Store at 4°C. Do not freeze the solution or let it dry during storage or use. Magne™ Protein G and Magne™ Protein A Beads Product Size Cat.# Magne™ Protein G Beads, 20% Slurry 1 ml G7471 5 ml G7472 50 ml G7473 Magne™ Protein A Beads, 20% Slurry 1 ml G8781 5 ml G8782 50 ml G8783 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Magne™ Protein G and Magne™ Protein A Beads are magnetic affinity beads with high specificity and high capacity for purification of immunoglobulins from cell culture media, ascites and serum samples. These paramagnetic beads are composed of iron encapsulated in macroporous cellulose with low nonspecific binding. The magnetic beads use a novel attachment chemistry to immobilize recombinant Protein G or Protein A protein molecules in the same orientation on the surface of the bead. The oriented attachment is known to improve the functionality of immobilized proteins. These beads offer a convenient method for achieving high purity and high recovery of monoclonal and polyclonal antibodies from a variety of biological samples. The superb magnetic properties of Magne™ Protein G and Magne™ Protein A Beads allow rapid and efficient capture of antibodies either with manually processed samples or in a high-throughput manner using the Promega ReliaPrep™ LV 32 HSM Instrument or a robotic platform such as the Beckman Coulter Biomek® FX. Features: • High Capacity: Binding capacities in excess of 25mg per milliliter of settled beads are observed depending on antibody species and isotype. • Ease of Handling: Minimize losses during purification and increase sample throughput due to exceptional magnetic properties. • High Purity: Ensure high-quality purification because of low nonspecific binding on beads. • Optimized Performance: Use validated antibody purification methods for small (20µl) to medium (50ml) sample volumes. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 4°C. Do not freeze. Do not allow beads to dry during storage or use. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 247 16 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Drug Discovery Drug Discovery Solutions 248 Drug Discovery Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 248 For complete and up-to-date product information visit: www.promega.com Today’s drug development needs are mature and complex. Instead of targets, biology and workflow are key elements. Drug developers in academia and industry alike need assays that are sensitive, robust, scalable and easy to use, that fit their workflows while maintaining physiological relevance. Promega has developed key platform technologies based on luminescence and fluorescence that can be applied across the discovery spectrum. Promega continues to offer solutions that enable you to develop better drugs, faster: •Better profiling data • More biologically relevant data • Multiplexing solutions for increased understanding of biology • Custom Assay Services (CAS@promega.com) Starting with a single, well-defined biological reaction, we have developed a solid technology platform from which hundreds of unique in vitro biochemical and cellbased assays have been configured. We offer multiple robust and functionally tested assays for many early drug discovery needs, including custom manufacturing and assay development capabilities. Custom Assay Services Biology-driven, Promega technology-enabled custom solutions for: • Cell Engineering • Assay Development & Qualification • Assay-Ready Cells In-Scale • Custom Assay Materials cas@promega.com03 NECROSIS VIABLE 7 REDUCED VIABILITY 7 APOPTOSIS 7 /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ /’+ 352 &$63$6( 352 &$63$6( 352 &$63$6( 352 &$63$6( &$63$6( &$63$6( $73 1$’+ $73 1$’+ $73 1$’+ &$63$6( ‘($’&(// 3527($6( /,9(&(// 3527($6( ,1$&7,9( $&7,9( /,9(&(// 3527($6( *6+ *6+ *6+ /’+ Drug Discovery Solutions Harnessing the Power of Bioluminescence for Biochemical and Cell-Based Assays Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 249 16Drug Discovery For complete and up-to-date product information visit: www.promega.com Solutions for Small Molecule Screening Visit www.promega.com/drugdiscovery to explore our portfolio of assays and custom assay development services, all built around innovative, sensitive bioluminescence technology. Targeted Protein Degradation Study small molecule-induced protein degradation in live cells. CRISPR-Enabled Endogenous Biology Tools to harness the power of CRISPR-based gene editing and live-cell bioluminescent detection to study endogenous protein dynamics Target Engagement Measure compound binding at select target proteins in real time. Cell Health Screening Assays Examine cell health in response to small molecule drugs with high-throughput cell viability and cytotoxicity assays. Energy Metabolism and Oxidative Stress Measure metabolic activity, including glucose uptake, oxidative stress and dinucleotide production. ADME-Tox Assays Study drug metabolism and toxicity using sensitive high-thoughput CYP450 assays. Learn how Promega can help your CRO develop better solutions for your clients. www.promega.com/drugdiscovery Table of Contents Section Contents Available in the Helix® on-site stocking system For complete and up-to-date product information visit: www.promega.com PRIMARY CUSTOM MANUFACTURER EXPERIENCE 40years + 5 Mfg Sites GLOBAL © 2019 Promega Corporation. All Rights Reserved. Don’t settle for just a supplier. Find a custom manufacturing partner. Your specifications. Your format. Our scientists waiting to help. Selecting a supplier for your biotechnology and biopharma products can be a challenge—especially one who can adapt to your specific needs. Don’t settle for just a supplier. Instead, partner with Promega and work with a custom manufacturer willing to provide you with the scientific expertise, ongoing technical support and quality standards that support your success. Learn more with our video: promega.com/CustomProcess 251 17 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Genetic Identity Preprocessing and Differential Extraction 252 DNA Isolation 255 Human-Specific DNA Quantitation 258 STR Amplification 259 Massively Parallel Sequencing 266 Genetic Identity Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 252 For complete and up-to-date product information visit: www.promega.com Preprocessing and Differential Extraction SwabSolution™ Kit, PunchSolution™ Kit and 5X AmpSolution™ Reagent Product Size Cat.# SwabSolution™ Kit 100 preps DC8271 PunchSolution™ Kit 100 preps DC9271 5X AmpSolution™ Reagent 100 preps DM1231 Not For Medical Diagnostic Use. Description: The SwabSolution™ Kit, PunchSolution™ Kit and 5X AmpSolution™ Reagent allow fast and simple processing of swabs and punches for PowerPlex® System analysis. These products are intended for preparation of single-source reference, database and paternity samples where sample purification is unnecessary. The SwabSolution™ Kit is used for rapid processing of swabs for STR analysis using PowerPlex® Systems. The SwabSolution™ Kit contains SwabSolution™ Reagent, which is used to generate a buccal swab extract that is added to the PowerPlex® System reaction. In addition, the SwabSolution™ Kit contains the 5X AmpSolution™ Reagent, which enables direct amplification of DNA from swabs using certain PowerPlex® Systems. See the supported PowerPlex® Systems at: www.promega.com/directamp/ The PunchSolution™ Kit is used for rapid processing of punches from nonFTA storage cards (S&S 903, Bode Buccal Collector™ device, etc.) for STR analysis using PowerPlex® Systems. The PunchSolution™ Kit contains PunchSolution™ Reagent, which is used to pretreat nonFTA punches prior to adding the PowerPlex® PCR amplification mix. In addition, the PunchSolution™ Kit contains the 5X AmpSolution™ Reagent, which enables direct amplification of DNA from punches using certain PowerPlex® Systems. See the supported PowerPlex® Systems at: www.promega.com/directamp/ The 5X AmpSolution™ Reagent enables direct amplification of DNA from unwashed FTA® punches, nonFTA punches and swabs using certain PowerPlex® Systems. Features: • Save Time: Rapid, simple preparation methods for swabs and punches can save 2–4 hours per plate of samples. • Experience Compatibility with Most PowerPlex® Systems: Using SwabSolution™ Kit, PunchSolution™ Kit and 5X AmpSolution™ Reagent increases the speed and versatility of the PowerPlex® Systems. Storage Conditions: Upon receipt of kit, thaw and mix as per instructions and store at 4°C. Casework Direct Kit, Custom Product Size Cat.# Casework Direct Kit, Custom 1 each AX4560 Not for Medical Diagnostic Use. Description: The sheer volume of property crime and sexual assault evidentiary samples submitted to forensic laboratories has compelled many laboratories to actively seek out better solutions for processing these challenging sample types. The Casework Direct Kit is designed to rapidly process swabs from casework samples or cuttings of sexual assault swabs and stained clothing. Unlike competing kits, lysates generated with the Casework Direct Kit are compatible with our quantification and STR amplification product lines. These lysates may be amplified with the PowerQuant® or Plexor® HY Systems to screen sexual assault samples for male DNA and to normalize human template for STR amplification with one of the PowerPlex® STR Systems. When used with the PowerQuant® System, valuable workflow information such as the presence/absence of male DNA, degradation or potential PCR inhibition is provided. Features: • No-wash protocol maximizes the chance of recovering DNA from trace samples • Quickly generates lysates that are compatible with PowerQuant®, Plexor® HY and PowerPlex® Systems • Useful for Y-screening and selection of evidentiary samples for STR testing Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 253 17Genetic Identity For complete and up-to-date product information visit: www.promega.com Differex™ System Product Size Cat.# Differex™ System 50 samples DC6801 200 samples DC6800 Manual Differex™ Magnet 1 each V1591 Available Separately Differex™ Digestion Buffer 150 ml A8501 Differex™ Separation Solution 40 ml A8511 ClickFit Microtube, 1.5ml 1,000 /pack V4741 A8501, DC6801, A8511, DC6800 Not For Medical Diagnostic Use. V1591, V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Differex™ System extracts DNA from sexual assault samples easily and quickly. The system provides a simple and fast method for separating male and female fractions of a sample, making it possible to analyze samples more quickly and efficiently. The Differex™ System offers recovery similar to that of the standard method commonly used for differential extraction. The Differex™ System is used in combination with the DNA IQ™ System and Slicprep™ 96 Device on robotic platforms to process up to 48 differential extractions in less than 5 hours, including incubation time, and less than 1 hour of hands-on time. Automated Differex™ System methods are available for the Biomek® 2000 and 3000 laboratory automation workstations as well as the Tecan Freedom EVO® liquid handler. Contact Promega Technical Services for additional information. A manual protocol for the Differex™ System is available for laboratories not yet using robotic platforms for DNA extraction. Features: • Automated Differential Extractions: The Differex™ System is the first and only system that allows a forensic laboratory to automate every step of differential extraction. • Direct Compatibility with the DNA IQ™ System and Downstream STR Applications: Clean DNA extracts mean you can be confident in your ability to obtain results regardless of your choice of STR systems. • Robust Results With Even Tough Samples: The Differex™ System works with challenging new and old samples typical of those from sexual assaults. • More Information About Automated Differex™ System: See the Automated Differex™ System page at: www.promega.com/products/ pm/genetic-identity/automated-differex/ Storage Conditions: Store at room temperature. Consumables for DNA Extraction in PCR, qPCR and CE Applications Product Size Cat.# Septa Mat, 96-Well 10 each CE2696 Optical Plate Seals 100 each V7840 Strip Cap, 8-Well 120 each V7850 Not For Medical Diagnostic Use. Description: Our plastic consumables provide excellent performance at a good value. These PCR plastics and consumables support DNA extraction, quantification, amplification and capillary electrophoresis of DNA. The PCR plastics and consumables are made for a variety of thermal cyclers, real-time PCR systems and CE instrumentation. Optical Plate Seals are used for sealing microplates to prevent evaporation and contamination in real-time PCR; they are compatible with real-time PCR systems such as the Applied Biosystems 7500 Real-Time System. Strip Caps are eight-strip domed caps for PCR plates and tubes to prevent evaporation and contamination in PCR. Septa Mats are used for sealing 96-well plates in capillary electrophoresis; they are compatible with Spectrum CE System and ABI Sequencers and Genetic Analyzers. Features: • PCR plastics and consumables made for a variety of thermal cyclers, realtime PCR systems and CE instrumentation. Storage Conditions: Store all consumables at 15–30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 254 For complete and up-to-date product information visit: www.promega.com Slicprep™ 96 Device Product Size Cat.# Slicprep™ 96 Device 10 pack V1391 Not For Medical Diagnostic Use. Description: The Slicprep™ 96 Device allows solid material to be incubated with a solution in a basket that is placed in a deep-well plate. Following incubation, the basket is raised with a collar for an additional 0.5ml of space below the basket. This allows removal of the incubation liquid and solubilized material from the solid support without having to transfer material to another tube or plate. One-millimeter holes in the bottom of the basket allow rapid flow of liquid in and out of the baskets. The device is manufactured with polypropylene to reduce adsorption of biological material onto the plastic and give it strength and stability over a wide temperature range. The components are manufactured and assembled in a HEPA-filtered clean room with gloved and gowned personnel to reduce the chance of DNA contamination. The package contains 10 units of the Slicprep™ 96 Device. Each unit consists of three components: the 96 Spin Basket, 96 Deep Well Plate and U-Shaped Collar, which is used to raise the baskets during centrifugation. Storage Conditions: Store at 22–25°C. Bone DNA Extraction Kit, Custom Product Size Cat.# Bone DNA Extraction Kit, Custom 100 preps AX6780 Not For Medical Diagnostic Use. Description: In certain cases involving missing persons, mass disasters and anthropological excavations, bone and teeth are often the only sample types available for identification. Further, these samples are often subjected to environmental damage, and co-extraction of environmental inhibitors during purification limits their usability in STR typing experiments. Purification of DNA free of inhibitors is a crucial first step in determining the success of obtaining a usable profile from these samples. A short preprocessing protocol followed by purification of DNA using DNA IQ™ chemistry yields inhibitor-free DNA that is compatible with PowerQuant® or Plexor® HY Systems for human and male DNA quantification and PowerPlex® STR Systems for generation of a STR profile. Features: • Quick preprocessing of bone powder using Demineralization Buffer, Custom • Compatible with manual and Maxwell® DNA IQ™ chemistry • Yields DNA free of inhibitors and compatible with downstream amplification reactions Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 255 17Genetic Identity For complete and up-to-date product information visit: www.promega.com DNA Isolation DNA IQ™ System Product Size Cat.# DNA IQ™ System 100 reactions DC6701 400 reactions DC6700 Casework Extraction Kit 100 reactions DC6745 Tissue and Hair Extraction Kit 100 reactions DC6740 Available Separately Lysis Buffer 150 ml A8261 2X Wash Buffer 70 ml A8271 Elution Buffer 50 ml A8281 DNA IQ™ Resin 50 ml A8251 DNA IQ™ Spin Baskets 1,000 /bag V1221 Proteinase K 100 mg V3021 DTT, Molecular Grade (Dry Powder) 5 g V3151 ClickFit Microtube, 1.5ml 1,000 /pack V4741 A8261, A8271, A8281, DC6745, A8251, V1221 Not For Medical Diagnostic Use. DC6701, DC6700, DC6740, V3021, V3151, V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The DNA IQ™ System is a DNA isolation system designed specifically for forensic and paternity laboratories. This system employs novel paramagnetic particles to isolate clean DNA for use with short tandem repeat (STR) analysis. The DNA IQ™ System can be used to extract DNA from a variety of sample types, including stains and liquid samples. Protocols for database samples and casework samples are available. The unique DNA IQ™ Resin removes PCR inhibitors and contaminants frequently encountered in casework samples. When working with larger sample volumes, such as those found in paternity and databasing, the DNA IQ™ System can deliver a consistent amount of total DNA. Samples including buccal swabs, liquid blood and stains on FTA® and other blood cards have been used with the DNA IQ™ System. The DNA IQ™ System has been tested with the PowerQuant™ and Plexor® HY Systems and PowerPlex® Systems to ensure a streamlined process. This translates into reliable products that give optimal results from isolation to quantification and STR analysis. Genomic DNA isolation using the DNA IQ™ System has been automated on the Biomek® 2000 and 3000 laboratory automation workstations as well as the Tecan Freedom EVO® liquid handler. Contact Promega Technical Services for additional information. Features: • Rapid: Only a few quick steps to obtain clean DNA with fewer PCR inhibitors. • Flexible: One simple system for use with casework, paternity and database samples. • Efficient: Sensitive to minute sample sizes. In addition, no harmful organic solvents such as phenol and chloroform are used, so use of a hood is not required and disposal of hazardous chemicals is eliminated. Storage Conditions: Store the DNA IQ™ System at 22–25°C. Store the Casework Extraction Kit at 15–30°C. DNA IQ™ Reference Sample Kit for Maxwell® 16 Product Size Cat.# DNA IQ™ Reference Sample Kit for Maxwell® 16 48 preps AS1040 Available Separately ClickFit Microtube, 1.5ml 1,000 /pack V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The DNA IQ™ Reference Sample Kit for Maxwell® 16 is designed specifically for optimal DNA extraction from buccal swabs, FTA® blood card punches, liquid blood or other high-concentration DNA reference samples. These samples are typically encountered in forensic, convicted-offender database and paternity testing. The kit contains the same trusted reagents used in the DNA IQ™ System in a convenient prepackaged format and is optimized to yield a final DNA concentration that minimizes the need for concentration or dilution prior to amplification. Liquefied samples are placed directly into the cartridges, and genomic DNA ready for amplification is obtained in approximately 20 minutes. Features: • Maximize Your Time: Automating DNA extraction reduces hands-on bench time spent manually extracting DNA. • Gain Confidence in Your Results: Instrument design, optimized reagents and automated methods provide consistent yield and purity. • Use Trusted DNA IQ™ Chemistry: The DNA IQ™ System is the recognized leader in automated DNA extraction chemistries and is included in the prefilled Maxwell® 16 reagent cartridges. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 256 For complete and up-to-date product information visit: www.promega.com DNA IQ™ Casework Pro Kit for Maxwell® 16 Product Size Cat.# DNA IQ™ Casework Pro Kit for Maxwell® 16 48 preps AS1240 Available Separately Casework Extraction Kit 100 reactions DC6745 LEV Plungers 50 /pk AS6151 LEV Elution Tubes 50 /pk AS6201 ClickFit Microtube, 1.5ml 1,000 /pack V4741 AS1240, DC6745 Not For Medical Diagnostic Use. AS6151, AS6201, V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The DNA IQ™ Casework Pro Kit for Maxwell® 16 includes newly designed plungers and optimized preprocessing, which results in improved DNA yields. The DNA IQ™ Casework Pro Kit for Maxwell® 16 is designed for optimal DNA extraction from forensic casework samples. These samples may include blood stains, semen stains, hairs, cigarette butts, tissue samples, and trace or “touch” DNA samples regularly encountered in forensic DNA analysis. The kit contains the same trusted reagents used in the DNA IQ™ System in a convenient, prefilled cartridge format and is optimized to provide a final DNA extract in a concentrated format. The DNA IQ™ Casework Pro Kit for Maxwell® 16 uses a plastic cartridge and plunger that allow DNA elution in a final volume of no more than 50μl. DNA IQ™ Lysis Buffer, Resin and Wash Buffer are included in the prefilled cartridge, and DNA IQ™ Elution Buffer is included in the kit to ensure proper storage of the DNA. The DNA IQ™ Casework Pro Kit is compatible with the Maxwell® 16 Forensic Instrument, which includes the hardware necessary to use this kit. The Casework Extraction Kit improves DNA extraction efficiency from a broad panel of sample types and is used for preprocessing samples before DNA extraction with the DNA IQ™ Casework Pro Kit for Maxwell® 16. Features: • Reduced Elution Volumes: Elute your sample in less than 50μl of DNA IQ™ Elution Buffer. No need for post-purification concentration steps. • Confidence in Your Chemistry: The DNA IQ™ System is the recognized leader in automated DNA extraction chemistries and is included in the prefilled Maxwell® 16 reagent cartridges. • Preprogrammed Methods: There is no need for programming or an external computer. The Maxwell® 16 Instrument is preloaded with all of the necessary methods, which are optimized for maximum performance. Storage Conditions: Store at 15–30°C. Forensic Grade Consumables Product Size Cat.# Elution Tubes, 0.5ml 50/pack AS7201 FSC Plungers 50/pack AS7151 LEV Plungers 50/pack AS1651 Nuclease-Free Water 150ml P1196 DNA IQ™ Spin Baskets 50/pack V1225 ClickFit Microtube, 1.5ml 100/pack V4745 AS7201, AS7151, AS1651, V1225, V4745 Not For Medical Diagnostic Use. P1196 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Promega forensic products are manufactured in alignment with the ISO 18385 standard. This standard ensures minimal risk of human DNA contamination for products used to collect, store and analyze biological materials for forensic purposes. Use with both Maxwell® FSC DNA IQ™ Casework Kit and DNA IQ™ Casework Pro Kit for Maxwell® 16. Learn more at: www.promega.com/products/genetic-identity/forensic-grade-faq/ Storage Conditions: Store all Forensic Grade Consumables at 15–30°C. Nuclease-Free Water can be stored at any temperature below 30°C. Casework Consumables Product Size Cat.# CW Spin Baskets 50/pack AS8101 CW Microfuge Tubes, 1.5ml 50/pack AS8201 Not For Medical Diagnostic Use. Description: The CW Spin Baskets and CW Microfuge Tubes, 1.5ml, are ethylene-oxide-treated and enable preprocessing of solid samples without the need to transfer swabs, simplifying the process and reducing the chance of cross-contamination. Use with both Maxwell® FSC DNA IQ™ Casework Kit and DNA IQ™ Casework Pro Kit for Maxwell® 16. Storage Conditions: Store all consumables at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 257 17Genetic Identity For complete and up-to-date product information visit: www.promega.com Genetic Identity Automation Hardware and Software Product Size Cat.# Shaker Integration Plate 1 each V3691 Deep Well Heat Transfer Block 1 each V6741 VARIOMAG® Teleshake (110V, for North America use only) 1 each V6751 V&P Scientific Heating Block (North America use only) 1 each V6761 1.2ml, Round-Bottom Deep Well Plate 50 /case V6771 2.2ml, Square-Well Deep Well Plate 50 /case V6781 Pyramid-Bottom Reservoir, 12 Column 25 /case V6791 Pyramid-Bottom Reservoir 25 /case V6801 1.1ml, Square-Well, V-Bottom Deep Well Plate 25 /case V6821 10ml, 24-Well Deep Well Plate 25 /case V6831 Four-Position Tube Holder 1 each V1601 STR Normalization Manager™ 3 CD-ROM DG1820 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Genetic Identity Automation Hardware and Software can be used on automated platforms in conjunction with Promega Genetic Identity products. Contact Technical Services for specific application and platform information. Maxwell® FSC Instrument Product Size Cat.# Maxwell® FSC Instrument 1 each AS4600 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® FSC Instrument, along with DNA IQ™ chemistry, offers easy-to-use, consistent, automated nucleic acid extraction from casework samples such as blood stains, semen stains, hairs, cigarette butts, tissues and trace DNA samples. Automated DNA extraction saves laboratories time and labor costs and frees staff to work on casework analysis. Features: • High-quality DNA extraction with minimal hands-on time. • Bar code reader for simplified data entry. • Intuitive software and touch screen interface. Storage Conditions: Store at 15–30°C. Maxwell® FSC DNA IQ™ Casework Kit Product Size Cat.# Maxwell® FSC DNA IQ™ Casework Kit 48 preps AS1550 Not For Medical Diagnostic Use. Description: The Maxwell® FSC DNA IQ™ Casework Kit is designed for optimal DNA extraction from forensic casework samples. These samples may include blood stains, semen stains, hairs, cigarette butts, tissue samples and trace or “touch” DNA samples regularly encountered in forensic DNA analysis. The kit contains the same trusted reagents as the DNA IQ™ System in a convenient, prefilled cartridge format and is optimized to provide a final DNA extract in a pure, concentrated format. The Maxwell® FSC DNA IQ™ Casework Kit uses a plastic cartridge and newly designed plunger that allow DNA elution in a final volume of no more than 50μl. DNA IQ™ Lysis Buffer, Resin and Wash Buffer are included in the prefilled cartridge, and DNA IQ™ Elution Buffer is included in the kit to ensure proper storage of the DNA. The Maxwell® FSC DNA IQ™ Casework Kit is compatible with the Maxwell® FSC Instrument (Chapter 13), which includes a surface tablet and easy, intuitive interface. Features: • Use for blood stains, semen stains, hairs, cigarette butts, tissue samples and trace or “touch” DNA samples. • Easy-to-use spin baskets circumvent the need to transfer swabs helping minimize cross-contamination. • Uses the same reagents as the DNA IQ™ Systems in an automated format. Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 258 For complete and up-to-date product information visit: www.promega.com Human-Specific DNA Quantitation PowerQuant™ System Product Size Cat.# PowerQuant™ System 200 reactions PQ5002 800 reactions PQ5008 PowerQuant™ Calibration Kit 1 each DS1221 Available Separately PowerQuant™ Male gDNA Standard 150 μl DD3021 Not For Medical Diagnostic Use. Description: The PowerQuant™ System is a 5-color, 4-target probe-based qPCR assay that simultaneously quantifies the total amount of amplifiable autosomal and Y-chromosomal DNA in a single assay using the same DNA standards. During amplification, annealing of the probe to its target sequence generates a substrate that is cleaved by the 5′ nuclease activity of Taq DNA polymerase when the enzyme extends from an upstream primer into the region of the probe. This liberates the fluorescent dye from its proximal position to the quencher and, therefore, an increase in amplification cycles leads to increase in fluorescence. The kit contains an internal PCR control (IPC) to test for false-negative results that may occur in the presence of PCR inhibitors. Advantages of this system include: • More consistent Auto/Y ratio. • Assessment of DNA degradation. • Reliable sample quality assessment. • Flexible options for 4-point to 7-point standard curve. The PowerQuant™ System is optimized for use on the Applied Biosystems 7500 real-time PCR systems with v2.0.6 or HID1.1 or higher software versions. Features: • Use Robust, Instrument-Native Software for Most Analyses: Probebased chemistry. • Reliably Quantify Sample: More consistent Auto/Y ratio. • Assess Sample Quality: Degradation marker included. • Achieve Sensitivity: Consistent and reproducible detection of 2pg of DNA. • Analyze Normalization for STR Analysis: Data analysis tool. • Process More Samples Per Plate: 4-point standard curve. Storage Conditions: Store at –30°C to –10°C. Plexor® HY System Product Size Cat.# Plexor® HY System 200 reactions DC1001 800 reactions DC1000 Available Separately Plexor® Calibration Kit, Set A 1 each DC1500 Water, Amplification Grade 6,250 μl DW0991 Not For Medical Diagnostic Use. Description: The Plexor® HY System is a real-time PCR assay to determine the concentration of total human DNA and male human DNA simultaneously in one reaction. The kit contains an internal PCR control (IPC) to test for falsenegative results that may occur in the presence of PCR inhibitors and a melt curve function to confirm that the correct product was amplified. The Plexor® HY System is a sensitive multiplex kit that routinely detects approximately 6.4pg of total DNA. PCR setup is performed at room temperature and is compatible with automated platforms. The Plexor® Systems work by measuring a reduction in fluorescent signal during amplification. Amplification of each target uses only two primers, one of which contains both a fluorescent tag and a modified base. As amplification proceeds, fluorescence is reduced by site-specific incorporation of a fluorescent quencher opposite the complementary modified base. The quencher is in close proximity to a fluorescent dye located on the end of the primer, resulting in a reduction of fluorescent signal. After PCR, a melt analysis can be performed to provide an internal control for the final assay design or to expedite troubleshooting. The Plexor® HY System is optimized for use on the Applied Biosystems 7500 and 7500 FAST real-time PCR systems and Stratagene Mx3005P® and Mx3000P® qPCR systems. For information about use with other qPCR instrumentation, contact Promega Technical Services. The Plexor® Analysis Software is available for free download. The unique functions of this software allow you to quickly and easily review data and create reports. Replicate samples are automatically averaged, template amounts are calculated and the necessary volume of DNA is displayed for your optimized STR amplification conditions. Features: • Simultaneous Quantification of Autosomal and Y-Chromosome DNA: Less variability, less time, more valuable data. • Consistent and Reproducible Detection of 6.4pg of DNA: If you can’t detect it with Plexor® HY, you can’t detect it with your STR system. • Internal Positive Control and Melt-Curve Analysis: Guard against false-negative and false-positive results, allowing you to be confident in your data. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 259 17Genetic Identity For complete and up-to-date product information visit: www.promega.com STR Amplification PowerPlex® ESX and ESI Fast Systems Product Size Cat.# PowerPlex® ESX 16 Fast System 100 reactions DC1611 400 reactions DC1610 PowerPlex® ESI 16 Fast System 100 reactions DC1621 400 reactions DC1620 PowerPlex® ESX/ESI 16 Fast Systems Bundle 100 reactions DC1631 400 reactions DC1630 PowerPlex® ESX 17 Fast System 100 reactions DC1711 400 reactions DC1710 PowerPlex® ESI 17 Fast System 100 reactions DC1721 400 reactions DC1720 PowerPlex® ESX/ESI 17 Fast Systems Bundle 100 reactions each DC1731 400 reactions each DC1730 Available Separately Size Conc. Cat.# Water, Amplification Grade 6,250 μl DW0991 2800M Control DNA 500 μl 0.25 ng/µl DD7251 25 μl 10 ng/µl DD7101 Not For Medical Diagnostic Use. Description: The PowerPlex® ESX and ESI Fast Systems meet the ENFSI recommendations for DNA profile sharing across Europe and allow co-amplification and detection of D3S1358, D8S1179, D18S51, D21S11, FGA, TH01, vWA, D2S441, D10S1248, D22S1045, D1S1656, D12S391, D2S1338, D16S539, D19S433, SE33 and Amelogenin. Rapid cycling technology enables amplification to be done in less than 50 minutes. These kits are available in multiple formats, including the option to detect SE33, to accommodate various requirements or preferences. Additionally, the kits have superior tolerance to common inhibitors and superior sensitivity to obtain full profiles from low-level DNA and are robust enough to genotype degraded DNA samples through the use of miniSTR loci. This system is compatible with ABI PRISM® 310, 3100 and 3100-Avant Genetic Analyzers and Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Features: • <50-Minute Amplification Time: Shorter turnaround time to results. • Multiple Kit Configurations: Confirm results from poor-quality samples. • ENFSI-Recommended Loci: Data are more easily shared across borders. • Mini-STRs: Obtain more complete profiles from degraded DNA. • Robust Buffer: Achieve better results with challenging casework samples. • One Kit for Databasing and Casework Samples: Simplified QC and inventory management. Storage Conditions: Store at –20°C. PowerPlex® Fusion 6C System Product Size Cat.# PowerPlex® Fusion 6C System 50 (or 100 direct-amp) reactions DC2705 200 (or 400 direct-amp) reactions DC2720 800 (or 1,600 direct-amp) reactions DC2780 Available Separately Size Conc. Cat.# PowerPlex® 6C Matrix Standard 5 preps DG4900 WEN Internal Lane Standard 500 200 μl DG5001 2800M Control DNA 25 μl 10 ng/µl DD7101 Not For Medical Diagnostic Use. Description: The PowerPlex® Fusion 6C System is a 27-locus multiplex for human identification applications including forensic analysis, relationship testing and research use. This six-color system allows co-amplification and fluorescent detection of the 18 autosomal loci in the expanded CODIS core loci (CSF1PO, FGA, TH01, vWA, D1S1656, D2S441, D2S1338, D3S1358, D5S818, D7S820, D8S1179, D10S1248, D12S391, D13S317, D16S539, D18S51, D19S433 and D21S11) and Amelogenin and DYS391 for gender determination. The Penta D, Penta E, TPOX, D22S1045 and SE33 loci also are included to increase discrimination and allow searching of databases that include profiles with these loci. Finally, two rapidly mutating Y-STR loci, DYS570 and DYS576, are included in the multiplex. The PowerPlex® Fusion 6C System works well with extracted DNA samples, including low amounts of template DNA, mixtures and inhibitor-laden samples. The PowerPlex® Fusion 6C System is also compatible with direct amplification, enabling streamlined STR databasing efforts. Amplification can be successfully performed with sample types such as FTA® card punches as well as pretreated swabs, Bode Buccal DNA Collector™ punches or S&S 903 punches. Fast cycling conditions used with the PowerPlex® Fusion 6C System reduce sample-processing time for all samples. The PowerPlex® Fusion 6C System is compatible with the Applied Biosystems® 3500 and 3500xL Genetic Analyzers as well as Applied Biosystems® 3130 and 3130xl Genetic Analyzers with Data Collection Software Version 4.0 with the DC v4 6-Dye Module v1 License (Life Technologies). Features: • Experience Highest Inter-Database Compatibility and Discrimination: 27 loci (23 autosomal STRs, 3 Y-STRs and Amelogenin); amplify all loci in the expanded CODIS core loci. • Streamline Your Workflows: Use direct-amplification protocols and rapid cycling. • Reduce Repeat Analysis of Difficult Samples: Experience high inhibitor tolerance and sensitivity for casework. • Simplify Your Validation and QC: Use one kit for both casework and database sections. Storage Conditions: Store all components at –30°C to –10°C. After the first use, store the PowerPlex® Fusion 6C System components at 2–10°C, where components are stable for 6 months. Do not refreeze. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 260 For complete and up-to-date product information visit: www.promega.com PowerPlex® Fusion System Product Size Cat.# PowerPlex® Fusion System 200 reactions DC2402 800 reactions DC2408 Available Separately Size Conc. Cat.# 2800M Control DNA 25 μl 10 ng/µl DD7101 Water, Amplification Grade 6,250 μl DW0991 Not For Medical Diagnostic Use. Description: The PowerPlex® Fusion System is a 24-locus multiplex for human identification applications including forensic analysis, relationship testing and research use. This five-color system allows co-amplification and fluorescent detection of the 13 core CODIS (US) loci (CSF1PO, FGA, TH01, TPOX, vWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 and D21S11), the 12 core European Standard Set loci (TH01, vWA, FGA, D21S11, D3S1358, D8S1179, D18S51, D10S1248, D22S1045, D2S441, D1S1656 and D12S391) and Amelogenin for gender determination. In addition, the male-specific DYS391 locus is included to identify null Y allele results for Amelogenin. The Penta D, Penta E, D2S1338 and D19S433 loci are included to increase discrimination and allow searching of databases that include profiles with these popular loci. This extended panel of STR markers is intended to satisfy both CODIS and ESS recommendations. The PowerPlex® Fusion System works well with extracted DNA samples, including low amounts of template DNA, mixtures and inhibitor-laden samples. The PowerPlex® Fusion System also is compatible with direct amplification, enabling streamlined STR databasing efforts. Amplification can be successfully performed with sample types such as FTA® card punches as well as pretreated swabs, Bode Buccal DNA Collector™ punches or S&S 903 punches. Fast cycling conditions used with the PowerPlex® Fusion System reduce sample-processing time for all samples. The PowerPlex® Fusion System is compatible with the ABI PRISM® 3100 and 3100-Avant Genetic Analyzers and Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Panels and bins text files are required for automatic assignment of genotypes using the GeneMapper® ID and ID-X software and are available for download at: www.promega.com/resources/tools/genemapper-id-software-panelsand-bin-sets/ The PowerPlex® Fusion System was given NDIS approval in March 2013 for NDIS CODIS databasing. Features: • Highest Interdatabase Compatibility and Discrimination: 24 loci (23 STRs plus Amelogenin), including the CODIS and ESS required loci. Amplifies all loci found in Identifiler®, SGM Plus® and PowerPlex® 16, some of the most commonly used multiplexes over the last decade. • Streamlined Workflows: Direct-amplification protocols and rapid cycling. • Less Repeat Analysis of Difficult Samples: High inhibitor tolerance and sensitivity for casework. • Easier Validation and QC: One kit for both casework and database sections. Storage Conditions: Store kit at –20°C. Upon receipt, move 2800M Control DNA to 4°C storage. PowerPlex® Y23 System Product Size Cat.# PowerPlex® Y23 System 50 reactions DC2305 200 reactions DC2320 Available Separately Size Conc. Cat.# 2800M Control DNA 25 μl 10 ng/µl DD7101 500 μl 0.25 ng/µl DD7251 Water, Amplification Grade 6,250 μl DW0991 Not For Medical Diagnostic Use. Description: The PowerPlex® Y23 System is a 23-loci, 5-color Y-STR multiplex designed for genotyping forensic casework samples, database samples and paternity samples. The PowerPlex® Y23 System works well with extracted DNA samples, including low amounts of template and male/female DNA mixtures. The PowerPlex® Y23 System also is compatible with direct amplification, enabling streamlined Y-STR databasing efforts. Amplification can be successfully performed with sample types such as FTA® card punches as well as pretreated swabs, Bode Buccal DNA Collector™ punches or S&S 903 punches. Faster cycling conditions cut amplification time almost in half. Moreover, reduced sample-processing time and faster cycling conditions provide a significant time savings in every run. The PowerPlex® Y23 System is tolerant of many known amplification inhibitors. The robust performance of the kit results in more interpretable data from inhibitor-laden samples. The PowerPlex® Y23 System was given NDIS approval in January 2013. Features: • More Meaningful STR Analysis: Higher power of discrimination from 23 loci results in fewer false-positive matches. • More Usable Profile from Samples with Excess Female DNA: High sensitivity in the presence of female DNA (<0.1ng male DNA, 1:6,000 ratio). • Streamlined Databasing Workflows: Direct-amplification compatible. • Significant Reduction in Amplification Time: Faster cycling conditions cut amplification time roughly in half. • Full Profiles from Challenging Casework Samples: High tolerance for inhibitors including tannic acid, hematin and humic acid. • Simplified Workflows and Inventory: One kit for both casework and databasing. Storage Conditions: Upon receipt of kit, remove 2800M Control DNA and store at 4°C. Store all other kit components at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 261 17Genetic Identity For complete and up-to-date product information visit: www.promega.com PowerPlex® 21 System Product Size Cat.# PowerPlex® 21 System 200 reactions DC8902 4 × 200 reactions DC8942 Available Separately Size Conc. Cat.# Water, Amplification Grade 6,250 μl DW0991 2800M Control DNA 25 μl 10 ng/µl DD7101 500 μl 0.25 ng/µl DD7251 Not For Medical Diagnostic Use. Description: The PowerPlex® 21 System is a multiplex STR system for human identification applications including forensic analysis, relationship testing and research use. The system allows co-amplification and fluorescent detection of 21 loci (20 STR loci and Amelogenin), including D1S1656, D2S1338, D3S1358, D5S818, D6S1043, D7S820, D8S1179, D12S391, D13S317, D16S539, D18S51, D19S433, D21S11, Amelogenin, CSF1PO, FGA, Penta D, Penta E, TH01, TPOX and vWA. The PowerPlex® 21 System is compatible with the ABI PRISM® 3100 and 3100-Avant Genetic Analyzers and Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Panels and bins text files are required for automatic assignment of genotypes using the GeneMapper® ID and ID-X software and are available for download at: www.promega.com/resources/tools/genemapper-id-software-panelsand-bin-sets/ Features: • Enjoy Maximum Discrimination: 21 markers for difficult cases and complete data overlap with most existing multiplexes. • Save Labor and Time: No need to wash FTA® card punches. Simpler protocols are available for swabs and nonFTA card punches as well. • Experience Higher Success Rates: High inhibitor tolerance benefits challenging casework samples and results in less locus drop-out and reaction failure. • Shorten PCR Time: 90-minute PCR increases laboratory productivity and decreases average turnaround time for your cases. Storage Conditions: Store kit at –20°C. Upon receipt, remove 2800M Control DNA and store at 4°C. PowerPlex® 18D System Product Size Cat.# PowerPlex® 18D System 200 reactions DC1802 800 reactions DC1808 Available Separately Size Conc. Cat.# Water, Amplification Grade 6,250 μl DW0991 2800M Control DNA 25 μl 10 ng/µl DD7101 Not For Medical Diagnostic Use. Description: The PowerPlex® 18D System is a multiplex STR system for use in database and paternity testing. This system is optimized for direct amplification of samples on FTA® cards. This five-color multiplex allows co-amplification of the 13 CODIS loci (D18S51, D21S11, TH01, D3S1358, FGA, TPOX, D8S1179, vWA, CSF1PO, D16S539, D7S820, D13S317, D5S818) plus Amelogenin, Penta E, Penta D, D2S1338 and D19S433. All eighteen loci are amplified simultaneously in a single tube and analyzed in a single injection. The PowerPlex® 18D System is compatible with ABI PRISM® 3100 and 3100-Avant Genetic Analyzers and Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. The PowerPlex® 18D System was given NDIS approval in July 2011 for NDIS CODIS databasing. Features: • Eliminate DNA Extraction: Simplify and shorten sample processing with direct amplification from FTA® cards. • Reduce PCR Time: Amplify in less than 1.5 hours using rapid cycling technology. • Upload More Markers: Type D2S1338, D19S433, Penta D, Penta E, Amelogenin and the 13 CODIS loci with one kit. • Automatically Assign Genotypes: Panels and bins text files are required for automatic assignment of genotypes using the GeneMapper® ID and ID-X software and are available for download at: www.promega.com/ resources/tools/genemapper-id-software-panels-and-bin-sets/ Storage Conditions: Store kit at –20°C. Upon receipt, remove 2800M Control DNA and store at 4°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 262 For complete and up-to-date product information visit: www.promega.com PowerPlex® 16 HS System Product Size Cat.# PowerPlex® 16 HS System 100 reactions DC2101 400 reactions DC2100 Available Separately Size Conc. Cat.# Internal Lane Standard 600 150 μl DG1071 Water, Amplification Grade 6,250 μl DW0991 2800M Control DNA 25 μl 10 ng/µl DD7101 500 μl 0.25 ng/µl DD7251 DC2101, DC2100, DW0991, DD7101, DD7251 Not For Medical Diagnostic Use. DG1071 For Laboratory Use. Description: The PowerPlex® 16 HS System is a multiplex STR system for use in DNA typing. This system co-amplifies the loci D18S51, D21S11, TH01, D3S1358, Penta E (labeled with fluorescein); FGA, TPOX, D8S1179, vWA and Amelogenin (labeled with TMR); CSF1PO, D16S539, D7S820, D13S317, D5S818 and Penta D (labeled with JOE). This multiplex includes all 13 CODIS STR markers, Amelogenin for gender determination and two low-stutter, highly discriminating pentanucleotide STR markers. All sixteen loci are amplified simultaneously in a single tube and analyzed in a single injection. The PowerPlex® 16 HS System is compatible with ABI PRISM® 310, 3100 and 3100-Avant Genetic Analyzers and Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Features: • Generate Profiles with Samples that Previously Failed to Amplify: The PowerPlex® 16 HS System is more tolerant of PCR inhibitors than competing STR systems and the previous version of the PowerPlex® 16 System. Avoid costly and time-consuming sample cleanup. • Gain Confidence in Analysis of Limited Samples: Each lot is quality tested to produce full profiles from 100pg of DNA. • Achieve High Discrimination: The loci included in PowerPlex® 16 HS System are more discriminating than competitive systems and are ideal for resolving partial matches or challenging familial cases. • Expect Concordance with Existing Databases: Primer sequences, dyes and ladders are all unchanged from the PowerPlex® 16 System. • Use a Complete System: The PowerPlex® 16 HS System includes size standard, amplification-grade water and Taq DNA polymerase already in the master mix. Simple to order, easy to use. • Automatically Assign Genotypes: Panels and bins text files are required for automatic assignment of genotypes using the GeneMapper® ID and ID-X software and are available for download at: www.promega.com/ resources/tools/genemapper-id-software-panels-and-bin-sets/ Storage Conditions: Store at –20°C. PowerPlex® CS7 System Product Size Cat.# PowerPlex® CS7 System 100 reactions DC6613 Available Separately Size Conc. Cat.# Internal Lane Standard 600 150 μl DG1071 Water, Amplification Grade 6,250 μl DW0991 2800M Control DNA 25 μl 10 ng/µl DD7101 500 μl 0.25 ng/µl DD7251 DC6613, DW0991, DD7101, DD7251 Not For Medical Diagnostic Use. DG1071 For Laboratory Use. Description: The PowerPlex® CS7 System is a multiplex STR assay for relationship testing and human identification. The PowerPlex® CS7 System allows co-amplification and three-color detection of seven STR loci, including LPL, F13B, FESFPS, F13A01, Penta D, Penta C and Penta E. All seven loci are amplified simultaneously in a single tube and analyzed in a single injection. The PowerPlex® CS7 System contains two loci, Penta D and Penta E, that overlap with the loci included in the PowerPlex® 16, 16 HS, 18D, 21 and Fusion Systems. This feature allows the PowerPlex® CS7 System to be used as a confirmatory kit in paternity applications using the five unshared STR loci to supplement the genotype and increase the available information. The PowerPlex® CS7 System is compatible with the ABI PRISM® 3100 and 3100-Avant Genetic Analyzers and Applied Biosystems® 3130 and 3130xl Genetic Analyzers. The PowerPlex® CS7 System provides all materials necessary to amplify STR regions of purified genomic DNA. Features: • More Loci: Supplement current testing with LPL, F13B, FESFPS, F13A01 and Penta C for greater discrimination. • Confirmatory Loci: Overlap of Penta D and Penta E in the PowerPlex® CS7 System and several PowerPlex® Systems allow detection of sample mixup when used together. • Complete: Hot-start Taq DNA polymerase is provided in the master mix, and size standard is included. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 263 17Genetic Identity For complete and up-to-date product information visit: www.promega.com SwabSolution™ Kit, PunchSolution™ Kit and 5X AmpSolution™ Reagent Product Size Cat.# SwabSolution™ Kit 100 preps DC8271 PunchSolution™ Kit 100 preps DC9271 5X AmpSolution™ Reagent 100 preps DM1231 Not For Medical Diagnostic Use. For additional information see page 252. PowerPlex® 5C Matrix Standards Product Size Cat.# PowerPlex® 5C Matrix Standards, 310 50 µl DG5640 PowerPlex® 5C Matrix Standard 5 preps DG4850 Not For Medical Diagnostic Use. Description: The PowerPlex® 5C Matrix Standards allow the PowerPlex® ESX, ESI, 18D, 21, Y23 and Fusion Systems to be analyzed on the ABI PRISM® 310 Genetic Analyzer (Cat.# DG5640) and ABI PRISM® 3100 and 3100-Avant or Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers (Cat.# DG4850). Proper generation of a spectral calibration file is critical to evaluate multicolor systems. The PowerPlex® 5C Matrix Standards (Cat.# DG5640 and DG4850) contain matrix fragments labeled with five fluorescent dyes: Fluorescein, JOE, TMR-ET, CXR-ET and WEN. Once generated, the spectral calibration file is applied during collection of PowerPlex® data to calculate and compensate for spectral overlap between different fluorescent dye colors. Storage Conditions: Store PowerPlex® 5C Matrix Standards, 310 (Cat.# DG5640), and PowerPlex® 5C Matrix Standard (Cat.# DG4850) at 4°C after first use. The matrix standards are light-sensitive; therefore, minimize light exposure. PowerPlex® 4-Dye Matrix Standards Product Size Cat.# PowerPlex® Matrix Standards, 310 50 μl DG4640 PowerPlex® 4C Matrix Standard 5 preps DG4800 Not For Medical Diagnostic Use. Description: The PowerPlex® 4-Dye Matrix Standards allow the PowerPlex® 16, PowerPlex® 16 HS, PowerPlex® ES, PowerPlex® Y, PowerPlex® CS7, and PowerPlex® 16 and ES Monoplex Systems to be analyzed on the ABI PRISM® 310 Genetic Analyzer or ABI PRISM® 377 DNA Sequencer (Cat.# DG4640) and the ABI PRISM® 3100 and 3100-Avant or Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers (Cat.# DG4800). The PowerPlex® 4C Matrix Standard allows the PowerPlex® 16, PowerPlex® 16 HS, PowerPlex® S5, PowerPlex® CS7, PowerPlex® 16 and ES Monoplex Systems, MSI Analysis System and GenePrint ® 10 System to be analyzed on the ABI PRISM® 3100 and 3100-Avant or Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Proper generation of a spectral calibration file is critical to evaluate multicolor systems. The PowerPlex® 4-Dye Matrix Standards contain matrix fragments labeled with four fluorescent dyes: Fluorescein, JOE, TMR and CXR. Once generated, the spectral calibration file is applied during collection of PowerPlex® data to calculate and compensate for spectral overlap between different fluorescent dye colors. The PowerPlex® 4C Matrix Standard (Cat.# DG4800) replaces PowerPlex® Matrix Standards, 3100/3130 (Cat.# DG4650), and contains a single tube of mixed fluorescent dye-labeled matrix fragments. Storage Conditions: Store the Matrix Standards, 310 (Cat.# DG4640), at –20°C. Store PowerPlex® 4C Matrix Standard (Cat.# DG4800) at 4°C after first use. The matrix standards are light-sensitive; therefore, minimize light exposure. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 264 For complete and up-to-date product information visit: www.promega.com WEN Internal Lane Standard 500 ESS Product Size Cat.# WEN Internal Lane Standard 500 ESS 200 µl DG5101 Not For Medical Diagnostic Use. Description: The WEN Internal Lane Standard 500 ESS is designed for use with the PowerPlex® ESI 16 and 17 Fast, ESX 16 and 17 Fast and ESI 17 Pro Systems. The designation “ESS”, or European Standard Set, indicates this ILS is for use with these PowerPlex® Systems. The standard contains 21 fragments ranging in size from 60bp to 500bp. Fragments of 60–200bp are spaced at 20bp intervals, except for the 65bp fragment. Fragments of 200–500bp are spaced every 25bp. Fragments that are muliples of 100bp have a higher intensity than the other fragments to simplify size assignment. The DNA fragments are double-stranded and asymmetrically labeled with a proprietary WEN dye. The WEN Internal Lane Standard 500 ESS is intended to be used in assigning sizes to DNA fragments separated by capillary electrophoresis and detected using a variety of fluorescence-detecting instruments. Storage Conditions: Store at –30°C to +10°C. After first use, store at 2–10°C, protected from light. WEN Internal Lane Standard 500 Y23 Product Size Cat.# WEN Internal Lane Standard 500 Y23 200 µl DG5201 Not For Medical Diagnostic Use. Description: The WEN Internal Lane Standard 500 Y23 is designed for use with the PowerPlex® Y23 System. The standard contains 21 fragments ranging in size from 60bp to 500bp. Fragments of 60–200bp are spaced at 20bp intervals, except for the 65bp fragment. Fragments of 200–500bp are spaced every 25bp. Fragments that are muliples of 100bp have a higher intensity than the other fragments to simplify size assignment. The DNA fragments are double-stranded and asymmetrically labeled with a proprietary WEN dye. The WEN Internal Lane Standard 500 Y23 is intended to be used in assigning sizes to DNA fragments separated by capillary electrophoresis and detected using a variety of fluorescence-detecting instruments. Storage Conditions: Store at –30°C to +10°C. After first use of the system, store at 2–10°C, protected from light. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 265 17Genetic Identity For complete and up-to-date product information visit: www.promega.com Internal Lane Standard 600 Product Size Cat.# Internal Lane Standard 600 150 μl DG1071 For Laboratory Use. Description: The Internal Lane Standard 600 (ILS 600) consists of 22 bands ranging in size from 60bp to 600bp. Fragments of 60–200bp are spaced at 20bp intervals, fragments of 200–500bp are spaced every 25 bases, and fragments of 500–600bp are spaced every 50 bases. Fragments that are multiples of 100 bases have fluorescence intensities approximately twice that of other fragments to simplify size assignment. The DNA ladder is double-stranded and asymmetrically labeled with carboxy-X-rhodamine (CXR). The Internal Lane Standard 600 is used to assign sizes to DNA fragments separated by electrophoresis and detected using a variety of fluorescence-detection instruments (e.g., Hitachi FMBIO® Fluorescence Imaging System and ABI PRISM® 310, 3100, 3100-Avant and Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers). ILS 600 is commonly used as an internal size marker for other applications and can be visualized by detecting fluorescent emission at 597nm after excitation at 576nm. In addition, the Internal Lane Standard 600 contains additives that prevent the formation of two artifacts (“split peak” and “n–10”) at the vWA locus in the PowerPlex® 16 and 16 HS Systems when using ABI PRISM® 3100, 3100-Avant and Applied Biosystems® 3130 and 3130xl Genetic Analyzers. Storage Conditions: Store at –20°C. Avoid multiple freeze-thaw cycles or exposure to frequent temperature changes. These fluctuations can greatly alter product stability. The Internal Lane Standard 600 is light-sensitive; therefore, minimize light exposure. 2800M Control DNA Product Size Conc. Cat.# 2800M Control DNA 25 μl 10 ng/µl DD7101 500 μl 0.25 ng/µl DD7251 Not For Medical Diagnostic Use. Description: The 2800M Control DNA is a single-source male human genomic DNA. This DNA can be used as a control for human STR analysis. Storage Conditions: Store at 2–10°C. VersaPlex™ 27PY System Product Size Cat.# VersaPlex™ 27PY System 200 reactions DC7020 Available Separately VersaPlex™ 6C Matrix Standard 5 preps DG4960 Not for Medical Diagnostic Use. Product may not be available in all countries. Please contact your local representative for more information. Description: Not for Medical Diagnostic Use. Product may not be available in all countries. Please contact your local representative for more information. Short tandem repeat (STR) loci are well distributed throughout the human genome and can be detected using the polymerase chain reaction (PCR). Alleles of STR loci are differentiated by the number of copies of the repeat sequence contained within the amplified region. They can be distinguished from one another using fluorescence detection following electrophoretic separation. The VersaPlex™ 27PY System is a 6-color, 27-loci multiplex STR amplification system capable of rapid cycling. In addition to the D6S1043 locus, the kit includes: CSF1PO, FGA, TH01, TPOX, vWA, D1S1656, D2S441, D2S1338, D3S1358, D5S818, D7S820, D8S1179, D10S1248, D12S391, D13S317, D16S539, D18S51, D19S433, D21S11, D22S1045, Penta D, Penta E, DYS391, DYS570, DYS576 and Amelogenin. Features: • Improved results from challenging samples helps save time and reduce costs by minimizing the need to repeat assays • Designed for forensic casework and paternity determination • Rapid cycling capabilities reduce processing time for all samples Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 266 For complete and up-to-date product information visit: www.promega.com Massively Parallel Sequencing PowerSeq™ Quant MS System Product Size Cat.# PowerSeq™ Quant MS System 500 reactions PS5000 Not For Medical Diagnostic Use. Description: The PowerSeq™ Quant MS System is a qPCR-based system designed for library quantification within the MPS workflow by directly measuring the number of DNA molecules present in libraries. Accurate quantification of a library determines the optimal amount of adapter ligated fragments for cluster generation and ensures even representation of each library on the chip. Features: • Enables normalization of MPS libraries based on DNA quantification • Uses BRYT Green® dye-based qPCR system for maximum sensitivity and reproducibility • Enables accurate and balanced multiplexed Illumina pooled libraries Storage Conditions: Store at –30°C to –10°C in a nonfrost-free freezer protected from light. PowerSeq™ CRM Nested System, Custom Product Size Cat.# PowerSeq™ CRM Nested System, Custom 1 each AX5810 Not For Medical Diagnostic Use. Description: Massively parallel sequencing (MPS) allows laboratories access to mitochondrial DNA (mtDNA) analysis using a more sensitive and highthroughput workflow compared to traditional sequencing methods. Increased mixture deconvolution and heteroplasmy resolution are achieved by deep sequencing coverage and digital read counts. Additionally, the use of small amplicons to sequence the mitochondrial control region improves sequencing results from degraded samples. The PowerSeq™ CRM Nested System, Custom, generates 10 small amplicons covering the control region of the mitochondrial genome in one multiplex. The targeted regions for amplification are designed to be in a range of 144–237bp to ensure optimal results from degraded samples. The system uses a nested amplification protocol that greatly reduces the number of steps and time required to produce libraries ready for sequencing. The protocol consists of a single PCR step to both amplify the target amplicons and incorporate indexed sequencing adapters. Features: • Massively parallel sequencing of mitochondrial HVI, HVII and HVIII control regions in a single reaction • Nested amplification protocol greatly reduces number of steps and time required for library preparation • Small amplicons ranging from 144–237bp for better results with compromised samples Storage Conditions: Store at –30°C to –10°C. Consumables for DNA Extraction in PCR, qPCR and CE Applications Product Size Cat.# Septa Mat, 96-Well 10 each CE2696 Optical Plate Seals 100 each V7840 Strip Cap, 8-Well 120 each V7850 Not For Medical Diagnostic Use. Description: Our plastic consumables provide excellent performance at a good value. These PCR plastics and consumables support DNA extraction, quantification, amplification and capillary electrophoresis of DNA. The PCR plastics and consumables are made for a variety of thermal cyclers, real-time PCR systems and CE instrumentation. Optical Plate Seals are used for sealing microplates to prevent evaporation and contamination in real-time PCR; they are compatible with real-time PCR systems such as the Applied Biosystems 7500 Real-Time System. Strip Caps are eight-strip domed caps for PCR plates and tubes to prevent evaporation and contamination in PCR. Septa Mats are used for sealing 96-well plates in capillary electrophoresis; they are compatible with Spectrum CE System and ABI Sequencers and Genetic Analyzers. Features: • PCR plastics and consumables made for a variety of thermal cyclers, realtime PCR systems and CE instrumentation. Storage Conditions: Store all consumables at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 267 18 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Biochemicals and Labware Biochemical Buffers and Reagents 268 Nucleic Acids 281 Tips and Accessories 283 Biochemicals and Labware Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 268 For complete and up-to-date product information visit: www.promega.com Biochemical Buffers and Reagents 4-CORE® Buffer Pack Product Size Cat.# 4-CORE® Buffer Pack (Buffers A, B, C and D), 1ml each 4 ml R9921 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 114. 5M Sodium Chloride, Molecular Biology Grade Product Size Conc. Cat.# 5M Sodium Chloride, Molecular Biology Grade 1 L 5 M V4221 For Research Use Only. Not for Use in Diagnostic Procedures. Description: 5M Sodium Chloride is commonly used in many molecular biology and forensic applications. Form: Clear, colorless liquid. Composition: 292.2g/L NaCl in deionized water. Properties: • pH at 25°C (1M): 5.0–8.0. • A260 at 5M: ≤0.02. • A280 at 5M: ≤0.01. • Conductivity at 25°C (0.05M): 5,000–7,000μSm. Features: • Quality Tested: Each lot of NaCl is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Acrylamide, Molecular Grade Product Size Cat.# Acrylamide, Molecular Grade 100 g V3111 500 g V3115 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Acrylamide, Molecular Grade, is used for the electrophoretic separation of nucleic acids and proteins. Very small DNA fragments, such as those generated by sequencing reactions, can be resolved by polyacrylamide gel electrophoresis. Proteins can be separated by a variety of techniques, including denaturing gel electrophoresis using SDS or urea, isoelectric focusing and native gel electrophoresis in a wide variety of buffers. Formula Weight: 71.08. Form: White, free-flowing crystals. Properties: • Purity: ≥99.9%. • Melting Point: 84–86°C. • Free Acrylic Acid: <0.001%. • Iron: ≤1ppm. • Lead: ≤1ppm. • pH (10% in 0.1M NaCl at 25°C): 6.0–7.0. • Conductivity (40% in water): ≤2.5μmhos. Features: • Quality Tested: Each lot of Molecular Grade Acrylamide is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Protect from moisture. Agarose, LE, Analytical Grade Product Size Cat.# Agarose, LE, Analytical Grade 100 g V3121 500 g V3125 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Agarose, LE, Analytical Grade, is used for the electrophoretic separation of nucleic acids. Form: White powder. Properties: • Gel Strength (1%): ≥1,000g/cm2 . • Gelling Point (1.5%): 36–39°C. • Melting Point (1.5%): 87–89°C. • EEO (–mr): 0.09–0.13. • Sulfate: ≤0.14%. • Moisture: ≤7.0%. Features: • Quality Tested: Each lot of Analytical Grade LE Agarose is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at +15°C to +30°C. Agarose, LMP, Preparative Grade for Large Fragments (>1,000bp) Product Size Cat.# Agarose, LMP, Preparative Grade for Large Fragments (>1,000bp) 25 g V2831 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Agarose, LMP, Preparative Grade for Large Fragments (>1,000bp), is a premium agarose used for isolating DNA fragments larger than 1,000bp. Each lot is tested and certified for the following applications: 1) restriction digestion, 2) ligation and transformation, and 3) random prime labeling. LMP = low melting point (i.e., ≤65°C). Form: White powder. Properties: • Gelling Point (1.5%): 26–30°C. • Melting Point (1.5%): ≤65°C. • Sulfate: ≤0.10%. • EEO (–mr): ≤0.10. • Moisture: ≤10%. • Gel Strength (1%): ≥200g/cm2 . Features: • Quality Tested: Each lot of Preparative Grade LMP Agarose is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at +15°C to +30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 269 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com Agarose, LMP, Preparative Grade for Small Fragments (10 to 1,000bp) Product Size Cat.# Agarose, LMP, Preparative Grade for Small Fragments (10 to 1,000bp) 25 g V3841 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Agarose, LMP, Preparative Grade for Small Fragments (10 to 1,000bp), is a premium agarose used for isolating DNA fragments from 10 to 1,000bp. The isolated DNA fragments can be used in various molecular biology applications: 1) restriction digestion, 2) ligation and transformation, and 3) random prime labeling. LMP = low melting point (i.e., ≤65°C). Form: White powder. Properties: • Gelling Point (4%): ≤35°C. • Melting Point (4%): ≤65°C. • Sulfate: ≤0.15%. • EEO (–mr): ≤0.15. • Moisture: ≤10%. • Gel Strength: ≥500g/cm2 . Features: • Quality Tested: Each lot of Preparative Grade LMP Agarose is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at +15°C to +30°C. Agarose, Low Melting Point, Analytical Grade Product Size Cat.# Agarose, Low Melting Point, Analytical Grade 25 g V2111 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Agarose, Low Melting Point, Analytical Grade, is ideal for applications that require recovery of intact DNA fragments after gel electrophoresis. Form: White powder. Properties: • Gelling Point (1.5%): 24–28°C. • Melting Point (1.5%): ≤65.5°C. • Sulfate: ≤0.12%. • EEO (–mr): ≤0.11. • Gel Strength (1%): ≥300g/cm2 . Features: • Quality Tested: Each lot of Analytical Grade LMP Agarose is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at +15°C to +30°C. Ammonium Sulfate, Molecular Biology Grade Product Size Cat.# Ammonium Sulfate, Molecular Biology Grade 5 kg H5252 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Ammonium Sulfate, Molecular Biology Grade, is a salt used in the purification of enzymes and other proteins by precipitation. Formula Weight: 132.13. Properties: • Purity: ≥99.0%. • Chloride: ≤5ppm. • Copper: ≤5ppm. • Iron: ≤5ppm. • Zinc: ≤5ppm. • Lead: ≤5ppm. • pH at 25°C (1M): 5.0–6.0. • A260 at 1M: ≤0.03. • A280 at 1M: ≤0.03. Features: • Quality Tested: Each lot of Ammonium Sulfate is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 270 For complete and up-to-date product information visit: www.promega.com Antibiotic G-418 Sulfate Product Size Cat.# Antibiotic G-418 Sulfate 5 g V7983 Antibiotic G-418 Sulfate Solution 20 ml V8091 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Antibiotic G-418 Sulfate is an aminoglycosidic antibiotic toxic to both prokaryotic and eukaryotic cells. It acts by interfering with protein synthesis and is used as an agent for selection of cultured cells expressing a gene (i.e., aminoglycoside 3´ phosphotransferase [APH 3´]) that confers resistance to G-418. The liquid form of the product is in distilled water and aseptically filtered. Formula Weight: 692.6 (anhydrous). Form: White powder. Physical/Chemical Properties of Powder: • Appearance: White powder. • TLC: Single major spot. • Elemental Analysis: %C = 28.8–36.07; %H = 5.76–7.76; %N = 6.72–8.41. • Absorbance: A280 (1mg/ml) = 0–0.015; A570 (100mg/ml) = 0–0.1. • Specific Rotation: +104° to +121°. Properties Specific to V7983: • Appearance: White powder. • Hydration Waters: 0–6, as determined from Elemental Analysis. • Potency: ≥700μg/mg. Properties Specific to V8091: • Potency: 40–60mg/ml. • Sterility: Aseptically filtered. Features: • Sterility: Antibiotic G-418 Sulfate liquid requires sterilization. Storage Conditions: Store at +15°C to +30°C. BCIP/NBT Color Development Substrate (5-bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium) Product Size Cat.# BCIP/NBT Color Development Substrate 1.25/2.5 ml S3771 For Laboratory Use. Description: BCIP (5-bromo-4-chloro-3-indolyl-phosphate) is used in conjunction with NBT (nitro blue tetrazolium) for the colorimetric detection of alkaline phosphatase activity. Each vial of BCIP is supplied with a vial of NBT. Preparation of Substrates to Detect Alkaline Phosphatase: For every 5ml of alkaline phosphatase buffer (100mM Tris-HCl [pH 9.0], 150mM NaCl, 1mM MgCl2 ), add 33μl NBT and 16.5μl BCIP. Add the NBT first, mix, add the BCIP, and mix again. Use within 1 hour, and discard any unused solution. Concentration: BCIP (50mg/ml) in 100% dimethylformamide; NBT (50mg/ml) in 70% dimethylformamide. Features: • Quality Tested: Each lot of BCIP/NBT Color Development Substrate is tested and qualified for use in blotting. Storage Conditions: Store at either 4°C or –20°C. Beetle Luciferin, Potassium Salt Product Size Cat.# Beetle Luciferin, Potassium Salt 5 mg E1601 50 mg E1602 250 mg E1603 1 g E1605 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferase genes from the North American firefly (Photinus pyralis) and from other beetles are commonly used as reporter genes for studying transcription regulation in transient assay systems and as markers for stably transformed eukaryotic cells. Beetle luciferin (also known as d-luciferin) is synthesized as the monopotassium salt and is a substrate for the beetle luciferase reporter systems. d-luciferin is provided for those researchers who prefer to formulate their own assay reagents for monitoring in vitro or in vivo luciferase activity. Formula: C11H7 N2 O3 S2 •K. Formula Weight: 318.4 (anhydrous). Features: • Formulation: Supplied as a potassium salt for easy preparation in aqueous buffer. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –70°C. Bisacrylamide, Molecular Grade (N,N´-Methylenebisacrylamide) Product Size Cat.# Bisacrylamide, Molecular Grade 25 g V3141 125 g V3143 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Bisacrylamide, Molecular Grade, is a cross-linking agent used in the preparation of polyacrylamide gels. This product is tested for its efficiency in gel polymerization. Formula Weight: 154.20. Form: White, free-flowing crystals. Properties: • Purity: ≥99.0%. • Acrylic Acid (CH2 :CHCOOH): ≤0.001%. • A290 (1% solution): ≤0.20. • Magnesium: ≤2ppm. • Conductivity (2% in water): ≤10μmhos. Features: • Quality Tested: Each lot of Bisacrylamide is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 271 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com Blue/Orange Loading Dye, 6X Product Size Cat.# Blue/Orange Loading Dye, 6X 3 ml G1881 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Blue/Orange Loading Dye, 6X, is a convenient marker dye containing 0.4% orange G, 0.03% bromophenol blue, 0.03% xylene cyanol FF, 15% Ficoll® 400, 10mM Tris-HCl (pH 7.5) and 50mM EDTA (pH 8.0). It is provided in a premixed, ready-to-use form. The dye is used for loading DNA samples into gel electrophoresis wells and tracking migration during electrophoresis. In a 0.5–1.4% agarose gel in 0.5X TBE, xylene cyanol FF migrates at approximately 4kb, bromophenol blue at approximately 300bp and orange G at approximately 50bp. Features: • Quality Tested: Each lot of Blue/Orange Loading Dye, 6X, is tested and certified to be free of nuclease activity. Storage Conditions: Store at –20°C. Boric Acid, Molecular Biology Grade (orthoboric acid) Product Size Cat.# Boric Acid, Molecular Biology Grade 500 g H5001 1 kg H5003 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Boric Acid, Molecular Biology Grade, in conjunction with Tris, is commonly used in buffers for the preparation of agarose or acrylamide gels and their associated running buffers. Formula Weight: 61.84. Properties: • Purity: ≥99.5%. • Iron: ≤5ppm. • Lead: ≤5ppm. • Moisture: ≤0.5%. • A260 at 1M: ≤0.015. • A280 at 1M: ≤0.010. Features: • Quality Tested: Each lot of Boric Acid is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Bovine Serum Albumin, Acetylated Product Size Conc. Cat.# Bovine Serum Albumin, Acetylated 1 ml 10 mg/ml R3961 400 μl 1 µg/µl R9461 R3961 For Laboratory Use. R9461 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Bovine Serum Albumin, Acetylated, can be used as an enzyme stabilizer or as a carrier protein. It is prepared by a modification of the method of Gonzalez et al. and dialyzed extensively with deionized water to remove impurities. Features: • Quality Tested: Each lot of BSA is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at –20°C. Coelenterazines Product Size Cat.# Coelenterazine 250 μg S2001 Coelenterazine-h 250 μg S2011 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferases from Renilla, Aequorea and other marine organisms are commonly used as indicators or reporters for studying cellular phenomena in expression assays in eukaryotic cells. Renilla luciferase is often used as a reporter of transcription regulation, whereas apoaequorin is often used as a calcium indicator. Other uses of coelenterazines include chemiluminescent detection of Reactive Oxygen Species (ROS) in cells or tissues. Promega offers the following coelenterazine analogs. Coelenterazine (native) is the luminescent substrate for Renilla luciferase and apoaequorin. Formula: C26H21N3 O3 . Formula Weight: 423.5. Form: Film. Coelenterazine-h imparts a luminescent intensity with its aequorin complex that is reported to be 10–20 times higher than that of native coelenterazine, making this derivative a useful tool for measuring small changes in Ca2+ concentrations. Formula: C26H21N3 O2 . Formula Weight: 407.5. Form: Film. Features: • Highly Pure: 95%. • Custom Capabilities: Custom packaging and sizes available. • Easy to Prepare: Supplied as a dried substrate for easy preparation in methanol or ethanol. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Diamond™ Nucleic Acid Dye Product Size Cat.# Diamond™ Nucleic Acid Dye 500 μl H1181 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Diamond™ Nucleic Acid Dye is a sensitive fluorescent dye that binds to single-stranded DNA, double-stranded DNA and RNA, and can be used to stain and visualize nucleic acids in gels. Diamond™ Nucleic Acid Dye is compatible with denaturing and native agarose and polyacrylamide gels and can be imaged with any standard imaging system, such as by UV transillumination with a Polaroid® or digital camera, GE ImageQuant™ or Bio-Rad Gel Doc™ systems. The concentrated dye is stable for up to 90 days at room temperature. Diamond™ Nucleic Acid Dye does not require prewashing or destaining of gels. It is more much more sensitive than ethidium bromide, so less sample nucleic acid and nucleic acid markers are required for visualization, resulting in increased savings with every gel you run. Features: • Sensitive: Sensitive detection of small amounts of nucleic acids. • Room-Temperature Stable: Convenient storage allows quick and easy use—no thawing necessary. • Flexible: Compatible with a variety of common gel types and imaging equipment. Storage Conditions: Store at room temperature (22–25°C) for up to 90 days. Store at –20°C for long-term storage. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 272 For complete and up-to-date product information visit: www.promega.com DTT, Molecular Grade (DL-Dithiothreitol) Product Size Conc. Cat.# DTT, Molecular Grade 100 μl 100 mM P1171 DTT, Molecular Grade (Dry Powder) 5 g V3151 25 g V3155 P1171 For Laboratory Use. V3151, V3155 For Research Use Only. Not for Use in Diagnostic Procedures. Description: DTT, Molecular Grade, is an antioxidant used to stabilize enzymes and other proteins containing sulfhydryl groups. The liquid form of the product is a 100mM solution of DTT in water. Formula: C4 H10O2 S2 . Formula Weight: 154.25. Form: White crystals/powder or liquid in deionized water. Physical/Chemical Properties of Powder: • Purity: ≥99.0%. • Melting Point: 40–44°C. • A283 at 20mM: ≤0.04. • % Oxidized: ≤0.50%. Features: • Quality Tested: Each lot of DTT is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at –30°C to –10°C. EDTA, 0.5M (pH 8.0), Molecular Biology Grade Product Size Cat.# EDTA, 0.5M (pH 8.0), Molecular Biology Grade 100 ml V4231 400 ml V4233 For Research Use Only. Not for Use in Diagnostic Procedures. Description: EDTA, 0.5M (pH 8.0), Molecular Biology Grade, is a chelator of divalent cations and is suitable for biochemistry and molecular biology applications. It is supplied as a solution in deionized water. Form: Clear, colorless liquid. Properties: • pH at 25°C: 7.9–8.1. • A280 at 0.5M: ≤0.25. • RNase Activity at 0.5M: ≤1.0% release of 3 H-RNA. • DNase Activity at 0.5M: ≤1.0% release of 3 H-DNA. • Protease Assay: None detected. Storage Conditions: Store at +15°C to +30°C. EDTA, Disodium Salt (Dihydrate), Molecular Biology Grade Product Size Cat.# EDTA, Disodium Salt, Molecular Biology Grade 100 g H5031 500 g H5032 For Research Use Only. Not for Use in Diagnostic Procedures. Description: EDTA, Disodium Salt, Molecular Biology Grade, is a chelator of divalent metal cations. Formula Weight: 372.20. Properties: • Purity: ≥99.0%. • Insolubles: ≤0.005%. • Lead: ≤5ppm. • Iron: ≤10ppm. Features: • Quality Tested: Each lot of EDTA is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Ethidium Bromide Solution, Molecular Grade Product Size Conc. Cat.# Ethidium Bromide Solution, Molecular Grade 10 ml 10 mg/ml H5041 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Ethidium Bromide Solution, Molecular Grade (10mg/ml), is a fluorescent dye suitable for staining nucleic acids after electrophoresis or in cesium chloride gradients. The solution can be used to detect both doublestranded and single-stranded DNA. Features: • Quality Tested: Each lot of Ethidium Bromide Solution is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 273 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com Formamide, Molecular Grade Product Size Cat.# Formamide, Molecular Grade 100 ml H5051 500 ml H5052 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Formamide is often used for the denaturation of nucleic acids in applications such as hybridization, sequencing gel electrophoresis and electron microscopy. Formula Weight: 45.04. Properties: • Purity: ≥99.5%. • Copper: ≤1ppm. • Iron: ≤1ppm. • Lead: ≤1ppm. • Zinc: ≤1ppm. • Refractive Index at 20°C: 1.446–1.448. • pH at 25°C of 1%: 6.5–7.5. • A260 at 10%: ≤0.10. • A280 at 10%: ≤0.02. Features: • Quality Tested: Each lot of Formamide is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Glycerol, Molecular Biology Grade Product Size Cat.# Glycerol, Molecular Biology Grade 1,000 ml H5433 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Glycerol is used for storage of enzymes at low temperatures. A 50% (w/v) glycerol solution will not freeze at –20°C. Glycerol is often used as a component in electrophoresis loading buffers because of its density (1.26g/ml). In addition, glycerol gradients can be used in the purification of bacteriophage or proteins. Cat.# H5433 is anhydrous glycerol with a purity of ≥99.5%. Properties: • Purity: ≥99.5%. • Calcium: ≤2ppm. • Magnesium: ≤1ppm. • Lead: ≤5ppm. • Zinc: ≤1ppm. • A260 at 10%: ≤0.05. • A280 at 10%: ≤0.05. Features: • Quality Tested: Each lot of glycerol is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Glycine, Molecular Biology Grade Product Size Cat.# Glycine, Molecular Biology Grade 500 g H5071 1 kg H5073 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Glycine is an amino acid used in the preparation of some electrophoresis buffers. Formula Weight: 75.07. Properties: • Purity: ≥99.0%. • Iron: ≤10ppm. • A260 at 1M: ≤0.05. • A280 at 1M: ≤0.05. Features: • Quality Tested: Each lot of Glycine is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Guanidine Thiocyanate, Molecular Grade (Guanidinium Thiocyanate) Product Size Cat.# Guanidine Thiocyanate, Molecular Grade 100 g V2791 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Guanidine Thiocyanate, Molecular Grade, at high concentrations, is a protein denaturant used most commonly for the isolation of intact RNA due to its ability to inhibit RNase. Formula Weight: 118.16. Form: White, crystalline powder. Properties: • Purity: ≥99.0%. • Insolubles: None. • A280 at 6M: ≤0.8. • A300 at 6M: ≤0.1. • A320 at 6M: ≤0.1. • A410 at 6M: ≤0.1. • Moisture: ≤1%. • Melting Point: 118–121°C. • Potassium: ≤50ppm. • Sodium: ≤0.5%. • Zinc: ≤1.5ppm. • Copper: ≤0.5ppm. • Barium: ≤3ppm. • Iron: ≤5ppm. Features: • Quality Tested: Each lot of Guanidine Thiocyanate is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 274 For complete and up-to-date product information visit: www.promega.com Guanidine-HCl, Molecular Biology Grade (Guanidinium Hydrochloride) Product Size Cat.# Guanidine-HCl, Molecular Biology Grade 100 g H5381 500 g H5383 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Guanidine-HCl, Molecular Grade, is commonly used for the isolation of intact mRNA from tissues or cultured cells. Formula Weight: 95.53. Form: Fine, colorless or white crystals. Properties: • Purity: ≥99.5%. • A230 at 6M: ≤0.15. • A260 at 6M: ≤0.03. • A280 at 6M: ≤0.02. • Moisture: ≤0.3%. • Melting Point: 186–188°C. • Lead: ≤5ppm. • Zinc: ≤1ppm. • Copper: ≤1ppm. • Iron: ≤5ppm. Features: • Quality Tested: Each lot of Guanidine-HCl is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. HEPES, Molecular Biology Grade (free acid) Product Size Cat.# HEPES, Molecular Biology Grade (free acid) 100 g H5302 500 g H5303 For Research Use Only. Not for Use in Diagnostic Procedures. Description: HEPES is a biological buffer that functions over a pH range of 6.8 to 8.2. Formula Weight: 238.3. Properties: • Appearance: White, crystalline powder. • Purity: ≥99.5%. • Lead: ≤5ppm. • Iron: ≤5ppm. • Moisture: ≤0.5%. • pH at 25°C (1M): 5.0–6.5. • A260 at 0.1M: ≤0.05. • A280 at 0.1M: ≤0.04. Features: • Quality Tested: Each lot of HEPES is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. IPTG, Dioxane-Free Product Size Cat.# IPTG, Dioxane-Free 1 g V3955 5 g V3951 50 g V3953 For Research Use Only. Not for Use in Diagnostic Procedures. Description: IPTG, Dioxane-Free (isopropyl-β-d-thiogalactopyranoside), is an inducer of β-galactosidase activity in many bacteria. Functioning as a lac analog, IPTG induces β-galactosidase activity by binding to and inhibiting the lac repressor. This product is used to differentiate recombinants from nonrecombinants in cloning strategies using vectors containing the lacZ or lacZ α-peptide gene. Formula Weight: 238.31. Form: White powder. Properties: • Purity: ≥99.0%. • Moisture: ≤1%. • pH (5%, H2 O): 5–7. • Dioxane Content: ≤10ppm. Storage Conditions: Store dry at –30°C to +10°C. Luciferin-EF™ Endotoxin-Free Luciferin Na Product Size Cat.# Luciferin-EF™ 25 mg E6551 250 mg E6552 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferin-EF™ is an endotoxin-free beetle luciferin that can be used for cell-based imaging applications in living systems, where endotoxin may create problems. Luciferin-EF™ is tested to ensure endotoxin is below detectable levels and packaged in amber vials with septa to facilitate easy dilution and use. Features: • Achieve Endotoxin Levels Below Detection Limits: No potential interference in assay due to the presence of endotoxins. • Be Assured of Product Integrity: Luciferin-EF™ is packaged in amber vials with septa to ensure product integrity as well as offer ease of dilution and use for imaging experiments. • Appreciate Flexibility and Convenience: Luciferin-EF™ is available in two sizes, depending on the number of experiments to be performed. Storage Conditions: Store at –70°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 275 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com L-Rhamnose Monohydrate Product Size Cat.# L-Rhamnose Monohydrate 10 g L5701 50 g L5702 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 330. MOPS/EDTA Buffer Product Size Cat.# MOPS/EDTA Buffer 3 × 10 ml Y5101 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 191. MULTI-CORE™ Buffer Pack Product Size Cat.# MULTI-CORE™ Buffer Pack 3 × 1 ml R9991 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 114. Nuclease-Free Water Product Size Cat.# Nuclease-Free Water 50 ml P1193 150 ml P1195 500 ml P1197 1,000 ml P1199 P1193 For Laboratory Use. P1195, P1197, P1199 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Nuclease-Free Water is an essential component of molecular biology experiments. Features: • Quality Tested: Each lot of Nuclease-Free Water is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at <30°C. PEG 8000, Molecular Biology Grade (Polyethylene Glycol 8000) Product Size Cat.# PEG 8000 Powder, Molecular Biology Grade 500 g V3011 For Research Use Only. Not for Use in Diagnostic Procedures. Description: PEG 8000 is used in the precipitation of phage, isolation of plasmid DNA and the enhancement of blunt-ended ligation reactions. Formula Weight: 7,000–9,000. Form: White, waxy crystalline flakes. Properties: • Purity: ≥99.0%. • pH at 25°C (5% water): 5.0–7.0. Features: • Quality Tested: Each lot of PEG 8000 is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at +15°C to +30°C. Protease Inhibitor Cocktail Product Size Cat.# Protease Inhibitor Cocktail, 50X 1 ml G6521 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Protease Inhibitor Cocktail is used to prevent protein degradation after lysing cells. The product is a mixture of six different protease inhibitors with different target protease specificities. The inhibitor cocktail is EDTA-free and provided as a powder, ready for reconstitution in 1ml of either 100% ethanol or DMSO to obtain a 50X working solution. Features: • Broad Specificity: Inhibitor cocktail is effective against a diverse number of proteases. • Great Potency: Reagent provides the best-in-class level of protease inhibition. • Highly Compatible: Works with a wide array of protein fusion tags (e.g., Flag®, His tag, GST tag) and capture technologies. It is ideally suited for HaloTag® Technology-based approaches. Storage Conditions: Store powdered Protease Inhibitor Cocktail at –30 to –10°C. Reconstituted Protease Inhibitor Cocktail can be stored at 2–10°C for 12 months. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 276 For complete and up-to-date product information visit: www.promega.com Proteinase K (Lyophilized) Product Size Cat.# Proteinase K 100 mg V3021 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Proteinase K, produced by the fungus Tritirachium album Limber, is a serine protease that exhibits broad cleavage activity. It cleaves peptide bonds adjacent to the carboxylic group of aliphatic and aromatic amino acids and is useful for general digestion of protein in biological samples. It has been purified to remove RNase and DNase activities. The stability of Proteinase K in urea and SDS and its ability to digest native proteins make it useful for a variety of applications including preparation of chromosomal DNA for pulsedfield gel electrophoresis, protein fingerprinting and removal of nucleases from preparations of DNA and RNA. A typical working concentration for Proteinase K is 50–100μg/ml. Form: Lyophilized powder. Recommended Reaction Buffer: 50mM Tris-HCl (pH 8.0), 10mM CaCl2 . Features: • Stable: Active over a pH range of 4.3–12.0, in 0.5% SDS or 1% Triton® X-100 and retains >80% of its activity at temperatures up to 60°C. Storage Conditions: Store lyophilized powder desiccated at –20°C. Proteinase K (PK) Solution Product Size Conc. Cat.# Proteinase K (PK) Solution 4 ml 20 mg/ml MC5005 16 ml 20 mg/ml MC5008 23 ml A5051 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Proteinase K, produced by the fungus Tritirachium album Limber, is a serine protease that exhibits broad cleavage activity. It cleaves peptide bonds adjacent to the carboxylic group of aliphatic and aromatic amino acids and is useful for general digestion of protein in biological samples. It has been purified to remove RNase and DNase activities. The stability of Proteinase K in urea and SDS and its ability to digest native proteins make it useful for a variety of applications including preparation of chromosomal DNA for pulsedfield gel electrophoresis, protein fingerprinting and removal of nucleases from preparations of DNA and RNA. A typical working concentration for Proteinase K is 50–100μg/ml. Formulation: Proteinase K (PK) Solution is supplied at a concentration of 20mg/ml in 10mM Tris-HCl (pH 7.5), 1mM calcium chloride and 50% glycerol. Features: • Stable: Active over a pH range of 4.3–12.0 in 0.5% SDS or 1% Triton® X-100 and retains >80% of its activity at temperatures up to 60°C. • Easy to Use: Provided in solution stable at room temperature and does not require resuspension or thawing prior to use. Storage Conditions: Store at 22–25°C. RNase A Solution Product Size Conc. Cat.# RNase A Solution 1 ml 4 mg/ml A7973 5 ml 4 mg/ml A7974 For Research Use Only. Not for Use in Diagnostic Procedures. Description: RNase A is an endoribonuclease that specifically hydrolyzes RNA 3´ of pyrimidine residues and cleaves the phosphodiester linkage to the adjacent nucleotide. RNase A is used to remove RNA during procedures for the isolation of plasmid and genomic DNA. Storage Conditions: Store at 15–30°C. SDS Solution, Molecular Biology Grade (10% w/v) Product Size Cat.# SDS Solution, Molecular Biology Grade (10% w/v) 100 ml V6551 500 ml V6553 For Research Use Only. Not for Use in Diagnostic Procedures. Description: SDS Solution (10% w/v) is sodium dodecyl sulfate in distilled, deionized water. SDS is a detergent that is known to denature proteins. It is used in polyacrylamide gel electrophoresis for the determination of protein molecular weight. It is also used in nucleic acid extraction procedures for the disruption of cell walls and dissociation of nucleic acid:protein complexes. Properties: • A260: ≤0.3. • A280: ≤0.2. Features: • Quality Tested: Each lot of SDS Solution is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at +15°C to +30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 277 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com Sephacryl® S-400 Product Size Cat.# Sephacryl® S-400 10 ml V3181 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Sephacryl® S-400 is a chromatography matrix used for rapid gel filtration. This matrix is useful in experiments involving the incorporation of synthetic linkers and adaptors. After linker ligation and digestion with the appropriate enzyme, unincorporated linkers and linker fragments may be rapidly removed from the DNA sample using spin columns containing Sephacryl® S-400. Such columns may be used to separate small DNA fragments (≤271bp) from longer DNA molecules. Composition: Suspension in 10mM Tris-HCl (pH 8.0), 100mM NaCl and 1mM EDTA. Features: • Quality Tested: Each lot is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at +2°C to +10°C. Sodium Chloride, Molecular Biology Grade Product Size Cat.# Sodium Chloride, Molecular Biology Grade 500 g H5271 1 kg H5273 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Sodium Chloride, Molecular Biology Grade, is commonly used in many molecular biology and forensic applications. Formula Weight: 58.45. Properties: • Purity: ≥99.5%. • Iron: ≤2ppm. • Lead: ≤5ppm. • pH at 25°C of 1M: 5.0–8.0. • A260 at 1M: ≤0.02. • A280 at 1M: ≤0.01. • Conductivity at 25°C (0.05M): 5,000–7,000μSm. Features: • Quality Tested: Each lot of Sodium Chloride is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Sodium Dodecyl Sulfate, Molecular Biology Grade (SDS) Product Size Cat.# Sodium Dodecyl Sulfate, Molecular Biology Grade (SDS) 100 g H5113 500 g H5114 1 kg H5115 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Sodium Dodecyl Sulfate, Molecular Biology Grade (SDS), is a detergent that is known to denature proteins. It is used in denaturing polyacrylamide gel electrophoresis for the determination of protein molecular weight. It is also used in nucleic acid extraction procedures for the disruption of cell walls and dissociation of nucleic acid:protein complexes. Formula Weight: 288.38. Properties: • Purity: ≥99.5%. • pH at 25°C (3% w/v): 6.0–7.5. • A230 at 3%: ≤0.40. • A260 at 3%: ≤0.30. • A280 at 3%: ≤0.05. • A405 at 3%: ≤0.01. Features: • Quality Tested: Each lot is tested and certified to be free of DNase and RNase activity. Storage Conditions: Store at +15°C to +30°C. SSC Buffer, 20X, Molecular Grade Product Size Cat.# SSC Buffer, 20X, Molecular Grade 1,000 ml V4261 For Research Use Only. Not for Use in Diagnostic Procedures. Description: SSC Buffer, 20X, Molecular Grade (pH 7.0), is commonly used in nucleic acid hybridization techniques at concentrations from 0.1X to 20X, depending on the application. Form: Clear, colorless liquid. Composition: 3M NaCl, 0.3M sodium citrate (for 20X concentration). Properties: • pH at 25°C (20X): 6.9–7.1. • Lead: ≤10ppm. • Conductivity at 25°C (2X): 24.4–32.4mmhos. Features: • Quality Tested: Each lot of SSC Buffer is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Streptavidin Product Size Cat.# Streptavidin 1 mg Z7041 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Promega Streptavidin is purified by affinity chromatography and is of the highest quality available. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 278 For complete and up-to-date product information visit: www.promega.com Streptavidin Alkaline Phosphatase Product Size Cat.# Streptavidin Alkaline Phosphatase 0.5 ml V5591 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Streptavidin Alkaline Phosphatase is used for the detection of biotinylated molecules. Composition: Conjugated Streptavidin Alkaline Phosphatase in PBS, 1mg/ml BSA, 1mM MgCl2 , 0.1mM ZnCl2 and 0.02% sodium azide. Features: • Quality Tested: Streptavidin Alkaline Phosphatase is quality tested to ensure optimal performance for the detection of biotinylated molecules. Storage Conditions: Store at 4°C. Do not freeze! TAE Buffer, Molecular Biology Grade (Tris-acetate-EDTA) Product Size Conc. Cat.# TAE Buffer, 10X, Molecular Biology Grade 1,000 ml 10X V4271 TAE Buffer, 40X, Molecular Biology Grade 1,000 ml 40X V4281 For Research Use Only. Not for Use in Diagnostic Procedures. Description: TAE Buffer is the most commonly used buffer for agarose DNA electrophoresis. A 1X solution is obtained by adding 1 part of the concentrated TAE to 9 or 39 parts of deionized water. Form: Clear, colorless liquid. Properties: • Composition (10X): 400mM Tris-acetate, 10mM EDTA. • Composition (40X): 1.6M Tris-acetate, 40mM EDTA. • pH at 25°C: 8.2–8.4. • Lead: ≤10ppm. Features: • Quality Tested: Each lot of TAE Buffer is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. TBE Buffer, 10X, Molecular Biology Grade Product Size Cat.# TBE Buffer, 10X, Molecular Biology Grade 1,000 ml V4251 For Research Use Only. Not for Use in Diagnostic Procedures. Description: TBE Buffer, 10X (pH 8.3), is used for polyacrylamide and agarose gel electrophoresis. This product has been optimized for use in DNA applications. Form: Clear, colorless liquid. Composition: 890mM Tris-borate, 890mM boric acid, 20mM EDTA. Properties: • pH at 25°C (1X): 8.2–8.4. Features: • Quality Tested for DNase Activity: Each lot of TBE Buffer is tested and demonstrates ≤1% release. • Quality Tested for RNase Activity: Each lot of TBE Buffer is tested and demonstrates ≤1% release. Storage Conditions: Store at +15°C to +30°C. TE Buffer, 1X, Molecular Biology Grade Product Size Cat.# TE Buffer, 1X, Molecular Biology Grade 100 ml V6231 500 ml V6232 For Research Use Only. Not for Use in Diagnostic Procedures. Description: TE Buffer, 1X, Molecular Grade (pH 8.0), is a buffer composed of 10mM Tris-HCl containing 1mM EDTA•Na2 . Properties: • pH at 25°C: 7.9–8.1. • A280: ≤0.05. Features: • Quality Tested: Each lot of TE Buffer is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 279 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com TMB Stabilized Substrate for Horseradish Peroxidase Product Size Cat.# TMB Stabilized Substrate for Horseradish Peroxidase 200 ml W4121 For Research Use Only. Not for Use in Diagnostic Procedures. Description: TMB Stabilized Substrate is a stable, ready-to-use TMB (3,3´, 5,5´-tetramethylbenzidine) color development substrate for localization of horseradish peroxidase-conjugated antibodies on dot blots and Western blots. It is easier to use than 4-chloro-1-naphthol (CN), which must be prepared immediately before use. TMB Stabilized Substrate comes premixed and fully diluted in a proprietary buffer containing less than 0.5% organic solvent. Features: • Convenient: Premixed, ready-to-use; in proprietary buffer containing less than 0.5% organic solvents. • Stable: Stable at room temperature for 12 months. • Sensitive: At least threefold more sensitive than 4-chloro-1-naphthol (CN); as little as 412pg of β-galactosidase detected on TMB blot as compared to 1.12ng on CN blot when detected with a β-galactosidase-specific antibody and HRP-conjugated secondary antibody. • Long-Lasting Color: Color is much more stable than 4-chloro-1-naphthol and photographs more easily. Storage Conditions: Store at 22–25°C. Tris Base, Molecular Biology Grade Product Size Cat.# Tris Base, Molecular Biology Grade 100 g H5133 500 g H5131 2,500 g H5135 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Tris Base, Molecular Biology Grade, is commonly used for many molecular biology applications. Formula: C4 H11NO3 . Formula Weight: 121.14. Form: Crystalized free base. Properties: • pH at 25°C of 1M: 10.0–11.5. • Purity: ≥99.9%. • A260 at 1M: ≤0.05. • A280 at 1M: ≤0.05. • Melting Point: 167–172°C. • Moisture: ≤0.2%. • Lead: ≤2ppm. • Magnesium: ≤1ppm. • Calcium: ≤1ppm. • Iron: ≤1ppm. Features: • Quality Tested: Each lot of Tris Base is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Tris-HCl, Molecular Biology Grade (Tris-Hydrochloride) Product Size Cat.# Tris-HCl, Molecular Biology Grade 100 g H5121 500 g H5123 2,500 g H5125 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Tris-HCl, Molecular Biology Grade, is sometimes used in combination with Tris base for preparation of Tris-HCl buffers. Formula Weight: 157.56. Properties: • pH at 25°C (0.1M): 4.2–5.0. • Purity: ≥99.0%. • A240 at 1M: ≤0.06. • A260, A280, A300, A600 at 1M: ≤0.05. • Melting Point: 150–152°C. • Moisture: ≤0.5%. • Calcium: ≤5ppm. • Iron: ≤5ppm. • Lead: ≤1ppm. • Magnesium: ≤1ppm. • Manganese: ≤1ppm. • Copper: ≤1ppm. • Zinc: ≤1ppm. Features: • Quality Tested: Each lot of Tris-HCl is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Triton® X-100, Molecular Biology Grade Product Size Cat.# Triton® X-100, Molecular Biology Grade 100 ml H5142 500 ml H5141 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Triton® X-100, Molecular Biology Grade, is a widely used nonionic surfactant. Properties: • Moisture: ≤1.0%. • Lead: ≤5ppm. • Iron: ≤5ppm. • Density at 25°C: 1.0645–1.0655g/ml. Features: • Quality Tested: Each lot of Triton® X-100 is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 280 For complete and up-to-date product information visit: www.promega.com Tween® 20, Molecular Biology Grade Product Size Conc. Cat.# Tween® 20, Molecular Biology Grade 100 ml 100% H5152 500 ml 100% H5151 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Tween® 20, Molecular Biology Grade, is a nonionic detergent used for many different molecular biology applications. Properties: • Appearance: Clear, yellow, viscous liquid. • Hydroxyl Number: 96–108. • Lead: ≤10ppm. Features: • Quality Tested: Each lot of Tween® 20 is tested and certified to be free of DNase, RNase and protease activity. Storage Conditions: Store at +15°C to +30°C. Urea Product Size Cat.# Urea 1 kg V3171 5 kg V3175 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Urea is a protein denaturant. Urea is qualified for use as the denaturing component in polyacrylamide gels. Formula: (NH2 ) 2 CO. Formula Weight: 60.06. Form: Fine, white, free-flowing pastilles. Properties: • Purity: ≥99.0%. • Melting Point: 132–135°C. • A280 at 8M in water: ≤0.10. • Chloride: ≤0.0005%. • Heavy Metals: ≤0.001%. • Iron: ≤0.001%. • Cyanate: none detected. Storage Conditions: Store at +15°C to +30°C. Protect from moisture. Western Blue® Stabilized Substrate for Alkaline Phosphatase Product Size Cat.# Western Blue® Stabilized Substrate for Alkaline Phosphatase 100 ml S3841 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Western Blue® Stabilized Substrate for Alkaline Phosphatase is a stable, ready-to-use substrate for Western blots and immunoscreening. It is a mixture of 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) and nitro blue tetrazolium (NBT) in a proprietary stabilizing buffer. Western Blue® Substrate should be used directly and without dilution. This liquid substrate deposits a permanent dark purple stain on membrane sites bearing alkaline phosphatase. Western Blue® Substrate is as sensitive as other reagents based on the BCIP/ NBT formulation. Features: • Convenient: Ready-to-use formulation that does not require dilution or reagent mixing. • Sensitive: Substrate is as sensitive as other commercially available BCIP/ NBT formulations and reagents. • Stable: Stable for one year at room temperature. Storage Conditions: Store at room temperature, 22–25°C. X-Gal (5-bromo-4-chloro-3-indolyl-β-dgalactopyranoside) Product Size Conc. Cat.# X-Gal 100mg/2 ml 50 mg/ml V3941 For Research Use Only. Not for Use in Diagnostic Procedures. Description: X-Gal, in conjunction with IPTG, is used to detect β-galactosidase activity to differentiate recombinants from nonrecombinants in cloning experiments using vectors containing the lacZ or lacZ α-peptide gene. Features: • Concentration: 50mg/ml in dimethylformamide, 2.0ml/vial. • Quality Tested: X-Gal is tested for use with the pGEM®-Z Vectors in a chromogenicity assay. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 281 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com Nucleic Acids 1.2kb Kanamycin Positive Control RNA Product Size Cat.# 1.2kb Kanamycin Positive Control RNA 1 × 5μg C1381 For Research Use Only. Not for Use in Diagnostic Procedures. Description: 1.2kb Kanamycin Positive Control RNA is supplied in 10mM TrisHCl (pH 7.4), 1mM EDTA. Storage Conditions: Store at –65°C. Genomic DNA Product Size Cat.# Human Genomic DNA: Male 100 μg G1471 Human Genomic DNA: Female 100 μg G1521 Human Genomic DNA 100 μg G3041 Mouse Genomic DNA 100 μg G3091 G1471, G1521, G3041 For Laboratory Use. G3091 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Genomic DNA from selected species are purified, and greater than 90% of the DNA is longer than 50kb in size as measured by pulsedfield gel electrophoresis. The DNA is suitable for Southern blot hybridizations, genomic analysis (including PCR), and genomic library construction. The Mouse Genomic DNA is isolated from whole blood from disease-free mice. Human Genomic DNA comes from multiple anonymous donors. Storage Conditions: Store at 4°C. Herring Sperm DNA Product Size Conc. Cat.# Herring Sperm DNA 10 mg 10 µg/µl D1811 100 mg 10 µg/µl D1815 500 mg 10 µg/µl D1816 For Laboratory Use. Description: Herring Sperm DNA is tested and certified to be free of any DNase or RNase activity. It is useful as a blocking agent in nucleic acid hybridization experiments. Features: • Quality Tested: Certified to be free of any DNase or RNase activity. • Multiple Applications: Use as a blocking agent in hybridizations or as carrier DNA. • Ready to Use: Provided as a 10mg/ml solution. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Note: Product may be viscous at 4°C. Prior to use, ensure product is at room temperature (it may be briefly warmed at 37°C) and mixed thoroughly to ensure homogeneity. Lambda DNA Product Size Cat.# Lambda DNA 250 μg D1501 For Laboratory Use. Description: Lambda DNA cl857 Sam7 is isolated from infected E. coli strain W3350. Restriction enzyme-digested Lambda DNA (48,502bp) may be used as a molecular weight size marker in gel analysis of nucleic acids. Lambda DNA is also a commonly used substrate in restriction enzyme activity assays. The nucleotide sequence has been determined. Features: • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –20°C. Unmethylated Lambda DNA Product Size Cat.# Unmethylated Lambda DNA 250 μg D1521 For Laboratory Use. Description: Unmethylated cl857 Sam7 Lambda DNA (48,502bp) is isolated from infected GM119, an E. coli strain lacking both the dam and dcm methylase activities. Unmethylated Lambda DNA is used as a substrate for restriction enzymes sensitive to DNA methylation. Features: • Unmethylated Substrate: Use as a substrate for methylation-sensitive restriction enzymes. Storage Conditions: Store at –20°C. pBR322 Vector Product Size Conc. Cat.# pBR322 Vector 10 μg 1 µg/µl D1511 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The plasmid pBR322 Vector (4,361bp) carries the genes for tetracycline and ampicillin resistance. pBR322 DNA digests typically are used as molecular weight size markers in gel analysis of nucleic acids. Storage Conditions: Store at –20°C. 0270VA05_2A PvuII 2066 pBR322 Vector (4,361bp) Ampr ori PvuI 3736 ScaI 3846 SphI 566 Tet r EcoRI 4359 HindIII 29 EcoRV 187 BamHI 375 SalI 651 BstZI 939 StyI 1369 PstI 3611 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 282 For complete and up-to-date product information visit: www.promega.com ΦX174, RF DNA Product Size Conc. Cat.# ΦX174, RF DNA 50 μg 1 µg/µl D1531 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The icosahedral bacteriophage ΦX174 replicative form (RF) is a double-stranded circular DNA molecule of 5,386 bases. Restriction enzyme-digested ΦX174 DNA generates molecular weight size markers used in gel analysis of nucleic acids. ΦX174 DNA is often used in the assays of restriction enzymes for the presence of nickase activity. Storage Conditions: Store at –20°C. 0271VA04_1A φX174 (5,386bp) PstI 1 HpaI 28 XhoI 163 MluI 222 DraI 327 AsuI 978 AccI 1193 HpaI 1292 DraI 1406 MluI 2147 SacII 2863 SinI 2782 AccI 3545 StuI 4489 HpaI 5002 AsuI 5042 K562 DNA High Molecular Weight Product Size Cat.# K562 DNA High Molecular Weight 30 μg DD2011 For Research Use Only. Not for Use in Diagnostic Procedures. Description: K562 DNA is purified from a subculture of the human chronic myelogenous leukemia cell line. K562 DNA serves as a control for most steps of the single-locus probe analysis procedure. The DNA also can be used as a reference for determining fragment sizes of VNTR alleles following appropriate restriction digestion. K562 fragment sizes obtained may vary slightly due to interlaboratory differences in protocols and methods of analysis. Concentration: 0.4–1.0μg/μl. Storage Conditions: Store at –20°C. Always avoid multiple freeze-thaw cycles or exposure to frequent temperature changes. These fluctuations can greatly alter product stability. K562 Genomic DNA Product Size Cat.# K562 Genomic DNA 80 μg E4931 For Research Use Only. Not for Use in Diagnostic Procedures. Description: K562 Genomic DNA is purified from the human lymphoma cell line K562 by detergent lysis and proteinase K digestion. K562 Genomic DNA is supplied at a concentration of 400μg/ml in TE buffer (10mM Tris-HCl, 1mM EDTA; final pH 8.0). Storage Conditions: Store at 2–10°C. Transfection Carrier DNA Product Size Conc. Cat.# Transfection Carrier DNA 5 × 20 μg 1 μg/μl E4881 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Transfection Carrier DNA is a plasmid DNA used to reduce the amount of an expression vector or reporter vector in mammalian cell transfection without reducing the overall amount of DNA. Diluting reporter DNA into Transfection Carrier DNA results in lowered expression of the protein of interest, overcoming artifacts due to overexpression. This is especially relevant when strong, constitutive promoters (e.g., CMV) are used. Depending on the application, the ratio of reporter to Transfection Carrier DNA may require optimization. This product is made from pGEM®-3Zf(–) Vector but has been purified using a method that results in low endotoxin carryover, making it more suitable for use in transfecting mammalian cells. Storage Conditions: Store at –30 to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 283 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com Tips and Accessories Gel Drying Film Product Size Cat.# Gel Drying Film, 25.0 × 28cm (50 uses) 100 sheets V7131 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Gel Drying Film is a clear cellulose film used with the Gel Drying Kit. Gel Drying Film is essentially gas-impermeable when dry. Storage Conditions: Store at room temperature. Gel Drying Kit Product Size Cat.# Gel Drying Kit, 17.5 × 20cm capacity 1 kit V7120 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Gel Drying Kit provides a convenient and economical alternative to expensive and sometimes problematic gel dryers and vacuum systems. Both polyacrylamide and agarose gels may be dried using this kit. After electrophoresis, gels are placed between two moistened sheets of clear cellulose film, the sheets are clamped between the frames, and the gels are left to dry overnight. Gels dried in this manner can be viewed easily while drying and, once dry, are protected from damage and can be stored in laboratory notebooks. The Gel Drying Film is essentially gas-impermeable when dry. A set of Gel Drying Frames will accommodate one standard 16 × 16cm polyacrylamide gel, four 7 × 9cm minigels or one 7 × 10cm agarose gel. Features: • Convenient and Cost-Effective: Offers an alternative to gel dryers and vacuum systems. • Flexible: Both polyacrylamide and agarose gels can be dried. • Easy to View: Gels are viewed easily while drying. • Easy to Store: Dried gels are protected from damage and can be stored in laboratory notebooks. • Easy to Use: Dried gels may be scanned densitometrically and also projected using an overhead projector. Storage Conditions: Store at room temperature. Plates Product Size Cat.# Wizard® SV 96 Binding Plates 10 pack A2271 100 pack A2278 Wizard® SV 96 Lysate Clearing Plates 10 pack A2241 100 pack A2248 384-Well Plate, Flat 10 /pk V5291 384-Well Plate, Conical 10 /pk V5311 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Binding Plates, Lysate Clearing Plates and 384-Well Plates (Flat and Conical) are available for nucleic acid purification. The Wizard® SV 96 Binding Plates are used with the Wizard® SV 96 Plasmid DNA Purification System (Cat.# A2250, A2255), Wizard® SV 96 Genomic DNA Purification System (Cat.# A2370, A2371) and Wizard® SV 96 PCR Clean-Up System (Cat.# A9340, A9341, A9342) to isolate DNA, or with the SV 96 Total RNA Isolation System (Cat.# Z3500, Z3505) to isolate RNA. The isolation procedures can be performed manually or on a robotic platform. The Binding Plates are designed for use with the Vac-Man® 96 Vacuum Manifold (Cat.# A2291) or a comparable manifold. The Wizard® SV 96 Lysate Clearing Plates are used with the Wizard® SV 96 Binding Plates (Cat.# A2271, A2278) and the Vac-Man® 96 Vacuum Manifold (Cat.# A2291) for simultaneous lysate clearing and DNA binding in the Wizard® SV 96 (Cat.# A2250, A2255) and Wizard® SV 9600 (Cat.# A2258) Plasmid DNA Purification System protocols. Tubes Product Size Cat.# 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 Microtubes, 1.5ml 1,000/bag V1231 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The 0.5ml PCR Tubes are designed to be used with the Quantus™ Fluorometer and QuantiFluor® Systems. Microtubes, 1.5ml, are intended for use with several nucleic acid purification systems. Storage Conditions: Store 0.5ml PCR Tubes at –30°C to 30°C. Store Microtubes, 1.5ml, at 15–30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 284 For complete and up-to-date product information visit: www.promega.com Promega Barrier Tips Product Size Cat.# Promega 10 Barrier Tips, 960/pk 0.5–10 μl A1491 Promega 10E Barrier Tips, 960/pk 0.5–10 μl A1501 Promega 10F Barrier Tips, 960/pk 0.5–10 μl A1511 Promega 20 Barrier Tips, 960/pk 2–20 μl A1521 Promega 100 Barrier Tips, 960/pk 10–100 μl A1541 Promega 200 Barrier Tips, 960/pk 50–200 μl A1551 Promega 1000 Barrier Tips, 768/pk 100–1,000 μl A1563 Not For Medical Diagnostic Use. Description: Aerosol barrier tips eliminate false signals and contamination caused by aerosols. Scientifically designed and tested, Promega Barrier Tips offer performance and economy when working with amplified nucleic acids (PCR), radioactive isotopes, tissue culture fluids, infectious samples and serological specimens. Promega Barrier Tips are made with an inert ultrahydrophobic HDPE plastic that offers the effectiveness of a self-sealing barrier with the convenience of sample retrieval. In retention tests, Promega Barrier Tips virtually eliminated tip retention and sample holdup. Features: • Sterile: Promega Barrier Tips are presterilized and certified RNase- and DNase-free. Tips are supplied packaged and sealed in covered trays. • Convenient: Designed to fit perfectly on all major brands of pipettor. Storage Conditions: Store at room temperature. Magnetic Stands and Spacers Product Size Cat.# MagnaBot® 384 Magnetic Separation Device 1 each V8241 384-Well Plate, Flat 10 /pk V5291 384-Well Plate, Conical 10 /pk V5311 MagnaBot® 96 Magnetic Separation Device 1 each V8151 MagnaBot® II Magnetic Separation Device 1 each V8351 MagnaBot® Flat Top Magnetic Separation Device 1 each V6041 Plate Clamp 96 1 each V8251 Plate Stand 1 each V8261 Deep Well MagnaBot® 96 Magnetic Separation Device 1 each V3031 Heat Transfer Block 1 each Z3271 Heat Block Insert 1 each Z3651 MagnaBot® Spacer 3/16 inch 1 each V8381 MagnaBot® Spacer 1/8 inch 1 each V8581 MagnaBot® Spacer 1/16 inch 1 each V8681 1/4 inch Foam Spacer 1 each Z3301 MagneSphere® Technology Magnetic Separation Stand (two-position) 0.5 ml Z5331 1.5 ml Z5332 12 × 75 mm Z5333 MagneSphere® Technology Magnetic Separation Stand (twelve-position) 0.5 ml Z5341 1.5 ml Z5342 12 × 75 mm Z5343 PolyATtract® System 1000 Magnetic Separation Stand 1 each Z5410 For Research Use Only. Not for Use in Diagnostic Procedures. MagneSphere® Magnetic Separation Stands Compatible with the PolyATtract® Systems. Stand Cat.# Sample Size Compatible Product 2-Position Stand Z5331 5–10mg PolyATtract® System 1000 Z5332 5–35mg PolyATtract® System 1000 PolyATtract® System III or IV 1 × 106 cells PolyATtract® System 1000 Z5333 35–100mg PolyATtract® System 1000 PolyATtract® System I or II Z5410 0.1–1g or 107 –108 cells PolyATtract® System 1000 12-Position Stand Z5341 5–10mg PolyATtract® System 1000 Z5342 5–35mg or 1 × 106 cells PolyATtract® System 1000 PolyATtract® System III or IV Z5343 35–100mg PolyATtract® System 1000 9488LA Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 285 18Biochemicals and Labware For complete and up-to-date product information visit: www.promega.com Vacuum Manifolds and Accessories Product Size Cat.# Vac-Man® 96 Vacuum Manifold 1 each A2291 Vac-Man® Jr. Laboratory Vacuum Manifold, 2-sample capacity 1 each A7660 Vac-Man® Laboratory Vacuum Manifold, 20-sample capacity 1 each A7231 Available Separately One-Way Luer-Lok® Stopcocks 10 each A7261 Vacuum Adapters 20 each A1331 For Research Use Only. Not for Use in Diagnostic Procedures. Eluator™ Vacuum Elution Device Product Size Cat.# Eluator™ Vacuum Elution Device 4 each A1071 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Eluator™ Vacuum Elution Device is used to elute nucleic acids from PureYield™ Midiprep or Maxiprep columns. It consists of two pieces, a blue base and a clear column assembly. The base interfaces with a Vacuum Manifold that contains Luer-Lok® fittings, such as the Vac-Man® Laboratory Vacuum Manifold (Cat.# A7231), and holds a 1.5ml tube to capture the eluted nucleic acids. The column assembly accepts PureYield™ Midiprep or Maxiprep columns. The Eluator™ Device eliminates the requirement for a centrifuge with a swinging bucket rotor for nucleic acid purification, simplifying and speeding purification protocols. Storage Conditions. Store at 15–30°C. MagnaBot® FLEX 96 Magnetic Separation Device Product Size Cat.# MagnaBot® FLEX 96 Magnetic Separation Device 1 each VA1290 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagnaBot® FLEX 96 Magnetic Separation Device is designed for high-throughput bioseparation using magnetic particles such as MagneSil® Paramagnetic Particles. This method uses the principle of magnetic separation as an alternative to vacuum filtration and centrifugation separation formats. For best results, use a multiwell plate that is free of flashing or support in the interstitial space between every 4 wells, such as 2ml Nunc™ 96-Well Polypropylene DeepWell™ Storage Places (Cat.# AS9307 or Thermo Fisher Cat.# 278743). Features: • Designed for use during automated processing with Maxwell® HT Paramagnetic particles • Compatible with 96-well plates Storage Conditions: Store at 15–30°C. x-tracta™ Gel Extractor Product Size Cat.# x-tracta™ Gel Extractor 25 /pack A2121 100 /pack A2122 Wizard® SV Gel and PCR Clean-Up System and x-tracta™ Gel Extractor Bundle 50 preps/25 extractors A9283 250 preps/100 extractors A9284 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The x-tracta™ Gel Extractor tool provides a convenient, safe method for removal of agarose gel fragments for further processing. The device removes a 0.13 × 0.33 inch gel piece from agarose gels for easy transfer into a microcentrifuge tube for processing. The x-tracta™ tool eliminates the need for razor blades or scalpels, and its single-use design eliminates the possibility for sample-to-sample cross-contamination. Note: The x-tracta™ Gel Extractor works best on 0.6–2% analytical grade agarose gels. Please exercise caution if using the x-tracta™ Gel Extractor on Low Melting Point (LMP) agarose gels because the extractor does not work effectively on these due to the gel consistency. Storage Conditions: Store at 22–25°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Ask A Scientist Our worldwide technical support scientists have extensive lab experience and are available to answer all your questions about Promega products. Contact us via chat, telephone or email: techserv@promega.com Visit us online at: www.promega.com/Support Promega offers best-in-class technical support for scientists. Services Include: • Troubleshooting experiments • Training on Promega technologies • Supporting Promega technologies on automated systems © 2020 Promega Corporation. All Rights Reserved. 287 19 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Lab Automation Maxwell® and Maxprep™ Instruments 288 Large-Volume Nucleic Acid Extraction 294 Lab Automation Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 288 For complete and up-to-date product information visit: www.promega.com Maxwell® and Maxprep™ Instruments Maxwell® RSC 48 Instrument Product Size Cat.# Maxwell® RSC 48 Instrument 1 each AS8500 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® RSC 48 Instrument is a compact, automated nucleic acid purification platform that processes up to 48 samples simultaneously. Using Maxwell® RSC prefilled cartridges, the Maxwell® RSC 48 Instrument brings consistent, reliable purification of DNA or RNA from a variety of sample types. The intuitive graphical interface makes the instrument easy to use. The integrated vision system with its large LED indicator reduces the potential for user error by detecting proper cartridge placement. An integrated Bar Code Reader makes it easy to track samples. Information on the service and support products. Features: • High-quality nucleic acid purification with minimal steps and less hands-on time • Purifies 1–48 samples in a single run • Intuitive software and integrated vision system for detecting and preventing deck tray setup errors Storage Conditions: Store at 15–25°C. Maxprep™ Liquid Handler with the Maxwell® RSC 48 Instrument Product Size Cat.# Maxprep™ Liquid Handler, RSC Carriers 1 each AS9100 Maxprep™ Liquid Handler, RSC Carriers w/ UV Light 1 each AS9101 Maxprep™ Liquid Handler, RSC 48 Carriers 1 each AS9200 Maxprep™ Liquid Handler, RCS 48 Carriers w/UV Light 1 each AS9201 Consumables Available Separately Size Cat.# Nunc 2.0ml Deep Well Plates 60/pack AS9307 Maxprep™ 50µl Conductive Disposable Tips, Filtered 5,760 tips AS9301 Maxprep™ 300µl Conductive Disposable Tips, Filtered 5,760 tips AS9302 Maxprep™ 1000µl Conductive Disposable Tips, Filtered 3,840 tips AS9303 Maxprep™ Reagent Reservoir, 50ml 28/pack AS9304 Maxprep™ Waste Bags, Clear 100/pack AS9305 Accessories Available Separately Size Cat.# Maxprep™ UV Lamp 1 each AS9310 Maxprep™ Carrier, Maxwell RSC 1 each AS9402 Maxprep™ Carrier, Maxwell RSC 48 Front 1 each AS9403 Maxprep™ Carrier, Maxwell RSC 48 Back 1 each AS9404 Maxprep™ Carrier, 12–13mm Sample Tubes 1 each AS9405 Maxprep™ Carrier, 15–17mm Sample Tubes 1 each AS9406 Maxprep™ Carrier, 10mm Sample Tubes 1 each AS9407 Maxprep™ Plunger Holder 1 each AS9408 Maxprep™ 3-Position Reagent Tube Holder 1 each AS9409 Maxprep™ Gripper Paddle 1 each AS9410 Maxprep™ Plunger Tool 1 each AS9411 Maxprep™ Reagent Carrier 1 each AS9412 RSC Plunger Pack 48/pack AS1670 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Our modular nucleic acid preparation solutions let you adapt your laboratory workflow as your needs change. You can combine the Maxprep™ Liquid Handler with the Maxwell® RSC and RSC 48 Instruments for automated sample preparation to create a virtual assembly line in your laboratory. Information on the service and support products. Features: • Automated Maxwell® sample preparation with the Maxprep™ Liquid Handler • Hands-free nucleic acid extraction on the Maxwell® RSC 48 • Post-extraction sample preparation for quantitation, normalization and amplification setup using the Maxprep™ Liquid Handler Storage Conditions: Store at 15–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 289 19Lab Automation For complete and up-to-date product information visit: www.promega.com Maxwell® RSC 48 Qualification Products Product Size Cat.# Installation Qualification 1 each SA1357 Operational Qualification 1 each SA1358 IQ/OQ Package 1 each SA1359 Description: The Maxwell® RSC 48 Installation Qualification and Operational Qualification products offer: • Fixed-cost service products for predictable support expenditures • Factory-trained service specialists ensure consistent and reliable service • Ongoing system documentation for audit tracing and compliance • Comprehensive service and support means minimal instrument downtime Maxwell® RSC 48 Installation Qualification The Installation Qualification service product includes a series of formal instrument checks, delivers written documentation of instrument functionality and demonstrates that everything ordered with the instrument is supplied and installed at the customer’s laboratory. This service product must be delivered by a Promega representative who is certified to perform the Installation Qualification. The service product involves a site visit to perform: • Installation by qualified Promega personnel • Inspection of shipping containers, instrument and accessories • Comparison of items received vs. items on purchase order • Inspection of laboratory conditions (power, etc.) • Review of all hazards and precautions with users • Confirmation/installation of correct firmware version • Testing of instrument run • Recording and documenting installation and actions Maxwell® RSC 48 Operational Qualification The Operational Qualification (OQ) service product demonstrates that the instrument functions according to its operational specifications. This service product must be delivered by a Promega representative who is certified to perform the Operational Qualification. The service product involves a site visit to perform: • Running operational verification tests • Documenting all calibration and test results • Training users to operate the instrument • Training users to use the log book • Completing customer-specific log book and OQ documentation Features: • The Installation Qualification (IQ) includes a series of instrument checks, delivers written documentation of functionality and demonstrates that everything ordered with the instrument is supplied and installed • The Operational Qualification (OQ) service product demonstrates that the instrument functions according to its operational specifications • The IQ/OQ Package combines both services Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 290 For complete and up-to-date product information visit: www.promega.com Maxprep™ Liquid Handler Qualification Products Product Size Cat.# Installation Qualification 1 each SA1397 Operational Qualification 1 each SA1398 IQ/OQ Package 1 each SA1399 Description: These service products must be delivered by a Promega representative who is certified to perform the installation and operational qualification. Maxprep™ Liquid Handler Installation Qualification and Operational Qualification The Maxprep™ Liquid Handler Installation Qualification and Operational Qualification products offer: • Installation by qualified Promega personnel • Fixed-cost service products for predictable support expenditures • Factory-trained service specialists ensure consistent and reliable service • Ongoing system documentation for audit tracing and compliance Maxprep™ Liquid Handler Installation Qualification The Installation Qualification service product includes a series of formal instrument checks, delivers written documentation of instrument functionality and demonstrates that everything ordered with the instrument is supplied and installed at the customer’s laboratory. This service product must be delivered by a Promega representative who is certified to perform the Installation Qualification. The service product involves a site visit to perform: • Installation by qualified Promega personnel • Inspection of shipping containers, instrument and accessories • Comparison of items received vs. items on purchase order • Inspection of laboratory conditions (power, etc.) • Review of all hazards and precautions with users • Confirmation/installation of correct firmware version • Testing of instrument run • Recording and documenting installation and actions Maxprep™ Liquid Handler Operational Qualification The Operational Qualification (OQ) service product demonstrates that the instrument functions according to its operational specifications. This service product must be delivered by a Promega representative who is certified to perform the Operational Qualification. The service product involves a site visit to perform: • Running operational verification tests • Documenting all calibration and test results • Training users to operate the instrument • Training users to use the log book • Completing customer-specific log book and OQ documentation Features: • The Installation Qualification (IQ) includes a series of instrument checks, delivers written documentation of functionality and demonstrates that everything ordered with the instrument is supplied and installed by a certified Promega representative • The Operational Qualification (OQ) service product demonstrates that the instrument functions according to its operational specifications • The IQ/OQ Package combines both services Maxwell® CSC Instrument Product Size Cat.# Maxwell® CSC Instrument 1 each AS6000 Available Separately RSC/CSC Deck Tray 1 each SP6019 RSC/CSC Plungers 50/pack AS1331 AS6000 For In Vitro Diagnostic Use. This product is only available in certain countries. SP6019, AS1331 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® Clinical Sample Concentrator (CSC) Instrument provides automated nucleic acid purification for a range of clinical sample types. The purification methods use sample lysis and binding to paramagnetic particles as the primary separation principle. Up to 16 samples can be prepared in a single run. Features:Performance • Reduce Errors: Minimal steps with automation. • Get Results Faster: DNA from blood with 38-minute processing time. • Reduce Repeat Testing: High-purity, high-concentration nucleic acid from blood. • Eliminate Contamination: Particle processing technology combined with UV light for sanitization. • Spend Less Money: Less expensive in terms of instrument and per prep price. • Do More with Less Space: Small footprint. Software • Simple Sample Tracking and Document Control: Integrated bar code reader. • Easy to Use: Controlled via Windows® 10 on tablet with touch screen interface. • Advanced Administrator Options. • Update Method Easily: Improved functionality for new method import. Regulatory • Simplify Validation and Improve Reliability: QSR-manufactured, CSC-labeled (including software). • Be Prepared for Audits: Design master file. • Count on World-Class Service and Support to Ensure Minimal Instrument Downtime: IQ/OQ service options. Storage Conditions: Store at 15–30°C. 10762TA Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 291 19Lab Automation For complete and up-to-date product information visit: www.promega.com Maxwell® CSC Service and Support Products Product Size Cat.# Maxwell® CSC Standard Service Agreement 1 each SA1110 Maxwell® CSC Premier Service Agreement 1 each SA1120 Maxwell® CSC Preventive Maintenance 1 each SA1130 Maxwell® CSC Installation Qualification 1 each SA1140 Maxwell® CSC Operational Qualification 1 each SA1150 Maxwell® CSC IQ/OQ Combination Package 1 each SA1160 This product is only available in certain countries. Description: Upon purchase of the Maxwell® CSC Instrument, the instrument will be covered by a one-year Premier Warranty. The Premier Warranty covers all parts, labor and shipping to and from our depot repair location (including a loaner instrument arriving at your lab within 1 working day) or onsite repair by a factory-trained service technician arriving within 2 business days. We will repair your instrument and return it to you performing to original factory specifications. The Premier Warranty also includes one preventive maintenance visit. Once the initial one-year warranty has expired, there are several options for continuing service coverage: Maxwell® CSC Standard Service Agreement (SA1110): The Standard Service Agreement covers all parts, labor and shipping to and from our depot repair location as well as a loaner instrument upon request. If your Maxwell® CSC Instrument needs repair, we will provide a box for shipment of the instrument back to our service facility. We will repair it and return it performing to original factory specifications. Preventive maintenance visits are available separately. Maxwell® CSC Premier Service Agreement (SA1120): The Premier Service Agreement includes all parts, labor and shipping to and from our depot repair location (including a loaner instrument arriving at your lab within 1 working day) or an onsite service visit by a factory-trained service technician within 2 business days. Additionally, it includes one annual preventive maintenance visit per year. Additional preventive maintenance visits are available separately. Maxwell® CSC Preventive Maintenance (SA1130): In order to keep the system operation at peak performance, Promega recommends that Maxwell® CSC Instruments receive a Preventive Maintenance check after 12 months of use. During this procedure, our qualified service personnel test the instrument, check consumable parts for wear and replace them as needed. Additionally, the system is aligned and performance is verified. Documentation for your files is provided. The preventive maintenance service is performed by returning the instrument to an authorized service center. Onsite service is available for an additional charge. Maxwell® CSC Installation Qualification and Operational Qualification (Cat.# SA1140, SA1150, SA1160) The Installation Qualification service product includes a series of formal instrument checks, delivers written documentation of instrument functionality and demonstrates that everything ordered with the instrument is supplied and installed at the customer’s laboratory. This service product must be delivered by a Promega representative who is certified to perform the Installation Qualification. The service product involves a site visit to perform: • installation by qualified Promega personnel • inspection of shipping containers, instrument and accessories • comparison of items received against items on the purchase order • inspection of laboratory conditions (power, etc.) • review of all hazards and precautions with users • confirmation/installation of correct software version • instrument test run • documentation of Installation Qualification. The Operational Qualification service product demonstrates that the instrument functions according to its operational specifications. This service product must be delivered by a Promega representative who is certified to perform the Operational Qualification. The service product involves a site visit to: • run operational verification tests • document all calibration and test results • train customer(s) to operate the instrument • train customer(s) to use the log book • complete Operation Qualification documentation. Features: • Fixed-Cost Service Products: Predictable support expenditures. • Factory-Trained Service Specialists: Consistent and reliable service. • Ongoing System Documentation: Audit tracing and compliance. • Comprehensive Service and Support: Minimal instrument downtime. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 292 For complete and up-to-date product information visit: www.promega.com Maxwell® FSC Instrument Product Size Cat.# Maxwell® FSC Instrument 1 each AS4600 Maxwell® FSC Deck Tray 1 each AS4016 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® FSC Instrument, along with DNA IQ™ chemistry, offers easy-to-use, consistent, automated nucleic acid extraction from casework samples such as blood stains, semen stains, hairs, cigarette butts, tissues and trace DNA samples. Automated DNA extraction saves laboratories time and labor costs and frees staff to work on casework analysis. Features: • High-quality DNA extraction with minimal hands-on time. • Bar code reader for simplified data entry. • Intuitive software and touch screen interface. Storage Conditions: Store at 15–30°C. Maxwell® RSC Instrument Product Size Cat.# Maxwell® RSC Instrument 1 each AS4500 Available Separately RSC/CSC Deck Tray 1 each SP6019 Maxwell® Instrument Bar Code Reader 1 each AS3200 AS4500, SP6019, AS3200 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® Rapid Sample Concentrator (RSC) Instrument is a platform for automated purification of nucleic acid from a range of sample types. The purification methods use sample lysis and binding to paramagnetic particles as the primary separation principle. Up to 16 samples can be prepared simultaneously in 25–60 minutes, depending on sample type. The Maxwell® RSC Instrument is controlled by a graphical user interface running on a tablet PC. The instrument is supplied with a Quantus™ Fluorometer and integrated software that allows extracted nucleic acid quantification measurements to be captured in the run report along with sample tracking and method run data. Features: • Easy to Use: Intuitive software and simple validation; very little hands-on time. • Automation: Get to results faster with minimal steps and lower costs. • Quantus™ Fluorometer Integration: Quickly capture extracted nucleic acid concentration values in the run report. • Flexible and Efficient Workflow: Access sample at any point in workflow; consistent performance eliminates reruns. • Technology: Magnetic particles enhance concentration, minimize contamination and provide highly pure and amplifiable nucleic acid ready for downstream analysis. • Small Footprint: Do more in less space. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 293 19Lab Automation For complete and up-to-date product information visit: www.promega.com Maxwell® RSC Service and Support Products Product Size Cat.# Maxwell® RSC Premier Warranty Upgrade 1 each SA1341 Maxwell® RSC Standard Service Agreement 1 each SA1342 Maxwell® RSC Premier Service Agreement 1 each SA1343 Maxwell® RSC Preventive Maintenance 1 each SA1346 Maxwell® RSC Installation Qualification 1 each SA1347 Maxwell® RSC Operational Qualification 1 each SA1348 Maxwell® RSC IQ/OQ Combination Package 1 each SA1349 Description: Upon purchase of the Maxwell® RSC Instrument, the instrument will be covered by a one-year Standard Warranty. The Standard Warranty covers all parts, labor and shipping to and from our depot repair location as well as a loaner instrument upon request. If your Maxwell® RSC Instrument needs repair, we will provide a box for shipment of the instrument back to our service facility. We will repair it and return it performing to original factory specifications. Preventive Maintenance visits are available separately. If you need additional coverage during the one-year Standard Warranty period, a Premier Warranty Upgrade is available. The Maxwell® RSC Premier Warranty Upgrade (Cat.# SA1341) includes all parts, labor and shipping to and from our depot repair location as well as your choice of a loaner instrument within 1 business day* or on-site service visit by a factory-trained service technician within 2 business days*. Additionally, it includes one annual Preventive Maintenance visit per year, which can be performed by returning the instrument to an authorized service center or by an on-site visit by a service technician. Additional Preventive Maintenance visits are available separately. *Where available. Once the initial one-year Standard Warranty has expired, there are several options for continuing service coverage: Maxwell® RSC Standard Service Agreement (Cat.# SA1342), covers all parts, labor and shipping to and from our depot repair location as well as a loaner instrument upon request. If your Maxwell® RSC Instrument needs repair, we will provide a box for shipment of the instrument back to our service facility. We will repair it and return it performing to original factory specifications. Preventive Maintenance visits are available separately. Maxwell® RSC Premier Service Agreement (Cat.# SA1343), includes all parts, labor and shipping to and from our depot repair location as well as your choice of a loaner instrument within 1 business day* or on-site service visit by a factory-trained service technician within 2 business days*. Additionally, it includes one annual Preventive Maintenance visit per year, which can be performed by returning the instrument to an authorized service center or by an on-site visit by a service technician. Additional Preventive Maintenance visits are available separately. *Where available. Maxwell® RSC Preventive Maintenance (Cat.# SA1346): In order to keep the system operating at peak performance, we recommend that Maxwell® RSC Instruments receive a Preventive Maintenance check after 12 months of use. During this procedure, our qualified service personnel test the instrument, check parts for wear and replace them as needed. Additionally, the system is aligned and performance is verified. Documentation for your files is provided. The preventive maintenance service is performed by returning the instrument to an authorized service center. Maxwell® RSC Installation Qualification and Operational Qualification Products, Cat.# SA1347, SA1348, SA1349 The Installation Qualification service product includes a series of formal instrument checks, delivers written documentation of instrument functionality and demonstrates that everything ordered with the instrument is supplied and installed at the customer’s laboratory. This service product must be delivered by a Promega representative who is certified to perform the Installation Qualification. The service product involves a site visit to perform: • Installation by qualified Promega personnel • Inspection of shipping containers, instrument and accessories • Comparison of items received vs. items on purchase order • Inspection of laboratory conditions (power, etc.) • Review all hazards and precautions with users • Confirmation/installation of correct firmware version • Testing of instrument run • Recording and documenting installation and actions The Operational Qualification (OQ) service product demonstrates that the instrument functions according to its operational specifications. This service product must be delivered by a Promega representative who is certified to perform the Operational Qualification. The service product involves a site visit to perform: • Running operational verification tests • Documenting all calibration and test results • Training user to operate the instrument • Trainings users to use the log book • Completing customer-specific log book, instrument sticker and OQ documentation Features: • Fixed-Cost Service Products: Predictable support expenditures. • Factory-Trained Service Specialists: Consistent and reliable service. • Ongoing System Documentation: Audit tracing and compliance. • Comprehensive Service and Support: Minimal instrument downtime. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 294 For complete and up-to-date product information visit: www.promega.com Large Volume Nucleic Acid Extraction HSM 2.0 Instrument Product Size Cat.# HSM 2.0 Instrument 1 each A2715 Available Separately HSM 2.0 Instrument Cover 1 each A2712 HSM 2.0 Tube Rack 1 each A2713 HSM 2.0 Tube Rack Stand 1 each A2714 HSM 2.0 Instrument 1-Year Service Agreement 1 each SA1330 ReliaPrep™ LV 32 HSM Standard Service Agreement 1 each SA3070 A2712, A2715, A2713, A2714, SA3070 For Research Use Only. Not for Use in Diagnostic Procedures. Products may not be available in all countries. Please contact your local representative for more information. Description: The Heater Shaker Magnet Instrument (HSM 2.0) is designed to perform all of the functions necessary for processing magnetic resin-based purification chemistries in large-volume formats. With its ability to heat, shake and apply a magnetic field, the HSM 2.0 Instrument provides all-in-one processing capabilities for a variety of large-volume purification chemistries in either a manual or automated format. The instrument uses standard 50ml conical tubes, magnets and reagent-based paramagnetic particles (PMPs). The PMPs provide a mobile solid phase that optimizes capture, washing and elution of biological target molecules. 11277TA Power Supply, HSM 2.0 Instrument and Tube Rack on Tube Rack Stand (from left to right). Initially designed to run the ReliaPrep™ Large Volume HT gDNA Isolation System (Cat.# A2751), the HSM 2.0 Instrument is supplied with software containing preprogrammed isolation methods for processing up to 32 samples of human whole blood in approximately 2–3.5 hours, depending on sample volume and number. Samples are processed in a semi-automated method with the user dispensing and aspirating reagents from the samples as directed by the software on a computer screen. The programmed methods control the heating, shaking, magnetization and timing of the steps required for the semi-automated purification. For fully automated purification, the HSM 2.0 Instrument can be integrated with a robotic liquid-handling workstation, which can process 32 samples in less than 4.5 hours. Minimum Software Computer Requirements: Windows® PC Dual-Core x86-based processor, 2MB Memory, 100GB HD, Video 1024 × 768 Microsoft Windows® 7 Professional and Ultimate editions (32-bit or 64-bit) Use of up-to-date antivirus software is strongly recommended. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 295 20 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Plate Readers, Fluorometers and Luminometers Microplate Readers 296 Fluorometers 297 Luminometers 298 Plate Readers, Fluorometers and Luminometers Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 296 For complete and up-to-date product information visit: www.promega.com Microplate Readers GloMax® Discover System Product Size Cat.# GloMax® Discover System 1 each GM3000 Available Separately Light Plate, ABS/Fluor 1 each E6532 GloMax® Dual Injectors with Pumps 1 each GM3030 GloMax® Discover Luminescence Filter Paddle 1 each GM3011 GloMax® Discover Fluorescence Filter Paddle 1 each GM3012 GloMax® Discover or Explorer Installation Qualification 1 each SA1104 GloMax® Discover or Explorer Operational Qualification 1 each SA1105 GloMax® Discover or Explorer Installation and Operational Qualification 1 each SA1106 GloMax® Discover or Explorer Instrument Rental, 1 month 1 each SA1098 GloMax® Discover Standard Service Agreement 1 each SA4000 GloMax® Discover or Explorer Preventive Maintenance 1 each SA4030 GloMax® Discover 96 Half-Position Aperture Assembly 1 each GM1050 E6532, GM3000, GM3030, GM3011, GM3012, GM1050 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® Discover System is a high-performance multimode detection instrument developed with Promega reagent chemistries to provide a simple means of detecting advanced chemistries. This instrument provides superior luminescence sensitivity and dynamic range for both strong and weak bioluminescence experimental samples, as well as a seamless integration with Promega bioluminescent assays. GloMax® Discover also provides flexible use of filters for fluorescence intensity, BRET, FRET, filtered luminescence and UVvisible absorbance measurements. The instrument is operated by an integrated Tablet PC, which provides quick and easy navigation through the control options. Exporting your results is made seamless with a variety of options, including exporting to your local data network. The GloMax® Discover software will provide many of the required technical elements of a part 11 compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Features: • Full Range Capabilities: Luminescence, fluorescence, BRET, FRET, and UV-visible absorbance detection. • Integrated with Promega Assays: Developed and optimized with Promega cell and gene reporter assays for seamless workflow; you will be up and running faster. • Easy-to-Use: Simple Tablet PC touch screen navigation with full PC capabilities and a state-of-the-art graphical user interface. • Superior Performance: Broader dynamic range, better sensitivity and lower well-to-well cross talk for more usable data from your experiment. • Connected to Your Workflow: Use as a standalone instrument or integrate into your high-throughput automated workflow; export data to your laboratory network. GloMax® Discover and GloMax® Explorer Systems. GloMax® Explorer System Product Size Cat.# GloMax® Explorer Fully Loaded Model 1 each GM3500 GloMax® Explorer with Luminescence and Fluorescence 1 each GM3510 Available Separately GloMax® Explorer Absorbance Module Upgrade 1 each GM3520 Light Plate, ABS/Fluor 1 each E6532 GloMax® Dual Injectors with Pumps 1 each GM3030 GloMax® Discover Fluorescence Filter Paddle 1 each GM3012 GloMax® Discover or Explorer Installation Qualification 1 each SA1104 GloMax® Discover or Explorer Operational Qualification 1 each SA1105 GloMax® Discover or Explorer Installation and Operational Qualification 1 each SA1106 GloMax® Explorer Standard Service Agreement 1 each SA1107 GloMax® Discover or Explorer Instrument Rental, 1 month 1 each SA1098 GloMax® Discover Standard Service Agreement 1 each SA4000 GloMax® Discover or Explorer Preventive Maintenance 1 each SA4030 GloMax® Discover 96 Half-Position Aperture Assembly 1 each GM1050 GM3500, GM3510, E6532, GM3030, GM3012, GM1050 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® Explorer System is a high-performance multimode detection instrument developed with Promega reagents to provide a simple means of detecting advanced chemistries. This instrument provides superior luminescence sensitivity and dynamic range for both strong and weak bioluminescence experimental samples as well as seamless integration with Promega bioluminescence assays. GloMax® Explorer measures luminescence, fluorescence intensity and visible absorbance. The instrument is operated by an integrated tablet PC, which provides quick and easy navigation through the control options. Exporting your results is easy with a variety of options, including export to your local data network. The GloMax® Explorer software provides many of the required technical elements of a part 11-compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Features: • Flexible Configuration Options: Luminescence, fluorescence and UVvisible absorbance detection. • Integrated with Promega Assays: Developed and optimized with Promega cell and gene reporter assays for seamless workflow; you will be up and running faster. • Easy to Use: Simple tablet PC touch screen navigation with full PC capabilities and state-of-the-art graphical user interface. • Superior Performance: Broader dynamic range, better sensitivity and lower well-to-well cross talk for more usable data from your experiment. • Connect to Your Workflow: Use as a standalone instrument or integrate into your high-throughput automated workflow. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 297 20Plate Readers, Fluorometers and Luminometers For complete and up-to-date product information visit: www.promega.com GloMax® Navigator System Product Size Cat.# GloMax® Navigator System 1 each GM2000 GloMax® Navigator System with Dual Injectors and Pumps 1 each GM2010 Available Separately Size Cat.# GloMax® Navigator Standard Service Agreement 1 each SA1301 Dual Injector Pump Station Upgrade for GloMax® Navigator 1 each SA1304 GloMax® Navigator Installation Qualification 1 each SA1305 GloMax® Navigator Operational Qualification 1 each SA1306 GloMax® Navigator Installation and Operational Qualification 1 each SA1307 GloMax® Navigator Preventive Maintenance 1 each SA1308 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® Navigator System is an easy-to-use microplate luminometer integrated with Promega chemistries for superior assay performance. The system provides researchers superior luminescence sensitivity and dynamic range for both strong and weak bioluminescence experimental samples as well as seamless integration with Promega industryleading bioluminescent gene reporter, cell-based and biochemical assays. GloMax® Navigator is operated by an integrated Tablet PC, which provides quick and easy navigation through the control options. Exporting your results is easy with a variety of options, including exporting to your local data network, USB flash drive and cloud-based storage locations. The GloMax® Navigator software provides many of the required technical elements of a part 11-compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Features: • Get Up and Running Faster with Integrated Promega Assays: Developed and optimized with Promega cell and gene reporter assays for seamless workflow. • Enjoy Ease of Use: Simple tablet PC touch screen navigation with full PC capabilities and state-of-the-art graphical user interface. • Experience Superior Performance: Broader dynamic range, better sensitivity and lower well-to-well cross talk for more usable data from your experiment. • Spend Less Time Optimizing. • Export Data to your Laboratory Network: The software provides many of the required technical elements of a part 11-compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Storage Conditions: Store at 4–50°C under noncondensing conditions and up to 75% humidity. Fluorometers Quantus™ Fluorometer Product Size Cat.# Quantus™ Fluorometer 1 each E6150 Available Separately 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 Quantus™ Instrument Standard Service Agreement 1 each SA4040 E4941, E6150, E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Quantus™ Fluorometer is a dual-channel fluorometer for your personal quantitation workflow. Designed to provide highly sensitive fluorescent detection when quantifying nucleic acids, the compact instrument is simple to operate. The Quantus™ Fluorometer is optimized with preprogrammed settings for Promega QuantiFluor® Dye Systems (QuantiFluor® dsDNA, RNA and ssDNA Systems) for nucleic acid quantitation, and allows users the flexibility to create their own methods and quantitation settings for other dyes. The Quantus™ Fluorometer is equipped with two fluorescence channels for nucleic acid and protein quantitation: • Blue fluorescence channel: Excitation 495nm shortpass (wavelengths up to 495nm), emission 510–580nm. • Red fluorescence channel: Excitation 640nm shortpass (wavelengths up to 640nm), emission 660–720nm. Features: • High Performance: Integrated with QuantiFluor® Dyes for high sensitivity, broad dynamic range and target specificity. Great for low-level sample quantitation such as FFPE or viral samples. • Increased Sensitivity: Significantly increased sensitivity over absorbance at 260nm (NanoDrop® spectrophotometer) for those samples that are low in concentration. Ten times more sensitive than Qubit® 2.0 and a detection limit of 50pg/ml, compared to 500pg/ml for the Qubit® 2.0. With a customized low standard curve, lower amounts can be detected. • Easy-to-Use Workflow and Navigation: Flexible with custom protocols and user-defined settings. PC software for data management workflow. • Affordable Price: Cost-effective to easily incorporate into your laboratory. • Recommended for Next-Gen Sequencing: Successfully used in several Next-Gen Sequencing systems, including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. 11749TA-sm Quantus™ Fluorometer. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 298 For complete and up-to-date product information visit: www.promega.com Quantus™ NGS Starter Package Product Size Cat.# Quantus™ NGS Starter Package 1 each E5150 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Quantus™ NGS Starter Package provides you with highly sensitive and easy-to-use DNA quantitation for your NGS applications all in one discounted bundle. Contents include a Quantus™ Fluorometer (Cat.# E6150); QuantiFluor® ONE dsDNA System (Cat.# E4870) and enough 0.5ml assay tubes for 500 reactions. The Quantus™ Fluorometer is a compact and easy-to-operate instrument designed for highly sensitive fluorescent detection of nucleic acids. The Quantus™ Fluorometer is optimized with preprogrammed settings for Promega QuantiFluor® Dye Systems (QuantiFluor® dsDNA, RNA, ssDNA Systems) for nucleic acid quantitation and allows you the flexibility to create your own methods and quantitation settings for other dyes. The QuantiFluor® ONE dsDNA System provides a fluorescent double-stranded DNA-binding dye in an “add-and-read” format for both dye and standard, simplifying DNA quantitation and speeding up your workflow. It’s as easy to use as NanoDrop® absorbance-based methods but much more sensitive for low-concentration samples. Features: • Integrated Instrumentation and Assay: The QuantiFluor® dyes are optimized for high sensitivity, broad dynamic range and target specificity on the Quantus™ Fluorometer. • Simple Measurement: Add-and-read format makes measuring low concentrations of dsDNA simple—no dilutions, no extra tubes. • Increased Sensitivity: Significantly increased sensitivity over absorbance at 260nm for low-concentration samples. • High Specificity to dsDNA: Minimal binding to ssDNA, RNA, protein and interfering compounds. • Affordable Price: Cost-effective to easily incorporate into your laboratory. • Recommended for Next-Gen Sequencing: Successfully used in several NGS systems including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. Storage Conditions: Store QuantiFluor® ONE dsDNA Dye and QuantiFluor® ONE Lambda DNA at –30°C to +10°C. Store 1X TE Buffer at –30°C to +30°C. Luminometers GloMax® Discover System Product Size Cat.# GloMax® Discover System 1 each GM3000 Available Separately Light Plate, ABS/Fluor 1 each E6532 GloMax® Dual Injectors with Pumps 1 each GM3030 GloMax® Discover Luminescence Filter Paddle 1 each GM3011 GloMax® Discover Fluorescence Filter Paddle 1 each GM3012 GloMax® Discover or Explorer Installation Qualification 1 each SA1104 GloMax® Discover or Explorer Operational Qualification 1 each SA1105 GloMax® Discover or Explorer Installation and Operational Qualification 1 each SA1106 GloMax® Discover or Explorer Instrument Rental, 1 month 1 each SA1098 GloMax® Discover Standard Service Agreement 1 each SA4000 GloMax® Discover or Explorer Preventive Maintenance 1 each SA4030 GloMax® Discover 96 Half-Position Aperture Assembly 1 each GM1050 E6532, GM3000, GM3030, GM3011, GM3012, GM1050 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® Discover System is a high-performance multimode detection instrument developed with Promega reagent chemistries to provide a simple means of detecting advanced chemistries. This instrument provides superior luminescence sensitivity and dynamic range for both strong and weak bioluminescence experimental samples, as well as a seamless integration with Promega bioluminescent assays. GloMax® Discover also provides flexible use of filters for fluorescence intensity, BRET, FRET, filtered luminescence and UVvisible absorbance measurements. The instrument is operated by an integrated Tablet PC, which provides quick and easy navigation through the control options. Exporting your results is made seamless with a variety of options, including exporting to your local data network. The GloMax® Discover software will provide many of the required technical elements of a part 11 compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Features: • Full Range Capabilities: Luminescence, fluorescence, BRET, FRET, and UV-visible absorbance detection. • Integrated with Promega Assays: Developed and optimized with Promega cell and gene reporter assays for seamless workflow; you will be up and running faster. • Easy-to-Use: Simple Tablet PC touch screen navigation with full PC capabilities and a state-of-the-art graphical user interface. • Superior Performance: Broader dynamic range, better sensitivity and lower well-to-well cross talk for more usable data from your experiment. • Connected to Your Workflow: Use as a standalone instrument or integrate into your high-throughput automated workflow; export data to your laboratory network. GloMax® Discover and GloMax® Explorer Systems. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 299 20Plate Readers, Fluorometers and Luminometers For complete and up-to-date product information visit: www.promega.com GloMax® Explorer System Product Size Cat.# GloMax® Explorer Fully Loaded Model 1 each GM3500 GloMax® Explorer with Luminescence and Fluorescence 1 each GM3510 Available Separately GloMax® Explorer Absorbance Module Upgrade 1 each GM3520 Light Plate, ABS/Fluor 1 each E6532 GloMax® Dual Injectors with Pumps 1 each GM3030 GloMax® Discover Fluorescence Filter Paddle 1 each GM3012 GloMax® Discover or Explorer Installation Qualification 1 each SA1104 GloMax® Discover or Explorer Operational Qualification 1 each SA1105 GloMax® Discover or Explorer Installation and Operational Qualification 1 each SA1106 GloMax® Explorer Standard Service Agreement 1 each SA1107 GloMax® Discover or Explorer Instrument Rental, 1 month 1 each SA1098 GloMax® Discover Standard Service Agreement 1 each SA4000 GloMax® Discover or Explorer Preventive Maintenance 1 each SA4030 GloMax® Discover 96 Half-Position Aperture Assembly 1 each GM1050 GM3500, GM3510, E6532, GM3030, GM3012, GM1050 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® Explorer System is a high-performance multimode detection instrument developed with Promega reagents to provide a simple means of detecting advanced chemistries. This instrument provides superior luminescence sensitivity and dynamic range for both strong and weak bioluminescence experimental samples as well as seamless integration with Promega bioluminescence assays. GloMax® Explorer measures luminescence, fluorescence intensity and visible absorbance. The instrument is operated by an integrated tablet PC, which provides quick and easy navigation through the control options. Exporting your results is easy with a variety of options, including export to your local data network. The GloMax® Explorer software provides many of the required technical elements of a part 11-compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Features: • Flexible Configuration Options: Luminescence, fluorescence and UVvisible absorbance detection. • Integrated with Promega Assays: Developed and optimized with Promega cell and gene reporter assays for seamless workflow; you will be up and running faster. • Easy to Use: Simple tablet PC touch screen navigation with full PC capabilities and state-of-the-art graphical user interface. • Superior Performance: Broader dynamic range, better sensitivity and lower well-to-well cross talk for more usable data from your experiment. • Connect to Your Workflow: Use as a standalone instrument or integrate into your high-throughput automated workflow. GloMax® Navigator System Product Size Cat.# GloMax® Navigator System 1 each GM2000 GloMax® Navigator System with Dual Injectors and Pumps 1 each GM2010 Available Separately Size Cat.# GloMax® Navigator Standard Service Agreement 1 each SA1301 Dual Injector Pump Station Upgrade for GloMax® Navigator 1 each SA1304 GloMax® Navigator Installation Qualification 1 each SA1305 GloMax® Navigator Operational Qualification 1 each SA1306 GloMax® Navigator Installation and Operational Qualification 1 each SA1307 GloMax® Navigator Preventive Maintenance 1 each SA1308 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® Navigator System is an easy-to-use microplate luminometer integrated with Promega chemistries for superior assay performance. The system provides researchers superior luminescence sensitivity and dynamic range for both strong and weak bioluminescence experimental samples as well as seamless integration with Promega industryleading bioluminescent gene reporter, cell-based and biochemical assays. GloMax® Navigator is operated by an integrated Tablet PC, which provides quick and easy navigation through the control options. Exporting your results is easy with a variety of options, including exporting to your local data network, USB flash drive and cloud-based storage locations. The GloMax® Navigator software provides many of the required technical elements of a part 11-compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Features: • Get Up and Running Faster with Integrated Promega Assays: Developed and optimized with Promega cell and gene reporter assays for seamless workflow. • Enjoy Ease of Use: Simple tablet PC touch screen navigation with full PC capabilities and state-of-the-art graphical user interface. • Experience Superior Performance: Broader dynamic range, better sensitivity and lower well-to-well cross talk for more usable data from your experiment. • Spend Less Time Optimizing. • Export Data to your Laboratory Network: The software provides many of the required technical elements of a part 11-compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Storage Conditions: Store at 4–50°C under noncondensing conditions and up to 75% humidity. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 300 For complete and up-to-date product information visit: www.promega.com GloMax® 20/20 Luminometer Product Size Cat.# GloMax® 20/20 Luminometer 1 each E5311 GloMax® 20/20 Luminometer w/Single Auto-Injector 1 each E5321 GloMax® 20/20 Luminometer w/Dual Auto-Injector 1 each E5331 Available Separately GloMax® 20/20 Light Standard 1 each E5341 GloMax® 20/20 Fluorescent Module, UV 1 each E5351 GloMax® 20/20 Fluorescent Module, Blue 1 each E5361 Thermal Printer Paper 1 each E2851 GloMax® 20/20 Test Tube Holder (1.5ml Microcentrifuge Tubes) 1 each E5371 GloMax® 20/20 Replacement Tubing (2), Valves (4), Tips (30) 1 each E4851 GloMax® 20/20 Replacement Valves 4 sets E5391 GloMax® 20/20 Replacement Power Supply 1 each E5411 Thermal Serial Printer and Universal Power Cable 1 each E2821 GloMax® 20/20 Base Instrument Service Agreement 1 each SA3000 GloMax® Injectors Service Agreement, 1 year 1 each SA3040 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® 20/20 Luminometer is an ultrasensitive, versatile and affordable luminometer designed for use with any Promega bioluminescent assay. The touch screen interface provides comprehensive instrument control and data collection. Optional modules for fluorescence detection provide additional flexibility. The option of an internal auto-injection system is an added convenience and meets the demands of the Dual-Luciferase® Assay. Software setup wizards guide the user through a brief process when establishing new protocols. New users can set up protocols and operate the instrument without a steep learning curve. Promega protocols are preloaded in the software to help users get started. The user can quickly select the protocol of interest and begin running assays directly to an Excel® spreadsheet, where data can be analyzed quickly and easily. Features: • Ultrasensitivity: Quantitate low-level luminescence samples with confidence. • Wide Dynamic Range: Measure both dim and bright samples without sample dilution. • Easy Protocol Setup: Promega protocols are preloaded for easy implementation. • Accessible Injector System: Completely visible plumbing allows inspection of tubing and tips. • Touch Screen Interface: Simple to operate. • Convenient Data Handling: Record data to a printer in real-time or export data to Excel®. • Flexibility: Options available for up to two auto-injectors to meet your experimental needs. 5552TA GloMax® 20/20 Luminometer. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 301 21 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Clinical Laboratory Products Purification 302 Quantification 308 Amplification 312 Clinical Laboratory Products Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 302 For complete and up-to-date product information visit: www.promega.com Maxwell® CSC Instrument Product Size Cat.# Maxwell® CSC Instrument 1 each AS6000 Available Separately RSC/CSC Plungers 50/pack AS1331 RSC/CSC Deck Tray 1 each SP6019 AS6000 For In Vitro Diagnostic Use. This product is only available in certain countries. SP6019, AS1331 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® Clinical Sample Concentrator (CSC) Instrument provides automated nucleic acid purification for a range of clinical sample types. The purification methods use sample lysis and binding to paramagnetic particles as the primary separation principle. Up to 16 samples can be prepared in a single run. Features:Performance • Reduce Errors: Minimal steps with automation. • Get Results Faster: DNA from blood with 38-minute processing time. • Reduce Repeat Testing: High-purity, high-concentration nucleic acid from blood. • Eliminate Contamination: Particle processing technology combined with UV light for sanitization. • Spend Less Money: Less expensive in terms of instrument and per prep price. • Do More with Less Space: Small footprint. Software • Simple Sample Tracking and Document Control: Integrated bar code reader. • Easy to Use: Controlled via Windows® 10 on tablet with touch screen interface. • Benefit from Advanced Administrator Options. • Update Method Easily: Improved functionality for new method import. Regulatory • Simplify Validation and Improve Reliability: QSR-manufactured, CSC-labeled (including software). • Be Prepared for Audits: Design master file. • Count on World-Class Service and Support to Ensure Minimal Instrument Downtime: IQ/OQ service options. Maxwell® CSC Service and Support Products Product Size Cat.# Maxwell® CSC Standard Service Agreement 1 each SA1110 Maxwell® CSC Premier Service Agreement 1 each SA1120 Maxwell® CSC Preventive Maintenance 1 each SA1130 Maxwell® CSC Installation Qualification 1 each SA1140 Maxwell® CSC Operational Qualification 1 each SA1150 Maxwell® CSC IQ/OQ Combination Package 1 each SA1160 This product is only available in certain countries. Description: Upon purchase of the Maxwell® CSC Instrument, the instrument will be covered by a one-year Premier Warranty. The Premier Warranty covers all parts, labor and shipping to and from our depot repair location (including a loaner instrument arriving at your lab within 1 working day) or onsite repair by a factory-trained service technician arriving within 2 business days. We will repair your instrument and return it to you performing to original factory specifications. The Premier Warranty also includes one preventive maintenance visit. Once the initial one-year warranty has expired, there are several options for continuing service coverage: Maxwell® CSC Standard Service Agreement (SA1110): The Standard Service Agreement covers all parts, labor and shipping to and from our depot repair location as well as a loaner instrument upon request. If your Maxwell® CSC Instrument needs repair, we will provide a box for shipment of the instrument back to our service facility. We will repair it and return it performing to original factory specifications. Preventive maintenance visits are available separately. Maxwell® CSC Premier Service Agreement (SA1120): The Premier Service Agreement includes all parts, labor and shipping to and from our depot repair location (including a loaner instrument arriving at your lab within 1 working day) or an onsite service visit by a factory-trained service technician within 2 business days. Additionally, it includes one annual preventive maintenance visit per year. Additional preventive maintenance visits are available separately. Maxwell® CSC Preventive Maintenance (SA1130): In order to keep the system operation at peak performance, Promega recommends that Maxwell® CSC Instruments receive a Preventive Maintenance check after 12 months of use. During this procedure, our qualified service personnel test the instrument, check consumable parts for wear and replace them as needed. Additionally, the system is aligned and performance is verified. Documentation for your files is provided. The preventive maintenance service is performed by returning the instrument to an authorized service center. Onsite service is available for an additional charge. Purification 10762TA Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 303 21Clinical Laboratory Products For complete and up-to-date product information visit: www.promega.com Maxwell® CSC Installation Qualification and Operational Qualification (Cat.# SA1140, SA1150, SA1160) The Installation Qualification service product includes a series of formal instrument checks, delivers written documentation of instrument functionality and demonstrates that everything ordered with the instrument is supplied and installed at the customer’s laboratory. This service product must be delivered by a Promega representative who is certified to perform the Installation Qualification. The service product involves a site visit to perform: • installation by qualified Promega personnel • inspection of shipping containers, instrument and accessories • comparison of items received against items on the purchase order • inspection of laboratory conditions (power, etc.) • review of all hazards and precautions with users • confirmation/installation of correct software version • instrument test run • documentation of Installation Qualification. The Operational Qualification service product demonstrates that the instrument functions according to its operational specifications. This service product must be delivered by a Promega representative who is certified to perform the Operational Qualification. The service product involves a site visit to: • run operational verification tests • document all calibration and test results • train customer(s) to operate the instrument • train customer(s) to use the log book • complete Operation Qualification documentation. Features: • Fixed-Cost Service Products: Predictable support expenditures. • Factory-Trained Service Specialists: Consistent and reliable service. • Ongoing System Documentation: Audit tracing and compliance. • Comprehensive Service and Support: Minimal instrument downtime. Maxwell® CSC Blood DNA Kit Product Size Cat.# Maxwell® CSC Blood DNA Kit 48 preps AS1321 For In Vitro Diagnostic Use. This product is only available in certain countries. Description: The Maxwell® CSC Blood DNA Kit is intended for use as an in vitro diagnostic (IVD) medical device, in combination with the Maxwell® CSC Instrument and Maxwell® CSC blood DNA purification method, to perform automated isolation of genomic DNA from human whole blood samples. The purified DNA is suitable for use in amplification-based in vitro diagnostic assays. Features: • Purifies DNA from whole blood samples collected in tubes containing EDTA, heparin or sodium citrate anticoagulants. • Designed for use with the Maxwell® CSC Instrument. • Designed for in vitro diagnostic use. • Manufactured under cGMP. Storage Conditions: Store at 15–30°C. Maxwell® CSC DNA FFPE Kit Product Size Cat.# Maxwell® CSC DNA FFPE Kit 48 preps AS1350 For In Vitro Diagnostic Use. This product is only available in certain countries. Description: The Maxwell® CSC DNA FFPE Kit is intended for use, in combination with the Maxwell® CSC Instrument and the Maxwell® CSC DNA FFPE purification method, as an in vitro diagnostic (IVD) medical device to perform automated isolation of DNA from human breast, lung and colon FFPE (formalin-fixed, paraffin-embedded) tissue samples. The purified DNA is suitable for use in amplification-based in vitro diagnostic assays. Features: • Extracts high-quality DNA suitable for use in amplification-based in vitro diagnostic assays. • Provides reliable, consistent nucleic acid extraction at an affordable price. • In combination with the Maxwell® CSC Instrument, it offers clinical customers a high-quality cGMP-compliant DNA extraction method. • Purifies human DNA from formalin-fixed, paraffin-embedded (FFPE) colon, breast and lung tissues. Storage Conditions: Store at 15–30°C. Maxwell® CSC RNA Blood Kit Product Size Cat.# Maxwell® CSC RNA Blood Kit 48 preps AS1410 For In Vitro Diagnostic Use. This product is only available in certain countries. Description: The Maxwell® CSC RNA Blood Kit is intended for use as an in vitro diagnostic (IVD) medical device, in combination with the Maxwell® CSC Instrument, to provide an easy method for efficient, automated purification of RNA from 2.5ml fresh human whole blood collected in EDTA tubes. Features: • Use in amplification-based in vitro diagnostic (IVD) assays. • Walkaway automated extraction from up to 16 samples in a single run • High yield, pure and amplifiable RNA from human whole blood. Minimized sample waste and re-runs. • Rapid processing time. Protocol can be easily completed within single 8-hour shift. Storage Conditions: Store at 15–30°C. Maxwell® CSC RNA FFPE Kit Product Size Cat.# Maxwell® CSC RNA FFPE Kit 48 preps AS1360 For In Vitro Diagnostic Use. This product is only available in certain countries. Description: The Maxwell® CSC RNA FFPE Kit is intended for use, in combination with the Maxwell® CSC Instrument and the Maxwell® CSC RNA FFPE purification method, as an in vitro diagnostic (IVD) medical device to perform automated isolation of RNA from human breast, lung and colon FFPE (formalin-fixed, paraffin-embedded) tissue samples. The purified RNA is suitable for use in amplification-based in vitro diagnostic assays. Features: • Extracts high-quality RNA suitable for use in amplification-based in vitro diagnostic assays. • Provides reliable, consistent nucleic acid extraction at an affordable price. • In combination with the Maxwell® CSC Instrument, it offers clinical customers a high-quality cGMP-compliant RNA extraction method. • Purifies human RNA from formalin-fixed, paraffin-embedded (FFPE) colon, breast and lung tissues. Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 304 For complete and up-to-date product information visit: www.promega.com Maxwell® RSC Instrument Product Size Cat.# Maxwell® RSC Instrument 1 each AS4500 Available Separately RSC/CSC Deck Tray 1 each SP6019 Maxwell® Instrument Bar Code Reader 1 each AS3200 AS4500, SP6019, AS3200 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Maxwell® Rapid Sample Concentrator (RSC) Instrument is a platform for automated purification of nucleic acid from a range of sample types. The purification methods use sample lysis and binding to paramagnetic particles as the primary separation principle. Up to 16 samples can be prepared simultaneously in 25–60 minutes, depending on sample type. The Maxwell® RSC Instrument is controlled by a graphical user interface running on a tablet PC. The instrument is supplied with a Quantus™ Fluorometer and integrated software that allows extracted nucleic acid quantification measurements to be captured in the run report along with sample tracking and method run data. Features: • Easy to Use: Intuitive software and simple validation; very little hands-on time. • Automation: Get to results faster with minimal steps and lower costs. • Quantus™ Fluorometer Integration: Quickly capture extracted nucleic acid concentration values in the run report. • Flexible and Efficient Workflow: Access sample at any point in workflow; consistent performance eliminates reruns. • Technology: Magnetic particles enhance concentration, minimize contamination and provide highly pure and amplifiable nucleic acid ready for downstream analysis. • Small Footprint: Do more in less space. Maxwell® RSC System DNA Purification Kits Product Size Cat.# Maxwell® RSC Blood DNA Kit 48 preps AS1400 Maxwell® RSC Whole Blood DNA Kit 48 preps AS1520 Maxwell® RSC DNA FFPE Kit 48 preps AS1450 Maxwell® RSC Cell DNA Purification Kit 48 preps AS1370 Maxwell® RSC ccfDNA Plasma Kit 48 preps AS1480 Maxwell® RSC Buccal Swab DNA Kit 48 preps AS1640 Maxwell® RSC Stabilized Saliva DNA Kit 48 preps AS1630 Maxwell® RSC Tissue DNA Kit 48 preps AS1610 Maxwell® RSC Cultured Cells DNA Kit 48 preps AS1620 Maxwell® RSC Buffy Coat DNA Kit 48 preps AS1540 Available Separately Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 CTAB Buffer 100 ml MC1411 MC1411 Not For Medical Diagnostic Use. All others For Research Use Only. Not for Use in Diagnostic Procedures. Description: These kits can be used for automated DNA purification with the Maxwell® RSC Instrument: Maxwell® RSC Blood DNA Kit • Extracts DNA from whole blood or buffy coat samples in 30–40 minutes. • Processes up to 400µl of whole blood. • Yields up to 15µg of gDNA, depending on white blood cell count. Maxwell® RSC Whole Blood DNA Kit • Extracts DNA from 50–500µl of whole blood in less than 40 minutes. • Simple, walkaway protocol with no preprocessing. • Compatible with blood stored in EDTA, heparin and citrate anticoagulants. Maxwell® RSC DNA FFPE Kit • Extracts amplifiable DNA from FFPE tissue sections. • Eliminates the use of hazardous organic solvents. • Purified DNA performs better in downstream applications. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 305 21Clinical Laboratory Products For complete and up-to-date product information visit: www.promega.com Maxwell® RSC Cell DNA Purification Kit • Extracts DNA from samples containing less than 10,000 cells. • Compatible with low-cell-number samples such as amniotic fluid, cerebral spinal fluid and cell supernatants. • Cells are collected and processed in up to 400μl volumes, and extraction is complete in about 30 minutes. Maxwell® RSC ccfDNA Plasma Kit • Simple, walkaway protocol with no preprocessing. • Provides high yields of pure and amplifiable ccfDNA. • Scalable protocol, process ccfDNA from 0.2–1ml of plasma. Maxwell® RSC Buccal Swab DNA Kit • Optimized reagents for buccal swab extraction. • Decreased hands-on time with simple protocol. • Consistent results with sufficient DNA for HLA assays. Maxwell® RSC Stabilized Saliva DNA Kit • Simple protocol with optimized reagents. • Consistent DNA yields. • DNA ready to use in downstream assays such as HLA typing. Maxwell® RSC Tissue DNA Kit • Extracts DNA from up to 50mg of mammalian tissue. • Purifies high yields of amplifiable DNA. • Automated protocol improves efficiency. Maxwell® RSC Cultured Cells DNA Kit • Extracts DNA from up to 5 × 106 mammalian tissue culture cells and 2 × 109 bacterial cells. • Simple, walkaway protocol requires no sample preprocessing. • Purified DNA is ready for analysis in about 45 minutes. Maxwell® RSC Buffy Coat DNA Kit • Purifies high yields of DNA from 50–250µl of buffy coat samples in about 50 minutes. • Simple walkaway protocol with no preprocessing. • Compatible with blood stored in EDTA, heparin and citrate anticoagulants. Maxwell® RSC System RNA Purification Kits Product Size Cat.# Maxwell® RSC miRNA Tissue Kit 48 preps AS1460 Maxwell® RSC RNA FFPE Kit 48 preps AS1440 Maxwell® RSC simplyRNA Cells Kit 48 preps AS1390 Maxwell® RSC miRNA Plasma and Serum Kit 48 preps AS1680 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These kits can be used for automated RNA purification with the Maxwell® RSC Instrument. Maxwell® RSC miRNA Tissue Kit • Purifies total RNA, including miRNA, from mammalian tissue samples • Eliminates use of hazardous organic solvents. Maxwell® RSC RNA FFPE Kit • Purifies amplifiable RNA from FFPE tissue samples. • Eliminates use of hazardous organic solvents. Maxwell® RSC simplyRNA Cells Kit • Purifies total RNA from fresh or frozen cells in under an hour. • Reduces pre-extraction sample handling to 4 steps. Maxwell® RSC miRNA Plasma and Serum Kit • High-quality, amplifiable RNA from plasma, serum or enriched exosomes • Simple, safe RNA extraction without organic reagents • Automated RNA extraction of 1–48 samples in a single run Maxwell® RSC Service and Support Products Product Size Cat.# Maxwell® RSC Premier Warranty Upgrade 1 each SA1341 Maxwell® RSC Standard Service Agreement 1 each SA1342 Maxwell® RSC Premier Service Agreement 1 each SA1343 Maxwell® RSC Preventive Maintenance 1 each SA1346 Maxwell® RSC Installation Qualification 1 each SA1347 Maxwell® RSC Operational Qualification 1 each SA1348 Maxwell® RSC IQ/OQ Combination Package 1 each SA1349 For additional information see page 293. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 306 For complete and up-to-date product information visit: www.promega.com Maxwell® 16 Viral Total Nucleic Acid Purification Kit Product Size Cat.# Maxwell® 16 Viral Total Nucleic Acid Purification Kit 48 preps AS1150 Maxwell® 16 Viral Total Nucleic Acid Purification System (IVD) 48 preps AS1155 AS1150 For Laboratory Use. AS1155 For In Vitro Diagnostic Use. This product is only available in certain countries. For additional information see page 154. ReliaPrep™ gDNA Tissue Miniprep System Product Size Cat.# ReliaPrep™ gDNA Tissue Miniprep System 100 preps A2051 250 preps A2052 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ gDNA Tissue Miniprep System provides a complete, ready-to-use method for purification of gDNA from up to 25mg of tissue, a buccal (cheek) swab, or a 1cm mouse tail snip, obtaining intact gDNA without the use of ethanol washes or precipitations. Features: • Easy to Use: Reagents are supplied “ready-to-use”—no additions required. • Save Time: Eluted DNA obtained in 30 minutes or less (hands-on time). • No Ethanol: Eliminates alcohol inhibition and carryover. • Pure gDNA: Improved A260/A230 ratios vs. the leading competitor. • Peace of Mind: Consistent results from run to run and between users. • Concentrated DNA: Good recovery and purity in as little as 50μl elution. Storage Conditions: Store at 15–30°C. ReliaPrep™ FFPE gDNA Miniprep System Product Size Cat.# ReliaPrep™ FFPE gDNA Miniprep System 10 reactions A2351 100 reactions A2352 Available Separately Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ FFPE gDNA Miniprep System provides a complete, all-inclusive method for purifying quality genomic DNA from formalinfixed paraffin-embedded tissue without using hazardous solvents or overnight digestion. Genomic DNA can be isolated from FFPE tissue in approximately two and one-half hours with minimal hands-on time. Features: • Isolate Quality, Intact gDNA: Optimized lysis and binding conditions reverse modifications introduced by the fixation process, resulting in intact, amplifiable gDNA. • Safely Deparaffinize Your Sample: Deparaffinization step occurs without harsh organic solvents. • Save Time: Purify gDNA from FFPE tissue in less than two and one-half hours with minimal hands-on time. No overnight digestion required. • Easy to Use: Minimal preparation time; simply add ethanol and go! Storage Conditions: Store at room temperature. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 307 21Clinical Laboratory Products For complete and up-to-date product information visit: www.promega.com ReliaPrep™ miRNA Cell and Tissue Miniprep System Product Size Cat.# ReliaPrep™ miRNA Cell and Tissue Miniprep System 10 preps Z6210 50 preps Z6211 250 preps Z6212 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ReliaPrep™ miRNA Cell and Tissue Miniprep System provides complete isolation of total RNA, including microRNA (miRNA) and other small non-coding RNA (sncRNA) subspecies, from a wide variety of cell and tissue types as quickly as 40 minutes. The proprietary column/binding matrix can efficiently capture total RNA, including miRNA, from very small amounts of input material. Using this membrane-based purification system, 1 × 102 to 1 × 106 cultured cells or 0.25–20mg of tissue can be processed per purification. The system incorporates a DNase treatment step, which effectively removes substances that can inhibit downstream assays. Features: • Easily Extract Total RNA in 40 Minutes: Experience superior ease of use compared to competitive purification chemistries; whether you’re a novice or an expert, 40-minute protocol reliably extracts total RNA, including miRNA. • Eliminate Harsh Organic Reagents: Bring your miRNA extraction out of the hood and onto your bench. Save money by eliminating the costly disposal of hazardous organic waste. • Isolate Pure RNA: Consistently isolate pure total RNA, including miRNA and other small non-coding RNAs, through an optimized chemistry. • Work with Low Elution Volumes: Extract high concentrations of amplifiable mRNA, miRNA and other small non-coding RNA in elution volumes that meet the needs of your downstream assays. Storage Conditions: Store at 15–30°C. ReliaPrep™ FFPE Total RNA Miniprep System Product Size Cat.# ReliaPrep™ FFPE Total RNA Miniprep System 10 reactions Z1001 100 reactions Z1002 Available Separately Microtubes, 1.5ml 1,000 /bag V1231 ClickFit Microtube, 1.5ml 1,000 /pack V4741 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ FFPE Total RNA Miniprep System provides a complete, all-inclusive method for purification of quality total RNA from formalin-fixed paraffin-embedded tissue without using hazardous solvents or overnight digestion. Total RNA can be isolated from FFPE tissue in approximately one and one-half hours with minimal hands-on time. Features: • Easy to Use: Minimal preparation time. • Safe: Deparaffinization step occurs without harsh organic solvents. • Isolate Quality, Intact Total RNA: Fine-tuned protocol results in high-quality, intact, amplifiable total RNA. Storage Conditions: Store at room temperature. ReliaPrep™ RNA Miniprep Systems Product Size Cat.# ReliaPrep™ RNA Cell Miniprep System 10 preps Z6010 50 preps Z6011 250 preps Z6012 ReliaPrep™ RNA Tissue Miniprep System 10 preps Z6110 50 preps Z6111 250 preps Z6112 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ReliaPrep™ RNA Miniprep Systems provide a fast and simple technique for preparation of intact total RNA from cultured cells or tissue in as little as 30 minutes. The proprietary column/binding matrix can efficiently capture RNA from very small amounts of input material, isolating RNA eluted in a minimal volume (less than 15µl). Using this membrane-based purification system, from 100 to 5 × 106 cultured cells or 0.25 to 20mg of tissue can be processed per purification. The system incorporates a DNase treatment step directly on the minicolumn membrane and effectively removes substances that can inhibit downstream assays. Purification is achieved without the use of phenol:chloroform extractions or ethanol precipitations, resulting in pure RNA that does not require additional purification or concentration of the RNA for use in demanding applications. Features: • Be Efficient: Allows use of precious samples. • Have Confidence: Provides maximum sensitivity for downstream assays without worry of inhibition when measuring low-copy-number targets. • Save Effort: No need to further concentrate samples for use. • Save Time: Rapid protocol and provided DNase reagents streamline laboratory processes. Storage Conditions: Store at 15–30°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 308 For complete and up-to-date product information visit: www.promega.com Quantification Quantus™ Fluorometer Product Size Cat.# Quantus™ Fluorometer 1 each E6150 Available Separately 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 Quantus™ Instrument Standard Service Agreement 1 each SA4040 E4941, E6150, E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Quantus™ Fluorometer is a dual-channel fluorometer for your quantitation workflow. Designed to provide highly sensitive fluorescent detection when quantifying nucleic acids, the compact instrument is simple to operate. The Quantus™ Fluorometer is optimized with preprogrammed settings for Promega QuantiFluor® Dye Systems (QuantiFluor® dsDNA, RNA and ssDNA Systems) to quantitate nucleic acids and offers the flexibility to create customized methods and quantitation settings for other fluorescent dyes. The Quantus™ Fluorometer is equipped with two fluorescence channels for nucleic acid and protein quantitation: • Blue fluorescence channel: Excitation 495nm shortpass (wavelengths up to 495nm), emission 510–580nm. • Red fluorescence channel: Excitation 640nm shortpass (wavelengths up to 640nm), emission 660–720nm. Features: • Experience High Performance: Integrated with QuantiFluor® Dyes for high sensitivity, broad dynamic range and target specificity. Great for low-level sample quantitation such as FFPE or viral samples. • Achieve Increased Sensitivity: Significantly increased sensitivity over absorbance at 260nm (NanoDrop® spectrophotometer) for those samples that are low in concentration. Ten times more sensitive than Qubit® 2.0 and a detection limit of 50pg/ml, compared to 500pg/ml for the Qubit® 2.0. With a customized low standard curve, lower amounts can be detected. • Implement Easy-to-Use Workflow and Navigation: Flexible with custom protocols and user-defined settings. PC software for data management workflow. • Easily Incorporate into Your Laboratory: Affordable price is very cost-effective. • Use for Next-Gen Sequencing: Successfully used in several Next-Gen Sequencing systems, including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. Quantus™ NGS Starter Package Product Size Cat.# Quantus™ NGS Starter Package 1 each E5150 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Quantus™ NGS Starter Package provides you with highly sensitive and easy-to-use DNA quantitation for your NGS applications all in one discounted bundle. Contents include a Quantus™ Fluorometer (Cat.# E6150); QuantiFluor® ONE dsDNA System (Cat.# E4870) and enough 0.5ml assay tubes for 500 reactions. The Quantus™ Fluorometer is a compact and easy-to-operate instrument designed for highly sensitive fluorescent detection of nucleic acids. The Quantus™ Fluorometer is optimized with preprogrammed settings for Promega QuantiFluor® Dye Systems (QuantiFluor® dsDNA, RNA, ssDNA Systems) for nucleic acid quantitation and offers flexibility to create customized methods and quantitation settings for other dyes. The QuantiFluor® ONE dsDNA System provides a fluorescent double-stranded DNA-binding dye in an “add-and-read” format for both dye and standard, simplifying DNA quantitation and speeding up your workflow. It’s as easy to use as NanoDrop® absorbance-based methods but much more sensitive for low-concentration samples. Features: • Employ Integrated Instrumentation and Assay: The QuantiFluor® dyes are optimized for high sensitivity, broad dynamic range and target specificity on the Quantus™ Fluorometer. • Measure Low dsDNA Concentrations: Add-and-read format makes measuring low concentrations of dsDNA simple—no dilutions, no extra tubes. • Notice Increased Sensitivity: Significantly increased sensitivity over absorbance at 260nm (NanoDrop spectrophotometer) for those samples that are low in concentration. • Expect High Specificity to dsDNA: Minimal binding to ssDNA, RNA, protein and interfering compounds. • Spend Less Money: Cost-effective to easily incorporate into your laboratory. • Use for Next-Gen Sequencing: Successfully used in several NGS systems including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. Storage Conditions: Store QuantiFluor® ONE dsDNA Dye and QuantiFluor® ONE Lambda DNA at –30°C to +10°C. Store 1X TE Buffer at –30°C to +30°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 309 21Clinical Laboratory Products For complete and up-to-date product information visit: www.promega.com QuantiFluor® ONE dsDNA System Product Size Cat.# QuantiFluor® ONE dsDNA System 100 reactions E4871 500 reactions E4870 Available Separately K562 Genomic DNA 80 μg E4931 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The QuantiFluor® ONE dsDNA System contains a fluorescent double-stranded DNA-binding dye (504nmEx/531nmEm) developed for use in an “add-and-read” format for dye and standard, making sample quantitation easy. This system enables sensitive quantitation of small amounts of doublestranded DNA (dsDNA). The QuantiFluor® ONE dsDNA System was developed using the fluorescence module of the GloMax® Multi+ Detection System with Instinct® Software, GloMax® Discover System and the Quantus™ Fluorometer. The QuantiFluor® ONE dsDNA System can be used with any fluorometer that is capable of measuring fluorescence at the appropriate excitation and emission wavelengths. Features: • Perform No Dilutions; Use No Extra Tubes: Add-and-read format makes this dye simple to use. • Increase Your Sensitivity: Significantly increased sensitivity compared to absorbance at 260nm (NanoDrop® spectrophotometer), allowing you to quantitate low-concentration samples with confidence. • Experience Minimal Binding: Highly specific to dsDNA; minimal binding to ssDNA, RNA, protein and interfering compounds. • Take Advantage of Flexible Instrumentation: Integrated on Quantus™ and GloMax® detection instruments, yet compatible with any fluorometer capable of measuring the appropriate fluorescence excitation and emission spectra. Storage Conditions: Store the QuantiFluor® ONE dsDNA Dye and QuantiFluor® ONE Lambda DNA at –30°C to +10°C. Store the 1X TE Buffer at –30°C to +30°C. QuantiFluor® dsDNA System Product Size Cat.# QuantiFluor® dsDNA System 1 ml E2670 QuantiFluor® dsDNA Sample Kit 1 each E2671 Available Separately 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The QuantiFluor® dsDNA System contains a fluorescent DNA-binding dye that enables sensitive quantitation of small amounts of double-stranded DNA (dsDNA) in solution. The quantitation of dsDNA is a very important step in many biological applications, particularly in standard molecular biology techniques. The dye shows minimal binding to singlestranded DNA (ssDNA) and RNA, allowing specific quantitation of dsDNA. Features: • Experience Minimal Binding: Highly specific to dsDNA; minimal binding to ssDNA, RNA, protein and interfering compounds. • Increase Your Sensitivity: Significantly increased sensitivity compared to absorbance at 260nm (NanoDrop® spectrophotometer) for lowconcentration samples. Performs better or equal to PicoGreen® dye and can detect as little as 50pg/ml. • Set Up Quickly and Easily: System includes all required reagents to quickly set up and quantitate dsDNA. • Use with Promega Instruments: Pre-optimized on both the Quantus™ Fluorometer and GloMax®-Multi+ Instrument. • Use for Next-Gen Sequencing: Successfully used in several Next-Gen Sequencing systems, including Illumina (HiSeq/miSeq), Roche (454) and LifeTech (ion Torrent and ion Proton) systems. Storage Conditions: Product may arrive frozen. Upon receipt, store at 2–10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 310 For complete and up-to-date product information visit: www.promega.com QuantiFluor® RNA System Product Size Cat.# QuantiFluor® RNA System 1 ml E3310 Available Separately 0.5ml PCR Tubes 50 pack E4941 200 pack E4942 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Sensitive quantitation of RNA is important for the success of downstream applications. The QuantiFluor® RNA System contains a fluorescent RNA-binding dye that enables sensitive quantitation of small amounts of RNA in solution. Detecting and quantitating small amounts of RNA is a very important step that is used in many biological applications, particularly in molecular biology techniques. Features: • Increase Your Sensitivity: Significantly increased sensitivity compared to absorbance results on the NanoDrop® spectrophotometer, allowing you to quantitate low-concentration samples with confidence. • Save Precious Sample for Downstream Assays: Less template RNA required than for quantification by spectrophotometry. • Experience Flexible Instrument Compatibility: Use easily on both the QuantiFluor®-ST Fluorometer and GloMax®-Multi Instrument. This system also can be used on any fluorescent instrument with appropriate optical channels. • Remain Cost-Effective: Value priced, robust option for RNA quantitation. • Use with Promega Instruments: Pre-optimized on both the Quantus™ Fluorometer and GloMax®-Multi+ Instrument. Storage Conditions: Store at –30°C to –10°C, protected from light. GloMax® Discover System Product Size Cat.# GloMax® Discover System 1 each GM3000 Available Separately Light Plate, ABS/Fluor 1 each E6532 GloMax® Dual Injectors with Pumps 1 each GM3030 GloMax® Discover Luminescence Filter Paddle 1 each GM3011 GloMax® Discover Fluorescence Filter Paddle 1 each GM3012 GloMax® Discover or Explorer Installation Qualification 1 each SA1104 GloMax® Discover or Explorer Operational Qualification 1 each SA1105 GloMax® Discover or Explorer Installation and Operational Qualification 1 each SA1106 GloMax® Discover or Explorer Instrument Rental, 1 month 1 each SA1098 GloMax® Discover Standard Service Agreement 1 each SA4000 GloMax® Discover or Explorer Preventive Maintenance 1 each SA4030 GloMax® Discover 96 Half-Position Aperture Assembly 1 each GM1050 E6532, GM3000, GM3030, GM3011, GM3012, GM1050 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® Discover System is a high-performance multimode detection instrument developed with Promega reagent chemistries to provide a simple means of detecting advanced chemistries. This instrument provides superior luminescence sensitivity and dynamic range for both strong and weak bioluminescence experimental samples, as well as a seamless integration with Promega bioluminescent assays. GloMax® Discover also provides flexible use of filters for fluorescence intensity, BRET, FRET, filtered luminescence and UVvisible absorbance measurements. The instrument is operated by an integrated Tablet PC, which provides quick and easy navigation through the control options. Exporting your results is made seamless with a variety of options, including exporting to your local data network. The GloMax® Discover software will provide many of the required technical elements of a part 11 compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 311 21Clinical Laboratory Products For complete and up-to-date product information visit: www.promega.com Features: • Full Range Capabilities: Luminescence, fluorescence, BRET, FRET, and UV-visible absorbance detection. • Integrated with Promega Assays: Developed and optimized with Promega cell and gene reporter assays for seamless workflow; you will be up and running faster. • Easy-to-Use: Simple Tablet PC touch screen navigation with full PC capabilities and a state-of-the-art graphical user interface. • Superior Performance: Broader dynamic range, better sensitivity and lower well-to-well cross talk for more usable data from your experiment. • Connected to Your Workflow: Use as a standalone instrument or integrate into your high-throughput automated workflow; export data to your laboratory network. GloMax® Discover and GloMax® Explorer Systems. GloMax® Explorer System Product Size Cat.# GloMax® Explorer Fully Loaded Model 1 each GM3500 GloMax® Explorer with Luminescence and Fluorescence 1 each GM3510 Available Separately GloMax® Explorer Absorbance Module Upgrade 1 each GM3520 Light Plate, ABS/Fluor 1 each E6532 GloMax® Dual Injectors with Pumps 1 each GM3030 GloMax® Discover Fluorescence Filter Paddle 1 each GM3012 GloMax® Discover or Explorer Installation Qualification 1 each SA1104 GloMax® Discover or Explorer Operational Qualification 1 each SA1105 GloMax® Discover or Explorer Installation and Operational Qualification 1 each SA1106 GloMax® Explorer Standard Service Agreement 1 each SA1107 GloMax® Discover or Explorer Instrument Rental, 1 month 1 each SA1098 GloMax® Discover Standard Service Agreement 1 each SA4000 GloMax® Discover or Explorer Preventive Maintenance 1 each SA4030 GloMax® Discover 96 Half-Position Aperture Assembly 1 each GM1050 GM3500, GM3510, E6532, GM3030, GM3012, GM1050 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GloMax® Explorer System is a high-performance multimode detection instrument developed with Promega reagents to provide a simple means of detecting advanced chemistries. This instrument provides superior luminescence sensitivity and dynamic range for both strong and weak bioluminescence experimental samples as well as seamless integration with Promega bioluminescence assays. GloMax® Explorer measures luminescence, fluorescence intensity and visible absorbance. The instrument is operated by an integrated tablet PC, which provides quick and easy navigation through the control options. Exporting your results is easy with a variety of options, including export to your local data network. The GloMax® Explorer software provides many of the required technical elements of a part 11-compliant system (user authentication and authorization, data integrity and protection, electronic signatures and audit trails) when used with the appropriate laboratory workflow. Features: • Flexible Configuration Options: Luminescence, fluorescence and UVvisible absorbance detection. • Integrated with Promega Assays: Developed and optimized with Promega cell and gene reporter assays for seamless workflow; you will be up and running faster. • Easy to Use: Simple tablet PC touch screen navigation with full PC capabilities and state-of-the-art graphical user interface. • Superior Performance: Broader dynamic range, better sensitivity and lower well-to-well cross talk for more usable data from your experiment. • Connect to Your Workflow: Use as a standalone instrument or integrate into your high-throughput automated workflow. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 312 For complete and up-to-date product information visit: www.promega.com Amplification GenePrint ® 24 System Product Size Cat.# GenePrint ® 24 System 100 reactions B1870 400 reactions B1874 Available Separately Size Conc. Cat.# WEN Internal Lane Standard 500 200 µl DG5001 GenePrint ® 5C Matrix Standard 5 preps B1930 Water, Amplification Grade 6,250 µl DW0991 2800M Control DNA 25 µl 10 ng/µl DD7101 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The GenePrint ® 24 System is a 24-locus multiplex system designed to generate a multi-locus human DNA profile from a variety of human-derived biological sources. This five-color system allows coamplification and fluorescent detection of the following autosomal STR loci: CSF1PO, FGA, TH01, TPOX, vWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51, D21S11, D10S1248, D22S1045, D2S441, D1S1656, D12S391, D2S1338, D19S433, Penta D and Penta E plus Amelogenin for gender determination. In addition, the male-specific DYS391 locus is included to identify null Y allele results for Amelogenin. The GenePrint ® 24 System is compatible with 2.5 to 5ng of extracted DNA samples and requires fewer PCR cycles in lower reaction volumes than previous STR systems. This is particularly important when optimal heterozygote balance is desired. The GenePrint ® 24 System is compatible with the Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Panels and bins text files are required for automatic assignment of genotypes using the GeneMapper® and GeneMarker® software and are available for download. Features: • Use Specialized Assay: STR assay specifically for DNA fingerprinting and mixed sample analysis with abundant source material. • Obtain Optimal Heterozygote Balance: Higher sample input for optimal heterozygote balance using up to 5ng of DNA template. • Take Advantage of High Power of Discrimination: Identify unique alleles to resolve complex mixtures from related individuals or multiple sources. • Employ Streamlined Workflow: Improve productivity with rapid cycling and more loci. • Simplify Validation: Simplify validation and continuity using loci in concordance with previously generated data. Storage Conditions: Store kit at –20°C. Upon receipt, move 2800M Control DNA and WEN ILS 500 to 4°C storage. PowerPlex® Fusion 6C System Product Size Cat.# PowerPlex® Fusion 6C System 50 (or 100 direct-amp) reactions DC2705 200 (or 400 direct-amp) reactions DC2720 800 (or 1,600 direct-amp) reactions DC2780 Available Separately Size Conc. Cat.# PowerPlex® 6C Matrix Standard 5 preps DG4900 WEN Internal Lane Standard 500 200 μl DG5001 2800M Control DNA 25 μl 10 ng/µl DD7101 Not For Medical Diagnostic Use. Description: The PowerPlex® Fusion 6C System is a 27-locus multiplex for human identification applications including forensic analysis, relationship testing and research use. This six-color system allows co-amplification and fluorescent detection of the 18 autosomal loci in the expanded CODIS core loci (CSF1PO, FGA, TH01, vWA, D1S1656, D2S441, D2S1338, D3S1358, D5S818, D7S820, D8S1179, D10S1248, D12S391, D13S317, D16S539, D18S51, D19S433 and D21S11) and Amelogenin and DYS391 for gender determination. The Penta D, Penta E, TPOX, D22S1045 and SE33 loci also are included to increase discrimination and allow searching of databases that include profiles with these loci. Finally, two rapidly mutating Y-STR loci, DYS570 and DYS576, are included in the multiplex. The PowerPlex® Fusion 6C System works well with extracted DNA samples, including low amounts of template DNA, mixtures and inhibitor-laden samples. The PowerPlex® Fusion 6C System is also compatible with direct amplification, enabling streamlined STR databasing efforts. Amplification can be successfully performed with sample types such as FTA® card punches as well as pretreated swabs, Bode Buccal DNA Collector™ punches or S&S 903 punches. Fast cycling conditions used with the PowerPlex® Fusion 6C System reduce sample-processing time for all samples. The PowerPlex® Fusion 6C System is compatible with the Applied Biosystems® 3500 and 3500xL Genetic Analyzers as well as Applied Biosystems® 3130 and 3130xl Genetic Analyzers with Data Collection Software Version 4.0 with the DC v4 6-Dye Module v1 License (Life Technologies). Features: • Experience Highest Inter-Database Compatibility and Discrimination: 27 loci (23 autosomal STRs, 3 Y-STRs and Amelogenin); amplify all loci in the expanded CODIS core loci. • Streamline Your Workflows: Use direct-amplification protocols and rapid cycling. • Reduce Repeat Analysis of Difficult Samples: Experience high inhibitor tolerance and sensitivity for casework. • Simplify Your Validation and QC: Use one kit for both casework and database sections. Storage Conditions: Store all components at –30°C to –10°C. After the first use, store the PowerPlex® Fusion 6C System components at 2–10°C, where components are stable for 6 months. Do not refreeze. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 313 21Clinical Laboratory Products For complete and up-to-date product information visit: www.promega.com PowerPlex® Fusion System Product Size Cat.# PowerPlex® Fusion System 200 reactions DC2402 800 reactions DC2408 Available Separately Size Conc. Cat.# 2800M Control DNA 25 μl 10 ng/µl DD7101 Water, Amplification Grade 6,250 μl DW0991 Not For Medical Diagnostic Use. Description: The PowerPlex® Fusion System is a 24-locus multiplex for human identification applications including forensic analysis, relationship testing and research use. This five-color system allows co-amplification and fluorescent detection of the 13 core CODIS (US) loci (CSF1PO, FGA, TH01, TPOX, vWA, D3S1358, D5S818, D7S820, D8S1179, D13S317, D16S539, D18S51 and D21S11), the 12 core European Standard Set loci (TH01, vWA, FGA, D21S11, D3S1358, D8S1179, D18S51, D10S1248, D22S1045, D2S441, D1S1656 and D12S391) and Amelogenin for gender determination. In addition, the male-specific DYS391 locus is included to identify null Y allele results for Amelogenin. The Penta D, Penta E, D2S1338 and D19S433 loci are included to increase discrimination and allow searching of databases that include profiles with these popular loci. This extended panel of STR markers is intended to satisfy both CODIS and ESS recommendations. The PowerPlex® Fusion System works well with extracted DNA samples, including low amounts of template DNA, mixtures and inhibitor-laden samples. The PowerPlex® Fusion System also is compatible with direct amplification, enabling streamlined STR databasing efforts. Amplification can be successfully performed with sample types such as FTA® card punches as well as pretreated swabs, Bode Buccal DNA Collector™ punches or S&S 903 punches. Fast cycling conditions used with the PowerPlex® Fusion System reduce sample-processing time for all samples. The PowerPlex® Fusion System is compatible with the ABI PRISM® 3100 and 3100-Avant Genetic Analyzers and Applied Biosystems® 3130, 3130xl, 3500 and 3500xL Genetic Analyzers. Panels and bins text files are required for automatic assignment of genotypes using the GeneMapper® ID and ID-X software and are available for download at: www.promega.com/resources/tools/genemapper-id-software-panelsand-bin-sets/ The PowerPlex® Fusion System was given NDIS approval in March 2013 for NDIS CODIS databasing. Features: • Highest Interdatabase Compatibility and Discrimination: 24 loci (23 STRs plus Amelogenin), including the CODIS and ESS required loci. Amplifies all loci found in Identifiler®, SGM Plus® and PowerPlex® 16, some of the most commonly used multiplexes over the last decade. • Streamlined Workflows: Direct-amplification protocols and rapid cycling. • Less Repeat Analysis of Difficult Samples: High inhibitor tolerance and sensitivity for casework. • Easier Validation and QC: One kit for both casework and database sections. Storage Conditions: Store kit at –20°C. Upon receipt, move 2800M Control DNA to 4°C storage. PowerPlex® Y23 System Product Size Cat.# PowerPlex® Y23 System 50 reactions DC2305 200 reactions DC2320 Available Separately Size Conc. Cat.# 2800M Control DNA 25 μl 10 ng/µl DD7101 500 μl 0.25 ng/µl DD7251 Water, Amplification Grade 6,250 μl DW0991 Not For Medical Diagnostic Use. Description: The PowerPlex® Y23 System is a 23-loci, 5-color Y-STR multiplex designed for genotyping forensic casework samples, database samples and paternity samples. The PowerPlex® Y23 System works well with extracted DNA samples, including low amounts of template and male/female DNA mixtures. The PowerPlex® Y23 System also is compatible with direct amplification, enabling streamlined Y-STR databasing efforts. Amplification can be successfully performed with sample types such as FTA® card punches as well as pretreated swabs, Bode Buccal DNA Collector™ punches or S&S 903 punches. Faster cycling conditions cut amplification time almost in half. Moreover, reduced sample-processing time and faster cycling conditions provide a significant time savings in every run. The PowerPlex® Y23 System is tolerant of many known amplification inhibitors. The robust performance of the kit results in more interpretable data from inhibitor-laden samples. The PowerPlex® Y23 System was given NDIS approval in January 2013. Features: • More Meaningful STR Analysis: Higher power of discrimination from 23 loci results in fewer false-positive matches. • More Usable Profile from Samples with Excess Female DNA: High sensitivity in the presence of female DNA (<0.1ng male DNA, 1:6,000 ratio). • Streamlined Databasing Workflows: Direct-amplification compatible. • Significant Reduction in Amplification Time: Faster cycling conditions cut amplification time roughly in half. • Full Profiles from Challenging Casework Samples: High tolerance for inhibitors including tannic acid, hematin and humic acid. • Simplified Workflows and Inventory: One kit for both casework and databasing. Storage Conditions: Upon receipt of kit, remove 2800M Control DNA and store at 4°C. Store all other kit components at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 314 For complete and up-to-date product information visit: www.promega.com PCR Optimization Kit and 5X PCR Buffers Product Size Cat.# PCR Optimization Kit 1 each D2381 5X PCR Buffer A 1 each D2301 5X PCR Buffer B 1 each D2311 5X PCR Buffer C 1 each D2321 5X PCR Buffer D 1 each D2331 5X PCR Buffer E 1 each D2341 5X PCR Buffer F 1 each D2351 5X PCR Buffer G 1 each D2361 5X PCR Buffer H 1 each D2371 For Laboratory Use. Description: The PCR Optimization Kit contains a portfolio of preformulated, high-quality buffers (A–H) that together cover a spectrum of PCR performance capabilities for endpoint, multiplex, real-time, GC-rich and inhibitor-resistant amplifications. The kit also contains a tube of 25mM MgCl2 solution and GoTaq® MDx Hot Start Polymerase, providing you a kit of reagents to perform a series of short experiments to quickly survey which combination of PCR buffer, MgCl2 and enzyme concentration yields optimal PCR performance specific for your assay. Once you identify your optimal PCR formulation, continue your work with a Made-to-Order 2X PCR Master Mix or purchase the stand-alone buffer with MGCL2 and GoTaq® MDx Hot Start Polymerase. Request your Made-to-Order 2X PCR Master Mix at: www.promega.com/made-to-order Features: • Accelerate your Assay Development: Achieve optimized PCR performance without spending a lot of development time to get there. Save yourself time by capitalizing on our 30+ years of PCR experience by starting your assay development and optimization with preformulated buffers that cover a wide variety of PCR performance capabilities. • Integrated Quality: Products are cGMP-manufactured, providing confidence for consistent, lot-to-lot PCR performance. • No-Hassle Customization: Seamlessly transition into daily execution of your PCR assay by continuing your work with a Made-to-Order 2X PCR Master Mix. Simply tell us what your reaction formulation is (which buffer, how much MgCl2 and enzyme you used), and we’ll make your personalized 2X PCR Master Mix*. *Minimum order quantity required for Made-to-Order 2X PCR Master Mixes. Storage Conditions: Store at –30 to –10°C. Magnesium Chloride Solution Product Size Conc. Cat.# Magnesium Chloride Solution 1.5 ml 25 mM A3511 25 ml 25 mM A3513 For Laboratory Use. Description: MgCl2 solution supplied at 25mM for PCR optimization. Storage Conditions: Store at –30°C to –10°C. GoTaq® MDx DNA Polymerases Product Size Conc. Cat.# GoTaq® MDx Hot Start Polymerase 100 u D6001 500 u D6005 GoTaq® MDx Hot Start Polymerase, Glycerol-Free 500 u D6201 GoTaq® MDx Hot Start Polymerase 2,500 u D6006 10,000 u D6008 GoTaq® MDx DNA Polymerase 100 u ≥5 u/µl D4001 500 u ≥5 u/µl D4005 2,500 u ≥5 u/µl D4006 GoTaq® MDx DNA Polymerase, Glycerol-Free 500 u ≥5 u/µl D4101 GoTaq® MDx Hot Start Polymerase, High Concentration 1,000 u ≥50 u/µl D6101 For Laboratory Use. Description: GoTaq® MDx DNA Polymerase is a full-length form of Taq DNA polymerase that exhibits 5´→3´ exonuclease activity. GoTaq® MDx Hot Start Polymerase contains GoTaq® MDx DNA Polymerase bound to a proprietary antibody that blocks polymerase activity. The polymerase activity is restored during the initial denaturation step when amplification reactions are heated at 94–95°C for two minutes. This allows hot-start PCR in which polymerase activity is inhibited at temperatures below 70°C, allowing convenient, room-temperature reaction setup. Hot-start PCR is advantageous for some amplification targets because primer-dimer and secondary products are eliminated or minimized. In some cases, hot-start PCR may improve yields. The glycerol-free product formulation is further purified to remove glycerol, making it suitable for further manufacture processing and lyophilization. GoTaq® MDx DNA Polymerase products are manufactured under cGMP standards. GoTaq® MDx DNA Polymerase products are general purpose reagents intended for general laboratory use. They can be used as a component of molecular diagnostic assays, where applicable country laws allow, without paying royalties. The products by themselves do not provide any diagnostic result. Features: • Achieve consistent and robust amplification using GoTaq® MDx DNA Polymerase. • Use Consistently Performing Enzymes: cGMP-manufactured using validated equipment, processes and methods under a certified Quality System to ensure consistent product performance lot-to-lot. • Work with High-Quality Enzymes Tested for Low DNA Contamination: QC-tested for bacterial, fungal and mammalian DNA. • Take Advantage of our Custom Solutions: Flexible product formats and formulations available. To use GoTaq® MDx Hot Start Polymerase in a custom format or to distribute GoTaq® MDx Hot Start Polymerase, contact the Promega Custom Order Department to discuss specific requirements. Storage Conditions: Store at –30 to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 315 21Clinical Laboratory Products For complete and up-to-date product information visit: www.promega.com GoScript™ Reverse Transcription System Product Size Cat.# GoScript™ Reverse Transcription System 50 reactions A5000 100 reactions A5001 Available Separately GoScript™ Reverse Transcriptase 100 reactions A5003 500 reactions A5004 GoScript™ Reverse Transcription Mix, Oligo(dT) 50 reactions A2790 100 reactions A2791 GoScript™ Reverse Transcription Mix, Random Primers 50 reactions A2800 100 reactions A2801 A5000, A5001, A2790, A2791, A2800, A2801 For Research Use Only. Not for Use in Diagnostic Procedures. A5003, A5004 For Laboratory Use. Description: The GoScript™ Reverse Transcription System includes a reverse transcriptase and a specialized set of reagents for efficient synthesis of first-strand cDNA optimized for quantitative PCR amplification. GoScript™ Reverse Transcriptase uses M-MLV Reverse Transcriptase and state-of-the-art buffer technology to deliver robust, reliable cDNA synthesis of a full range of rare and abundant transcripts, even in the presence of inhibitors. GoScript™ Reverse Transcriptase is qualified for use in qPCR, including GoTaq® qPCR systems. Features: • Available as a standalone enzyme, a complete reverse transcription kit or as a master mix with Oligo(dT) or Random Primers. • Achieve sensitive transcription of both high-copy and low-copy messages. • Transcribe short and long transcripts; process through secondary structure. Storage Conditions: Store at –30°C to –10°C. PCR Nucleotide Mix Product Size Conc. Cat.# PCR Nucleotide Mix 200 μl 10 mM C1141 1,000 μl 10 mM C1145 200 μl 25mM U1431 1,000 μl 25mM U1432 For Laboratory Use. Description: High-quality deoxynucleotide triphosphates (dNTPs) are critical for PCR efficacy. The PCR Nucleotide Mix is a premixed solution containing the sodium salts of dATP, dCTP, dGTP and dTTP. PCR Nucleotide Mix is manufactured under cGMP conditions and has equimolar amounts of each dNTP to ensure optimal PCR. Adding dNTPs as a mix also simplifies pipetting steps and reduces the risk of contamination. There are two ready-to-use formulations available: • A premixed solution with each nucleotide at a concentration of 10mM in water at pH 7.5; the total concentration of nucleotides is 40mM. • A premixed solution with each nucleotide at a concentration of 25mM in water at pH 7.5; the total concentration of nucleotides is 100mM. Features: • Optimized and Pretested in PCR: Equimolar amounts of each dNTP ensure optimal PCR. • Convenient: Add 1μl for 50μl PCR. • Easy to Use: Reduced pipetting steps contribute to ease-of-use and reduce the risk of contamination. • Performance Guaranteed: Promega PCR systems, enzymes and reagents are proven in PCR to ensure reliable, high-performance results. If you are not completely satisfied with any Promega PCR product, we will send a replacement or refund your account. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ • cGMP-Manufactured: Achieve lot-to-lot product consistency. • Two Concentrations Available: 10mM and 25mM. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 316 For complete and up-to-date product information visit: www.promega.com Deoxynucleotide Triphosphates (dNTPs) Product Size Conc. Cat.# dATP 25 μmol 100 mM U1205 40 μmol 100 mM U1201 200 μmol 100 mM U1202 dGTP 25 μmol 100 mM U1215 40 μmol 100 mM U1211 200 μmol 100 mM U1212 dCTP 25 μmol 100 mM U1225 40 μmol 100 mM U1221 200 μmol 100 mM U1222 dTTP 25 μmol 100 mM U1235 40 μmol 100 mM U1231 200 μmol 100 mM U1232 Set of dATP, dCTP, dGTP, dTTP 10µmol each 100 mM U1330 25 μmol each 100 mM U1420 40µmol each 100 mM U1240 200 μmol 100 mM U1410 For Laboratory Use. Description: High-quality deoxynucleotide triphosphates (dNTPs) are critical for the success of many key procedures such as cDNA synthesis, sequencing and labeling. Promega dNTPs have greater than 99% triphosphate content and are provided at a concentration of 100mM in water at pH 7.5. Features: • Dependable: PCR-tested deoxynucleotides ensure optimal performance with all Promega amplification enzymes. • Consistent: dNTPs are >99% pure, allowing highly consistent results. • Convenient: Supplied at a convenient concentration (100mM in water) for ease-of-use in PCR and other applications. Storage Conditions: Store at –30°C to –10°C. PCR Amplifications From Each Size of Individual dNTPs. Each catalog number supplies each individual dNTP at 100mM. Reactions are based on 200µM each dNTP in a 50µl reaction. Cat.# Quantity Volume Reactions U1330, U1335 10 µmol each 100 µl each 1,000 U1420 25 µmol each 250 µl each 2,500 U1240, U1245 40 µmol each 400 µl each 4,000 U1410 200 µmol each 2 × 1,000 µl each 20,0009479LA Deoxyuridine Triphosphate (dUTP) Product Size Conc. Cat.# dUTP 40 μmol 100 mM U1191 Set of dATP, dCTP, dGTP, dUTP 10µmol each 100 mM U1335 40µmol each 100 mM U1245 For Laboratory Use. Description: High-quality deoxynucleotide triphosphates (dNTPs) are critical for the success of many key procedures such as cDNA synthesis, sequencing and labeling. Promega dNTPs have greater than 99% triphosphate content and are provided at a concentration of 100mM in water at pH 7.5. dUTP (2´-Deoxyuridine, 5´-Triphosphate) can be used in place of dTTP in PCR and RT-PCR protocols to prevent carryover from previous amplifications. The substitution of dUTP for dTTP in PCR results in uracil-containing PCR products that are suitable for most standard applications. The enzyme uracil-N-glycosylase (UNG, also referred to as UDG) can be added to a PCR premix to excise uracil from any contaminating PCR product, thereby preventing false positives. Each lot of dUTP is function-tested to ensure specific DNA amplification and the absence of nuclease activity. Features: • Dependable: PCR-tested deoxynucleotides ensure optimal performance with all Promega amplification enzymes. • Consistent: dUTP is ≥99% triphosphate, allowing highly consistent results. • Convenient: Supplied at a convenient concentration (100mM in water) for ease-of-use in PCR and other applications. Storage Conditions: Store at –20°C. Avoid exposure to frequent temperature changes. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 317 21Clinical Laboratory Products For complete and up-to-date product information visit: www.promega.com RNasin® Ribonuclease Inhibitors Product Size Conc. Cat.# RNasin® Ribonuclease Inhibitor 2,500 u 20–40 u/µl N2111 10,000 u 20–40 u/µl N2115 Recombinant RNasin® Ribonuclease Inhibitor 2,500 u 20–40 u/µl N2511 10,000 u 20–40 u/µl N2515 RNasin® Plus RNase Inhibitor 2,500 u 40 u/µl N2611 10,000 u 40 u/µl N2615 N2111, N2115 For Research Use Only. Not for Use in Diagnostic Procedures. N2511, N2515, N2611, N2615 For Laboratory Use. For additional information see page 122. Microsatellite Instability (MSI) Analysis Product Size Cat.# MSI Analysis System, Version 1.2 100 reactions MD1641 Available Separately Internal Lane Standard 600 150 μl DG1071 DG1071 For Laboratory Use. MD1641 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MSI Analysis System, Version 1.2, is a fluorescent multiplex PCR-based method detect microsatellite instability (MSI), a form of genomic instability. This instability is due to insertion or deletion of repeating units during DNA replication and failure of the mismatch repair system (MMR) to correct these errors. MSI analysis typically involves comparing allelic profiles of microsatellite markers generated by amplification from matching pairs of test samples, which may be MMR-deficient, and normal tissue samples. New alleles in the abnormal sample not found in the corresponding normal sample indicate the presence of MSI. MSI analysis can be used as a screening method to identify samples for further characterization. The MSI Analysis System, Version 1.2, includes fluorescently labeled primers (marker panel) for co-amplification of seven markers for analysis of the MSIhigh (MSI-H) phenotype, including five nearly monomorphic mononucleotide repeat markers (BAT-25, BAT-26, MON0-27, NR-21 and NR-24) and two highly polymorphic pentanucleotide repeat markers (Penta C and Penta D). Amplified fragments are detected using an ABI PRISM® 310, 3100, 3100-Avant, 3130 or 3130xl Genetic Analyzer after spectral calibration. Panels and bins text files simplify and standardize data analysis by providing automated assignment of genotypes using GeneMapper® 4.0 software. Features: • Understand the Complete MSI Phenotype: A single multiplex PCR amplifies five informative mononucleotide repeat markers for MSI-H determination. • Confidence in Sample Identification: Co-amplification of highly polymorphic pentanucleotide repeats provides internal sample tracking. • Consistent Data Analysis: MSI Panels and bins for GeneMapper® software can be downloaded. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 318 For complete and up-to-date product information visit: www.promega.com Y Chromosome Deletion Detection System, Version 2.0 Product Size Cat.# Y Chromosome Deletion Detection System, Version 2.0 25 reactions MD1531 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Y Chromosome Deletion Detection System, Version 2.0, provides a standardized screening panel amplifying only informative nonpolymorphic sequence tag sites (STS) on the human Y chromosome. The system amplifies key functional regions associated with AZoospermia Factor (AZF), namely the regions that flank AZFa and cover AZFb, AZFc, AZFd including DAZ, KAL-Y, SMCY and flanking loci for other key spermatogenesis-related genes (namely RBM1, DFFRY and DBY). Five Multiplex Master Mixes, with a total of 20 characterized Y-specific primer pairs, are included. Four of the multiplex primer sets contain a control primer pair that amplifies a fragment of the X-linked SMCX locus. One of the multiplex primer sets (Multiplex E Master Mix) contains a control primer pair that amplifies a unique region in both male and female DNA (ZFX/ZFY). Finally, a primer pair that amplifies a region of the SRY gene has been included in Multiplex E Master Mix as a control for the testis-determining factor on the short arm of the Y chromosome to detect XX males arising from Y to X translocations. The Multiplex Master Mixes are designed to facilitate the simultaneous amplification of several different regions of the Y chromosome. The amplification products (83–496bp) of the five multiplex PCR amplifications can be clearly separated by agarose gel electrophoresis and visualized by ethidium bromide staining. Failure to amplify specific regions of the Y chromosome is indicative of Y chromosome deletions in the test sample. The size control ladder provided minimizes analysis time and the possibility of misinterpreting molecular weight of amplification products. Features: • Ease of Use: Premixed Multiplex Master Mixes contain 20 primer pairs, including internal controls providing a standardized panel of results requiring no user optimization. • More Robust Reactions: Improved formulation and use of GoTaq® DNA Polymerase minimizes dropouts. • Flexibility: Amplify genomic DNA purified using various methods and with a PE480 (oil overlay) or PE9600/9700 (non-oil overlay) thermal cycler. • Complete System: All required reagents are provided in the kit. Storage Conditions: Store at –20°C. Primer Sets in the Y Chromosome Deletion Detection System. Locus/ Locus/ Locus/ Locus/ Locus/ Multiplex STS 1 STS 2 STS 3 STS 4 STS 5 Master Mix A DAZ/ DYS240/ DYS271/ DYS221/ KAL-Y/ SY254 SY157 SY81 SY130 SY182 Master Mix B SMCY/ DYS218/ DAZ/ DAZ/ SYPR3 SY127 SY242 SY208 Master Mix C DYS219/ DYS212/ DYF51S1/ DAZ/ SY128 SY121 SY145 SY255 Master Mix D DYS236/ DYS223/ DYS215/ SY152 SY133 SY124 Master Mix E SRY/ DYS224/ DYS148/ DYS273/ ZFX1/ SY14 SY134 SY86 SY84 ZFY9492LA CE-Marked In Vitro Diagnostic Medical Device—Y Chromosome AZF Analysis Product Size Cat.# Y Chromosome AZF Analysis System 25 reactions MD1631 For In Vitro Diagnostic Use. This product is only available in certain countries. Description: The Y Chromosome AZF Analysis System complies with EU Directive 98/79/EC on in vitro diagnostic medical devices. The Y Chromosome AZF Analysis System provides a multiplex PCR-based method to analyze the integrity of the human Y chromosome AZF region. The Y Chromosome AZF Analysis System is to be used as part of a diagnostic workup to characterize male infertility. This information is potentially useful for patients considering in vitro fertilization because deletions in the AZF region of the Y chromosome are passed on to male offspring produced by in vitro fertilization, resulting in infertility. The Y Chromosome AZF Analysis System consists of 20 primer pairs that are homologous to previously identified and mapped sequence-tagged sites (STS). These primers will amplify nonpolymorphic short DNA segments from the AZF region of the Y chromosome, covering AZFa, AZFb, AZFc, proximal AZFc/AZFd (including DAZ, KALY and SMCY) and flanking loci for other key spermatogenesis-related genes (RBM1, DFFRY and DBY). The Y Chromosome AZF Analysis System is fully compliant with European Molecular Genetics Quality Network (EMQN) recommendations. The primers have been combined into five Multiplex Master Mix sets (A–E) for use in multiplex PCR. This makes it possible to analyze all 20 STS by performing five concurrent PCR amplifications. Features: • Compliant with EU Directive 98/79/EC: Y Chromosome AZF Analysis System is labeled as an in vitro diagnostic medical device and bears the CE Mark. • State-of-the-Art Detection of First Choice STS: Primer pairs are compliant with current EMQN recommendations and include primer pairs to amplify SRY. • Single Amplification: Saves time and labor with simultaneous amplification of 5 multiplex reactions, which analyzes the extent of Y chromosome integrity. • Complete System: Optimized premixed Multiplex Master Mixes, including control primers to test for PCR amplification, provide a standardized panel of results. Storage Conditions: Store all components at –20°C. Avoid multiple freezethaw cycles. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 319 22 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Mass Spectrometry Glycosidases 320 Reference Reagents for Mass Spectrometry 321 Proteases and Surfactants 322 Mass Spectrometry Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 320 For complete and up-to-date product information visit: www.promega.com Glycosidases Glycosidases Product Size Conc. Cat.# Endo H 10,000 units 500 u/µl V4871 50,000 units 500 u/µl V4875 Fetuin 500 μg 10 mg/ml V4961 PNGase F 500 units 10 u/µl V4831 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Endoglycosidase H (Endo H) is a recombinant glycosidase cloned from Streptomyces plicatus and overexpressed in E. coli. Endo H cleaves the chitobiose core of high mannose and a limited number of hybrid oligosaccharides from N-linked glycoproteins. It does not cleave complex glycans. Enzymatic cleavage is between the two N-acetylglucosamine residues in the diacetylchitobiose core of the oligosaccharide, leaving one N-acetylglucosamine residue on the asparagine. This is in contrast to PNGase F, which cleaves all asparagine-linked oligosaccharides. Unit Definition: One unit is defined as the amount of enzyme required to remove >95% of the carbohydrate from 10μg of denatured RNase B in 1 hour at 37°C in a total reaction volume of 10μl. Fetuin is a glycoprotein with O-linked and N-linked glycosylation sites. PNGase F is a recombinant glycosidase cloned from Elizabethkingia miricola and overexpressed in E. coli. PNGase F has a molecular weight of 36kDa. Storage Conditions: Store Endo H and Fetuin at –30 to –10°C. PNGase F Product Size Conc. Cat.# PNGase F 500 units 10 u/µl V4831 For Research Use Only. Not for Use in Diagnostic Procedures. Description: PNGase F is a recombinant glycosidase cloned from Elizabethkingia miricola and overexpressed in E. coli. PNGase F has a molecular weight of 36kDa. PNGase F catalyzes the cleavage of N-linked oligosaccharides between the innermost GlcNAc and asparagine residues of high mannose, hybrid and complex oligosaccharides from N-linked glycoproteins. PNGase F will not remove oligosaccharides containing Alpha-(1,3)-linked core fucose commonly found on plant glycoproteins. Unit Definition: One unit of PNGase F will catalyze the deglycosylation of 1 nanomole of denatured Ribonuclease B (RNase B) in one minute at 37°C. One Promega unit is equal to 1 IUB milliunit. Molecular Weight: PNGase F has a molecular weight of approximately 36kDa. Physical Form: PNGase F is supplied as a liquid in 20mM Tris-HCl (pH 7.5 at 25°C), 50mM NaCl and 5mM EDTA at a concentration of 10,000u/ml. Storage Conditions: Store at 2–10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 321 22Mass Spectrometry For complete and up-to-date product information visit: www.promega.com Reference Reagents for Mass Spectrometry 6 × 5 LC-MS/MS Peptide Reference Mix Product Size Cat.# 6 × 5 LC-MS/MS Peptide Reference Mix 50 μl V7491 200 pmol V7495 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The 6 × 5 LC-MS/MS Peptide Reference Mix is a unique reagent designed to monitor liquid chromatography (LC) and mass spectrometry (MS) instrument performance and assist in method development and optimization. The product is a mixture of 30 peptides; 6 sets of 5 isotopologues of the same peptide sequence. The isotopologues differ only by the number of stable, heavy-labeled amino acids incorporated into the sequence. The labels consist of uniform 13C and 15N atoms. Chromatographically, each of the isotopologues is indistinguishable; however, since they differ in mass, they are clearly resolved by mass spectrometry. The isotopologues of each peptide are present in a series of tenfold dilutions. This format allows assessment of instrument dynamic range and sensitivity from a single run. Peptides with a wide range of hydrophobicities were chosen to enable reporting of LC column performance. In addition, the peptides were chosen for maximal stability. Amino acids prone to artificial post-translational modification (i.e., methionine, asparagine, etc.) were excluded from the sequences. None of the peptides have internal lysines or arginines and will therefore not be affected by trypsin or Lys-C. In addition there is a mass separation of at least 4 Daltons between the isotopologues, so that even low-resolution instruments can distinguish the masses. PReMiS™ Software Tool The 6 x 5 LC-MS/MS Peptide Reference Mix is accompanied by a complementary PReMiS™ Software tool (available by download) that reports on key liquid chromatography and mass spec parameters. The parameter reports can be exported to CSV or saved as .pdf files. In addition to the general reporting feature, performance parameters can be tracked over time, allowing a clear assessment of trends to pinpoint poor performance and maintenance needs. For those laboratories that have multiple instruments, the ability to compare parameters across instruments will also be available. Thermo (.raw) and ABSCIEX (.wiff) formats are available for direct importing. Other vendor formats can be imported after conversion to .mzml format. Data reports are rapidly generated (usually in less than 2 minutes), with clear presentation of the XIC of all 30 masses available for immediate viewing. Features: • Save Time: Unique peptide formulation allows assessment of LC and MS parameters in one run with a single reagent. • Eliminate Manual Calculations: Complementary software provides routine analysis. • Ensure Consistent Instrument Performance Over Time: Complementary software provides historical monitoring. • Accurately Report Instrument Sensitivity and Dynamic Range: Peptides are AAA-qualified. • Use with Neat or Complex Mixture Analysis: Compatible with multiple applications. Storage Conditions: Store at –30°C to –10°C. Mass Spec-Compatible Yeast and Human Protein Extracts Product Size Conc. Cat.# MS Compatible Yeast Protein Extract, Digest 100 μg V7461 MS Compatible Human Protein Extract, Digest 100 μg V6951 MS Compatible Yeast Protein Extract, Intact 1 mg 10 mg/ml V7341 MS Compatible Human Protein Extract, Intact 1 mg 10 mg/ml V6941 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The mass spectrometry-compatible yeast and human protein extracts are designed specifically for mass spectrometry applications (i.e., instrument monitoring). The extracts are predigested and cleaned up by solid-phase extraction for immediate use in liquid chromatography/mass spectrometry (LC/MS) analysis. Both the yeast and human extracts also are available in an intact undigested form to provide a test material for optimizing mass spec protein sample preparation. The yeast extracts are beneficial for users who prefer working with a relatively compact and well studied proteome, whereas the human extract provides opportunity for working with a complex proteome having a large dynamic range. Consistent extract protein composition is ensured by tight control over cell culture conditions and manufacturing process. Lot-to-lot consistency of extracts is monitored by various protein and peptide qualitative and quantitation methods, including LC/MS and amino acid analysis. Our manufacturing process assures compatibility with reverse phase liquid chromatography and mass spectrometry by monitoring nonspecific protein fragmentation, nonbiological post-translational modifications and, for digested extracts, minimal undigested peptides. Features: • Compatible with LC/MS instrumentation platforms. • Minimal nonbiological post-translational modifications. • Peptide quantity measured by AAA. • Model systems for method development/instrument monitoring. • Multiple formats (digest/intact). Storage Conditions: Store the predigested extracts at –30°C to –10°C. Store the intact, undigested extracts at less than –65°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 322 For complete and up-to-date product information visit: www.promega.com Proteases and Surfactants rAsp-N, Mass Spec Grade Product Size Cat.# rAsp-N, Mass Spec Grade 10µg VA1160 For Research Use Only. Not for Use in Diagnostic Procedures. Description: rAsp-N, Mass Spec Grade, is a recombinant protease that was cloned from Stenotrophomonas maltophilia and purified from E. coli. rAsp-N is a highly active protease suitable for proteomic analysis of complex mixtures as well as peptide mapping of purified proteins, such as therapeutic monoclonal antibodies. The protease is provided in 10µg aliquots in a conical vial for easy and consistent resuspension. Features: • Less expensive alternative to native Asp-N • Larger volume (5X more protease) for more consistent resuspension • Use in complex proteomic analyses and peptide mapping of purified proteins Storage Conditions: Store the lyophilized product at –30°C to –10°C. Lys-C, Mass Spec Grade, and Lys-N, Mass Spec Grade Product Size Cat.# Lys-C, Mass Spec Grade 20µg VA1170 Lys-N, Mass Spec Grade 20µg VA1180 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Endoproteinase Lys-C, Mass Spec Grade, is a highly-purified serine protease that hydrolyzes specifically at the carboxyl side of lysines. Lys-C retains proteolytic activity under strong protein denaturing conditions such as 8M urea, which can be used to improve digestion of proteolytically resistant proteins. Lys-C, Mass Spec Grade, has optimal activity in the range of pH 7.0– 9.0. This protease can be used alone or in combination with other proteases to produce protein digests for peptide mapping applications or protein identification by peptide mass fingerprinting or MS/MS spectral matching. Endoproteinase Lys-N, Mass Spec Grade, is a zinc metalloprotease that cleaves at the amino side of lysines. Lys-N, Mass Spec Grade, retains proteolytic activity under strong protein denaturing conditions such as 8M urea, which can be used to improve digestion of proteolytically resistant proteins. Charged amino-terminal peptide fragments generated by Lys-N, Mass Spec Grade, are useful for de novo sequencing with ETD fragmentation techniques. Features: • Active under strong denaturing conditions • Choice of N-terminal (Lys-N) or C-terminal (Lys-C) lysine cleavage • Generates longer peptides than with tryptic digests Storage Conditions: Store the lyophilized product at –30°C to –10°C. Rapid Digestion–Trypsin and Rapid Digestion– Trypsin/Lys-C Kits Product Size Cat.# Rapid Digestion–Trypsin 100µg VA1060 Rapid Digestion–Trypsin/Lys-C 100µg VA1061 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Rapid Digestion–Trypsin and Rapid Digestion–Trypsin/Lys-C Kits are designed to shorten protein digestion times to 60 minutes versus the typical 4–18 hours required for protein digestion. Both kits contain three components: i) protease (Trypsin or Trypsin/Lys-C Mix); ii) protease Resuspension Buffer; and iii) Rapid Digestion Buffer optimized for faster digestions. Protein digestion with these kits follows a simple-to-use protocol that is both fast and efficient. The protocol is flexible, can accommodate a large range of sample volumes and protein concentrations and requires no special laboratory equipment or off-line desalting. The entire sample preparation procedure is performed in as little as 60 minutes. Features: • Faster digestion time. • Streamlined workflow. • Tighter coefficients of variation. Storage Conditions: Store at –30°C to –10°C. AccuMAP™ Low pH Protein Digestion Kit Product Size Cat.# AccuMAP™ Low pH Protein Digestion Mini Kit 1 each VA1040 AccuMAP™ Low pH Protein Digestion Maxi Kit 1 each VA1050 Available Separately AccuMAP™ Denaturing Solution 1ml VA1000 AccuMAP™ 10X Low pH Reaction Buffer 1ml VA1010 AccuMAP™ 100X Oxidation Suppressant 50µl VA1020 AccuMAP™ Low pH Resistant rLys-C Solution 120µl VA1030 TCEP 15mg VB1000 Iodoacetamide 15mg VB1010 AccuMAP™ Modified Trypsin Solution 120µl V5285 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The AccuMap™ Low pH Protein Digestion Kit is designed for accurate, reproducible characterization of biotherapeutic proteins by peptide mapping using LC/MS or UV HPLC. The entire sample preparation procedure is performed at low (mildly acidic) pH to suppress artificial deamidation and disulfide bond scrambling. The kit also contains an optional agent for suppression of protein oxidation during sample preparation. Features: • Complete sample preparation in 4.5–5 hours. • Highly reproducible digestion results. • For reduced and nonreduced proteins. Storage Conditions: Store at less than –65°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 323 22Mass Spectrometry For complete and up-to-date product information visit: www.promega.com Sequencing Grade Modified Trypsin Product Size Cat.# Sequencing Grade Modified Trypsin 100 μg V5111 100 μg V5117 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Trypsin is a serine protease that specifically cleaves at the carboxylic side of lysine and arginine residues. The stringent specificity of trypsin is essential for protein identification. Native trypsin is subject to autolysis, generating pseudotrypsin, which exhibits a broadened specificity including a chymotrypsin-like activity. Such autolysis products, present in a trypsin preparation, would result in additional peptide fragments that could interfere with database analysis of the mass of fragments detected by mass spectrometry. Sequencing Grade Trypsin has been manufactured to provide maximum specificity. Lysine residues in the porcine trypsin have been modified by reductive methylation, yielding a highly active and stable molecule that is extremely resistant to autolytic digestion. The specificity of the purified trypsin is further improved by TPCK treatment, which inactivates chymotrypsin. The treated trypsin is then purified by affinity chromatography and lyophilized. It is resistant to mild denaturing conditions such as 0.1% SDS, 1M urea or 10% acetonitrile and retains 50% of its activity in 2M guanidine HCl. The activity of trypsin is decreased when acidic residues are present on either side of a susceptible bond. If proline is at the carboxylic side of lysine or arginine, the bond is almost completely resistant to cleavage. Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Recommended Reaction Buffer: 50mM NH4 HCO3 (pH 7.8). Features: • TPCK Treatment Followed by Affinity Purification: Elimination of chymotrypsin activity enables distinct and consistent data. • Stability: Ensured up to five freeze-thaw cycles. • Reliable and Customer-Proven: Referenced in thousands of papers. • Alternative Formats: Flexibility depending on experimental design and scope. Storage Conditions: Store lyophilized at –20°C. Sequencing Grade Modified Trypsin, Frozen Product Size Cat.# Sequencing Grade Modified Trypsin, Frozen 100 μg V5113 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Trypsin is a serine protease that specifically cleaves at the carboxylic side of lysine and arginine residues. The stringent specificity of trypsin is essential for protein identification. Native trypsin is subject to autolysis, generating pseudotrypsin, which exhibits a broadened specificity including a chymotrypsin-like activity. Such autolysis products, present in a trypsin preparation, would result in additional peptide fragments that could interfere with database analysis of the mass of fragments detected by mass spectrometry. Sequencing Grade Trypsin has been manufactured to provide maximum specificity. Lysine residues in the porcine trypsin have been modified by reductive methylation, yielding a highly active and stable molecule that is extremely resistant to autolytic digestion. The specificity of the purified trypsin is further improved by TPCK treatment, which inactivates chymotrypsin. The treated trypsin is then purified by affinity chromatography. It is resistant to mild denaturing conditions such as 0.1% SDS, 1M urea or 10% acetonitrile and retains 50% of its activity in 2M guanidine HCl. The activity of trypsin is decreased when acidic residues are present on either side of a susceptible bond. If proline is at the carboxylic side of lysine or arginine, the bond is almost completely resistant to cleavage. Sequencing Grade Modified Trypsin, Frozen, is supplied in convenient 20µg aliquots as a frozen liquid in 50mM acetic acid. Recommended Reaction Buffer: 50mM NH4 HCO3 (pH 7.8). Features: • TPCK Treatment Followed by Affinity Purification: Elimination of chymotrypsin activity enables distinct and consistent data. • Stability: Ensured up to five freeze-thaw cycles. • Reliable and Customer-Proven: Referenced in thousands of papers. Storage Conditions: Store at –70°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 324 For complete and up-to-date product information visit: www.promega.com Trypsin/Lys-C Mix, Mass Spec Grade Product Size Cat.# Trypsin/Lys-C Mix, Mass Spec Grade 20 μg V5071 100 μg V5072 100 μg V5073 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Trypsin/Lys-C Mix, Mass Spec Grade, is a mixture of Trypsin Gold, Mass Spectrometry Grade, and rLys-C, Mass Spec Grade. The Trypsin/Lys-C Mix is designed to improve digestion of proteins or protein mixtures in solution. Using the conventional trypsin digestion protocol (i.e., overnight incubation at nondenaturing conditions), Trypsin/Lys-C Mix improves protein digestion by eliminating the majority of missed cleavages, which occur at prominent quantities in trypsin digests. Trypsin/Lys-C Mix enhances digestion and compensates for the trypsin proteolytic inefficiency at lysine sites. Replacing trypsin with Trypsin/Lys-C Mix in this conventional protocol leads to multiple benefits for protein analysis including more accurate mass spectrometry-based protein quantitation and improved protein mass spectrometry analytical reproducibility. Trypsin/Lys-C Mix also provides greater tolerance to trypsin-inhibiting agents, assuring efficient digestion of proteins for which protein purification is limited or not feasible. Features: • Simple to Use: Use standard overnight digestion with nondenaturing conditions. • Enhanced Proteolysis: Increase peptide recovery, resulting in enhanced protein quantitation and improved reproducibility and eliminating the majority of missed cleavages. • Tolerant to Trypsin-Inhibiting Contaminants: Generate mass spectrometry data from poor-quality sample material. Storage Conditions: Store Trypsin/Lys-C Mix, Mass Spec Grade, at –30°C to –10°C. Chymotrypsin, Sequencing Grade Product Size Cat.# Chymotrypsin, Sequencing Grade 25 μg V1061 100 μg V1062 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Chymotrypsin is a highly-purified serine endopeptidase derived from bovine pancreas that preferentially hydrolyzes at the carboxyl side of aromatic amino acids: Tyr, Phe and Trp. Cleavage may also be observed, but at a lower rate, at Leu and Met. Chymotrypsin activity is optimal in the pH range of 7.0–9.0. This sequencing grade enzyme can be used alone or in combination with other proteases to produce protein digests for peptide mapping applications or protein identification by peptide mass fingerprinting or MS/MS spectral matching. It is suitable for digestion reactions in-solution or in-gel. Storage Conditions: Store at 4°C. rLys-C, Mass Spec Grade Product Size Cat.# rLys-C, Mass Spec Grade 15 μg V1671 For Research Use Only. Not for Use in Diagnostic Procedures. Description: rLys-C, Mass Spec Grade, is a recombinant Lys-C expressed in E. coli. Sequence origin of rLys-C is Protease IV from Pseudomonas aeruginosa. Similar to a native Lys-C, rLys-C cleaves at the carboxyl side of lysine residues with exceptional specificity. rLys-C retains proteolytic activity under protein denaturing conditions such as 8M urea, which is used to improve digestion of proteolytically resistant proteins. rLys-C activity is optimal in the pH range of 8–9. The protease is supplied in a lyophilized form along with a Reconstitution Buffer, which is formulated to increase stability of rLys-C solution. Frozen rLys-C solution can be stored for a month at –20°C without detectable loss of activity. rLys-C is recommended for digestion of single proteins and complex protein mixtures in-solution and in-gel. Features: • Competitive Performance: Matches cleavage specificity of a native Lys-C. Proteolytic activity is similar. • Purity: No contaminating peptides are identified with reverse-phase HPLC. • Application-Qualified: Each lot is qualified by mass spectrometry. • Tolerance to Protein Denaturing Conditions: Retains activity in 8M urea. • Cost-Effective: Severalfold price reduction as compared to a native Lys-C. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 325 22Mass Spectrometry For complete and up-to-date product information visit: www.promega.com Arg-C, Sequencing Grade Product Size Cat.# Arg-C, Sequencing Grade 10 μg V1881 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Arg-C (clostripain) is an endopeptidase that cleaves at the C terminus of arginine residues, including the sites next to proline. Cleavage also will occur at lysine residues. This sequencing grade enzyme can be used alone or in combination with other proteases for protein analysis by mass spectrometry and other applications. Arg-C activity is optimal in the pH range of 7.6–7.9. Storage Conditions: Store at 2–10°C. Asp-N, Sequencing Grade Product Size Cat.# Asp-N, Sequencing Grade 2 μg V1621 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Asp-N, Sequencing Grade, is an endoproteinase that hydrolyzes peptide bonds on the N-terminal side of aspartic and cysteic acid residues: Asp and Cys. Asp-N activity is optimal in the pH range of 4.0–9.0. This sequencing grade enzyme can be used alone or in combination with other proteases to produce protein digests for peptide mapping applications or protein identification by peptide mass fingerprinting or MS/MS spectral matching. It is suitable for digestion reactions in solution or in gel. Storage Conditions: Store at 4°C. Glu-C, Sequencing Grade Product Size Cat.# Glu-C, Sequencing Grade 50 μg V1651 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Glu-C, Sequencing Grade (S. aureus V8), is a serine protease that specifically cleaves at the C terminus of either aspartic or glutamic acid residues. In ammonium bicarbonate and ammonium acetate the enzyme specificity is higher at the glutamic residues. In phosphate buffers cleavage occurs at the aspartic and glutamic residues. Glu-C activity is optimal in the pH range of 4.0–9.0. This sequencing grade enzyme can be used alone or in combination with other proteases to produce protein digests for peptide mapping applications or protein identification by peptide mass fingerprinting or MS/MS spectral matching. It is suitable for digestion reactions in solution but not recommended for in-gel digestions. Storage Conditions: Store at 2–10°C. Elastase Product Size Cat.# Elastase 5 mg V1891 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Elastase is a serine protease that preferentially cleaves at the C terminus of alanine, valine, serine, glycine, leucine or isoleucine. Elastase has a unique capability of digesting elastin. This enzyme can be used alone or in combination with other proteases for protein analysis by mass spectrometry and other applications. Elastase activity is optimal at pH 9.0. Storage Conditions: Store at 2–10°C. Pepsin Product Size Cat.# Pepsin 250 mg V1959 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Pepsin preferentially cleaves at the C terminus of phenylalanine, leucine, tyrosine and tryptophan. This protease can be used alone or in combination with other proteases for protein analysis by mass spectrometry and other applications. Pepsin activity is optimal at pH 1.0–3.0. Storage Conditions: Store at 2–10°C. Thermolysin Product Size Cat.# Thermolysin 25 mg V4001 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Thermolysin is a thermostable metalloproteinase. The high digestion temperatures may be used as an alternative to denaturants to improve digestion of proteolytically resistant proteins. Thermolysin preferentially cleaves at the N terminus of the hydrophobic residues leucine, phenylalanine, valine, isoleucine, alanine and methionine. The optimal digestion temperature range is 65–85°C. Thermolysin activity is optimal at pH 5.0–8.5. Storage Conditions: Store at –30 to –10°C. Immobilized Trypsin Product Size Cat.# Immobilized Trypsin 2 ml V9012 4 ml V9013 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Immobilized Trypsin provides a fast and convenient method for digesting a range of concentrations of purified protein or complex protein mixtures. Digested peptides are easily separated from the Immobilized Trypsin as they flow through the spin column into the collection tube. Immobilized Trypsin is easily removed from the peptide solution because the trypsin does not pass though the column frit. Trypsin is a proteolytic enzyme, which cleaves at the carboxyl side of positively charged Lysine (Lys) and Arginine (Arg). When these amino acids are followed by the nonpolar Proline (Pro), the digestion of the site is not efficient. When Lys and Arg are followed by acids [Aspartic Acid (Asp) and Glutamic Acid (Glu)] the digestion is also not as efficient. Features: • Fast: Digestions can be accomplished in as little as 30 minutes. • Scalable: Easily adjustable protocol to accommodate various protein concentrations. • Easy to Use: No shaking or water baths necessary. Storage Conditions: Store at 4°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 326 For complete and up-to-date product information visit: www.promega.com Trypsin Gold, Mass Spectrometry Grade Product Size Cat.# Trypsin Gold, Mass Spectrometry Grade 100 μg V5280 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Trypsin is a serine protease that specifically cleaves at the carboxylic side of lysine and arginine residues. The stringent specificity of trypsin is essential for protein identification. Native trypsin is subject to autolysis, generating pseudotrypsin, which exhibits a broadened specificity including a chymotrypsin-like activity. Such autolysis products, present in a trypsin preparation, would result in additional peptide fragments that could interfere with database analysis of the mass of fragments detected by mass spectrometry. Trypsin Gold, Mass Spectrometry Grade, is manufactured to provide maximum specificity. Lysine residues in the porcine trypsin have been modified by reductive methylation, yielding a highly active and stable molecule that is extremely resistant to autolytic digestion. The specificity of the purified trypsin is further improved by TPCK treatment, which inactivates chymotrypsin. The treated trypsin is then purified by affinity chromatography and lyophilized to yield Trypsin Gold, Mass Spectrometry Grade. It is resistant to mild denaturing conditions such as 0.1% SDS, 1M urea or 10% acetonitrile and retains 50% of its activity in 2M guanidine HCl. The activity of trypsin is decreased when acidic residues are present on either side of a susceptible bond. If proline is at the carboxylic side of lysine or arginine, the bond is almost completely resistant to cleavage. Each lot of quality-tested Trypsin Gold, Mass Spectrometry Grade, is qualified for use with in-gel digestion and mass spectrometric analysis. Learn more about our custom options for this product at: www.promega.com/custom/ Features: • Each Lot Qualified by Mass Spectrometry: Ensures compatibility with customer applications/instrumentation. • TPCK Treatment Followed by Affinity Purification: Elimination of chymotrypsin activity enables distinct and consistent data. • Stability Ensured up to Five Freeze-Thaw Cycles: Minimize leftover reagents. • Referenced in Thousands of Papers: Reliable and customer proven. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store the lyophilized powder at –20°C. Reconstitute powder in 50mM acetic acid and store at –20°C. For long-term storage, freeze reconstituted trypsin at –70°C. Limit the number of freeze-thaw cycles to five. Glycosidases Product Size Conc. Cat.# Endo H 10,000 units 500 u/µl V4871 50,000 units 500 u/µl V4875 Fetuin 500 μg 10 mg/ml V4961 PNGase F 500 units 10 u/µl V4831 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Endoglycosidase H (Endo H) is a recombinant glycosidase cloned from Streptomyces plicatus and overexpressed in E. coli. Endo H cleaves the chitobiose core of high mannose and a limited number of hybrid oligosaccharides from N-linked glycoproteins. It does not cleave complex glycans. Enzymatic cleavage is between the two N-acetylglucosamine residues in the diacetylchitobiose core of the oligosaccharide, leaving one N-acetylglucosamine residue on the asparagine. This is in contrast to PNGase F, which cleaves all asparagine-linked oligosaccharides. Unit Definition: One unit is defined as the amount of enzyme required to remove >95% of the carbohydrate from 10μg of denatured RNase B in 1 hour at 37°C in a total reaction volume of 10μl. Fetuin is a glycoprotein with O-linked and N-linked glycosylation sites. PNGase F is a recombinant glycosidase cloned from Elizabethkingia miricola and overexpressed in E. coli. PNGase F has a molecular weight of 36kDa. Storage Conditions: Store Endo H and Fetuin at –30 to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 327 22Mass Spectrometry For complete and up-to-date product information visit: www.promega.com ProTEV Plus Product Size Conc. Cat.# ProTEV Plus 1,000 u 5 u/µl V6101 8,000 u 5 u/µl V6102 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ProTEV Plus is an improved 48kDa version of the Nla protease from tobacco etch virus (TEV) that has been engineered to be more stable than native TEV protease for prolonged enzymatic activity. It is a highly specific proteolytic enzyme that cleaves within a seven-amino-acid sequence (ENLYFQ(G/S)). ProTEV Plus is active over a wide range of pH values (5.5–8.5) and temperatures (4–30°C). It can be used to cleave protein fusions that have been engineered with the above amino acid sequence at the desired cleavage site. The enzyme is compatible for both in-solution and on-column cleavage reactions. ProTEV Plus also contains an HQ tag (analogous to His tag) located at the N terminus of the protein, which allows it to be immobilized on Ni-based affinity resins and removed from the cleavage reaction. Learn more about our custom options for this product at: www.promega.com/custom/ Features: • Active Over a Wide Range of pH and Temperatures: Cleave individual fusion proteins using optimal conditions to maintain activity and correct conformation. • HQ-Tagged: Convenient removal of ProTEV Plus using Ni-based affinity resins after cleavage. • Specific: Highly specific and active for its seven-amino acid sequence with minimal off-target effects. • Cleaves Fusion Proteins Directly in Solution or Immobilized on Affinity Resins: ProTEV Plus is easy to use in multiple experimental formats. Storage Conditions: Store at –20°C. ProteaseMAX™ Surfactant, Trypsin Enhancer Product Size Cat.# ProteaseMAX™ Surfactant, Trypsin Enhancer 1 mg V2071 5 × 1 mg V2072 For Research Use Only. Not for Use in Diagnostic Procedures. Description: ProteaseMAX™ Surfactant, Trypsin Enhancer, is designed to improve in-gel and in-solution protein digestion. ProteaseMAX™ Surfactant ensures fast and efficient protein digestion with proteases such as Trypsin, Chymotrypsin and Lys-C. For in-gel protein digestion, ProteaseMAX™ Surfactant offers time and labor savings. Digestion step is complete in 1 hour, and the surfactant provides concurrent extraction of peptides from gels, eliminating the need for post-digestion peptide extraction. The surfactant also improves recovery of longer peptides that are retained in the gel under a standard extraction protocol. For in-solution digestions, ProteaseMAX™ Surfactant solubilizes proteins, including difficult proteins (i.e., membrane proteins), and enhances protein digestion by providing a denaturing environment prior to protease addition. ProteaseMAX™ Surfactant degrades over the course of a digestion reaction, yielding products that are compatible with downstream methods such as mass spectrometry (MS) and liquid chromatography (LC). No long-term negative effect of the residual surfactant on the ion optics and capillary of mass spectrometers has been observed. ProteaseMAX™ Surfactant can be used with existing in-gel or in-solution digestion protocols. Features: • No Peptide Extraction Required Following In-Gel Digestions: Save time and increase the number of samples processed. • Improved Peptide Recovery from Gels: Increase protein sequence coverage, thus increasing confidence of protein identification. • Enhanced Protein Solubilization: Solubilize complex proteins, such as membrane proteins, at room temperature, avoiding high temperature and preventing precipitation. • Degrades Over Course of Digestion: Samples are ready for use directly for mass spectrometry analysis without additional inactivation steps such as heating or acid treatment. Storage Conditions: Store lyophilized ProteaseMAX™ Surfactant at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 328 For complete and up-to-date product information visit: www.promega.com Proteinase K (Lyophilized) Product Size Cat.# Proteinase K 100 mg V3021 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Proteinase K, produced by the fungus Tritirachium album Limber, is a serine protease that exhibits broad cleavage activity. It cleaves peptide bonds adjacent to the carboxylic group of aliphatic and aromatic amino acids and is useful for general digestion of protein in biological samples. It has been purified to remove RNase and DNase activities. The stability of Proteinase K in urea and SDS and its ability to digest native proteins make it useful for a variety of applications including preparation of chromosomal DNA for pulsedfield gel electrophoresis, protein fingerprinting and removal of nucleases from preparations of DNA and RNA. A typical working concentration for Proteinase K is 50–100μg/ml. Form: Lyophilized powder. Recommended Reaction Buffer: 50mM Tris-HCl (pH 8.0), 10mM CaCl2 . Features: • Stable: Active over a pH range of 4.3–12.0, in 0.5% SDS or 1% Triton® X-100 and retains >80% of its activity at temperatures up to 60°C. Storage Conditions: Store lyophilized powder desiccated at –20°C. IdeS Protease and IdeZ Protease Product Size Conc. Cat.# IdeS Protease 5,000 units V7511 IdeS Protease 25,000 units V7515 IdeZ Protease 5,000 units V8341 IdeZ Protease, Frozen 2,000 units 50 u/µl V8342 IdeZ Protease 25,000 units V8345 For Research Use Only. Not for Use in Diagnostic Procedures. Description: IdeS Protease IdeS Protease is an immunoglobulin-degrading enzyme from Streptococcus pyogenes (IdeS). It is an engineered recombinant protease overexpressed in E. coli that cleaves Immunoglobulin G (IgG) with high specificity at a single site below the hinge region, yielding F(ab´)2 and Fc fragments. The protocol for a standard reaction is to add the IdeS Protease to the IgG sample, add 1 unit of IdeS Protease per 1µg of IgG to be digested and incubate the sample at 37°C for 30–60 minutes in a neutral pH buffer. IdeZ Protease IdeZ Protease is an immunoglobulin-degrading enzyme from Streptococcus equi subspecies zooepidemicus. It is an engineered recombinant protease overexpressed in E. coli. Like IdeS Protease, IdeZ Protease specifically cleaves IgG molecules below the hinge region to yield F(ab´) 2 and Fc fragments. However, IdeZ Protease has significantly improved activity against mouse IgG2a and IgG3 subclasses compared to IdeS Protease. Features: • See Digestion in 30 Minutes with No Optimization: Fast and easy to use. • Cleave Exclusively at a Single Site Below the Hinge to Produce F(ab´)2 and Fc Fragments: Highly reproducible and specific. • Expect High Performance: Essentially 100% complete digestion. • Effectively Cleave Many IgG Molecules: Both IdeS and IdeZ Proteases effectively cleave human IgG1, IgG2, IgG3 and IgG4, monkey, sheep, rabbit, humanized and chimeric IgGs as well as Fc-fusion proteins. However, mouse IgG2a and IgG3 are cleaved by IdeZ Protease only. Storage Conditions: Store IdeS Protease at –30°C to –10°C. Store IdeZ Protease at –30°C to –10°C. Factor Xa Protease Product Size Cat.# Factor Xa Protease 50 μg V5581 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Factor Xa Protease is purified from bovine plasma and activated by treatment with the activating enzyme from Russell’s viper venom. Factor Xa Protease preferentially cleaves after the arginine residue in the amino acid sequence Ile-Glu-Gly-Arg. Recommended Reaction Buffer: 20mM Tris-HCl (pH 7.4), 0.1M NaCl. Storage Conditions: Store in aliquots at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 329 23 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Protein Expression Cell-Based Protein Expression 330 Eukaryotic Cell-Free Protein Expression 331 Prokaryotic Cell-Free Protein Expression 337 Protein Expression Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 330 For complete and up-to-date product information visit: www.promega.com Cell-Based Protein Expression Regulated Mammalian Expression System Product Size Cat.# Regulated Mammalian Expression System 1 system C9470 Coumermycin A1 5 mg C9451 Novobiocin Sodium Salt 1 g C9461 Available Separately pReg neo Vector 20 μg C9421 pF12A RM Flexi® Vector 20 μg C9431 pF12K RM Flexi® Vector 20 μg C9441 C9421, C9470, C9431, C9451, C9441 For Research Use Only. Not for Use in Diagnostic Procedures. C9461 For Research Use Only. Not for Use in Therapeutic or Diagnostic Procedures. Description: The Regulated Mammalian Expression System features low basal levels, robust and rapid induction, and downregulation of gene expression in mammalian cells. The Regulated Mammalian Expression System is based on a novel on/off switch that relies on the rapid and sensitive modulation by coumerin-related compounds of a chimeric transactivator protein. Nanomolar concentrations of the antibiotic coumermycin promote homodimerization of a chimeric transactivator that, in turn, binds to lambda operator sequences located upstream of a minimal promoter driving transcription of coding sequences for a protein of interest. The levels of protein expression can be regulated by adjusting the coumermycin concentration. More significantly, this expression can be promptly and effectively switched off by adding novobiocin, which acts as an antagonist by dissociating the dimerized transactivator protein. The protein coding region of interest is cloned into either the pF12A RM Flexi® Vector or pF12K RM Flexi® Vector, both of which are specially designed for Regulated Mammalian (RM) protein expression. These vectors incorporate regulatory promoter sequences upstream of the protein-coding region and are compatible with the Flexi® Vector System. In transient transfection paradigms, the pF12A or pF12K RM Flexi® Vector containing the protein-coding region of interest is co-transfected into mammalian cells together with the pReg neo Vector. The pReg neo Vector is designed to express a chimeric transactivator protein that interacts with the regulatory promoter region in the pF12A and pF12K RM Flexi® Vectors in a regulated fashion in response to coumermycin and novobiocin. Additionally, the pReg neo Vector encodes a neomycin phosphotransferase gene that allows stable cell selection and generation with the antibiotic G-418. Features: • Enhanced Data: High level of controlled induction combined with low basal protein expression. • Regulated Expression: Dose-response induction of protein expression; rapid and sensitive on/off switch for protein expression. • Versatility: Compatible with other Flexi® Vectors. Storage Conditions: Store at –20°C. Single Step (KRX) Competent Cells Product Size Cat.# Single Step (KRX) Competent Cells 20 × 50 μl L3002 L-Rhamnose Monohydrate 10 g L5701 50 g L5702 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Single Step (KRX) Competent Cells are designed for efficient transformation and tightly controlled protein expression. These cells consolidate the best attributes of these two steps into one strain to evaluate protein expression in E. coli. Transformation efficiencies are greater than 108 cfu/μg, similar to other highly competent cells. The single step cells are available in single transformation size (50μl). KRX also can be used for blue/white screening. Single Step (KRX) is an E. coli K strain that contains a chromosomal copy of the T7 RNA polymerase driven by a rhamnose promoter (rhaBAD) to provide dramatic control of the proteins expressed via a T7 promoter. Pre-induced expression protein levels are significantly lower than those of BL21(DE3)- derived strains. This feature facilitates cloning and expression of proteins toxic to E. coli. Genotype: [F´, traD36, ΔompP, proA+B+, lacI q , Δ(lacZ)M15] ΔompT, endA1, recA1, gyrA96 (Nalr ), thi-1, hsdR17 (rk – , mk +), e14– (McrA– ), relA1, supE44, Δ(lac-proAB), Δ(rhaBAD)::T7 RNA polymerase. Features: • Save Time: In two days, you can transform your vector into the Single Step (KRX) Competent Cells and be ready for protein expression. • Controlled Protein Expression: For overall expression of cloned proteins, the Single Step (KRX) Competent Cells provide dramatic control of expressed protein-coding regions. • Achieve High Yields: Protein expression levels were shown to be as high as or higher than levels expressed in BL21(DE3)-derived strains. • Blue/White Screening: Convenient method for detecting recombinant clones. Storage Conditions: Always store competent cells at –70°C. Thaw on ice when ready for use. Do not refreeze thawed, unused aliquots. BL21(DE3)pLysS Competent Cells Product Size Cat.# Single-Use BL21(DE3)pLysS Competent Cells 1 ml L1195 BL21(DE3)pLysS Competent Cells, >106 cfu/μg 1 ml L1191 For Research Use Only. Not for Use in Diagnostic Procedures. Description: BL21(DE3)pLysS Competent Cells allow high-efficiency protein expression of any gene that is under the control of a T7 promoter and has a ribosome binding site. BL21(DE3)pLysS is lysogenic for λ-DE3, which contains the T7 bacteriophage gene I, encoding T7 RNA polymerase under the control of the lac UV5 promoter. BL21(DE3)pLysS also contains a plasmid, pLysS, which carries the gene encoding T7 lysozyme. T7 lysozyme lowers the background expression level of target genes under the control of the T7 promoter but does not interfere with the level of expression achieved following induction by IPTG. For researchers doing more than one transformation, competent cells are available in standard format (200µl aliquots). For added convenience, single-use competent cells (50µl aliquots) also are offered. Genotype: F–, ompT, hsdSB (rB –, mB –), dcm, gal, λ(DE3), pLysS, Cmr . Features: • T7 RNA Polymerase Under the Control of the lac UV5 Promoter: Inducible protein expression. • Deficient in Proteases lon and OmpT: Increased stability of expressed protein. • pLysS Plasmid: Lower background expression of target genes. Storage Conditions: Store at –70°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 331 23Protein Expression For complete and up-to-date product information visit: www.promega.com Eukaryotic Cell-Free Protein Expression TnT® T7 Insect Cell Extract Protein Expression System Product Size Cat.# TnT® T7 Insect Cell Extract Protein Expression System 10 reactions L1101 40 reactions L1102 pF25A ICE T7 Flexi® Vector 20 μg L1061 pF25K ICE T7 Flexi® Vector 20 μg L1081 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The TnT® T7 Insect Cell Extract Protein Expression System is a convenient, quick, single-tube, coupled transcription/translation system for the cell-free expression of proteins. Protein synthesis reactions are initiated by the addition of a DNA template, eliminating the need for the time-consuming process of in vitro RNA synthesis. The extract is made from the commonly used Spodoptera frugiperda Sf21 cell line. All components necessary for the transcription/translation are present in the TnT® T7 ICE Master Mix. To initiate protein synthesis, the only component that must be added is the DNA template. Reactions are incubated at 28–30°C and are complete within 4 hours. Proteins are expressed from genes cloned downstream of the T7 promoter. Companion vectors have been designed to achieve optimal yield with this system (pF25A and pF25K). They contain untranslated region (UTR) sequences at the 5´ and 3´ ends of the gene coding region to enhance translation efficiency. Using the TnT® T7 Insect Cell Extract Protein Expression System and these vectors, 75μg/ml of functional protein can be produced. Features: • Obtain Data Faster: Protein is expressed in only 4 hours, not days as with cell-based expression. • Complete System: No requirement to purchase additional reagents. • Achieve High Protein Yields: Express up to 75μg/ml of protein for multiple applications. Storage Conditions: Store at –70°C. TnT® SP6 High-Yield Wheat Germ Protein Expression System Product Size Cat.# TnT® SP6 High-Yield Wheat Germ Protein Expression System 40 reactions L3260 10 reactions L3261 Available Separately TnT® SP6 High-Yield Master Mix Minus Amino Acids 1 ml X808X For Research Use Only. Not for Use in Diagnostic Procedures. Description: The TnT® SP6 High-Yield Wheat Germ Protein Expression System, based on an optimized wheat germ extract, is a single-tube, coupled transcription/translation system designed to express proteins in only two hours. Protein synthesized, in the range of 10–100μg/ml, can be used in multiple proteomic-based applications, as well as in high-throughput analysis. All components necessary for transcription/translation are provided in the extract, with the exception of the plasmid DNA or PCR template. Optional protein-labeling reagents must also be supplied by the user. For custom wheat germ extract (depleted amino acids), order Cat.# X808X (see Products, Available Separately). Features: • Save Time: You can generate protein in only two hours, as compared to days when using cell-based (E. coli) systems. • Choose Your Format: Use plasmid or PCR-generated templates to generate protein. • Achieve High Yields: Generate 10- to 20-fold more protein (10–100μg/ml) when compared to other cell-free systems. • Generate Usable Protein: Generate soluble, full-length protein and avoid problems associated with E. coli systems. Storage Conditions: Store at –70°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 332 For complete and up-to-date product information visit: www.promega.com TnT® Quick Coupled Transcription/Translation System Product Size Conc. Cat.# TnT® T7 Quick Coupled Transcription/Translation System 40 reactions L1170 TnT® T7 Quick Coupled Transcription/Translation System, Trial Size 5 reactions L1171 TnT® SP6 Quick Coupled Transcription/Translation System 40 reactions L2080 TnT® SP6 Quick Coupled Transcription/Translation System, Trial Size 5 reactions L2081 Magnesium Acetate 100 μl 25 mM L4581 Potassium Chloride 200 μl 2.5 M L4591 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The TnT® Quick Systems are convenient single-tube, coupled transcription/translation reactions for eukaryotic cell-free protein expression. These cell-free expression systems combine the RNA Polymerase, nucleotides, salts, amino acids and Recombinant RNasin® Ribonuclease Inhibitor with the reticulocyte lysate solution to form a single TnT® Quick Master Mix. The TnT® Quick Coupled Transcription/Translation System is available in two configurations for the expression of genes cloned downstream from either the T7 or SP6 RNA polymerase promoters. To use these cell-free expression systems, 0.2–2.0μg of circular plasmid DNA containing a T7 or SP6 promoter, or a PCR-generated fragment containing a T7 promoter, is added to an aliquot of the TnT® Quick Master Mix and incubated in a 50μl reaction volume for 60–90 minutes at 30°C. The expression reaction produces significant quantities of protein for a variety of applications including GST pull-downs and gel shift assays. Features: • Obtain Data Faster: Functional protein is expressed in only one hour, not days as with cell-based expression systems. • Multiple Applications with One System: Use expressed protein for the characterization of protein:protein interaction, protein:nucleic acid interaction, protein modification and more. • Consistent, Reliable Results: This mammalian-based system expresses soluble, functional proteins that are post-translationally modified, unlike E. coli-based systems. • Fewer Steps: Expressed proteins can be used directly after expression; no requirement for additional purification. • Flexible Systems Available: TnT® Systems for linear, circular or PCR templates are available. Storage Conditions: Store at –70°C. Do not freeze-thaw the lysate more than two times. TnT® Coupled Reticulocyte Lysate Systems Product Size Cat.# TnT® SP6 Coupled Reticulocyte Lysate System 40 reactions L4600 TnT® SP6 Coupled Reticulocyte Lysate System, Trial Size 8 reactions L4601 TnT® T7 Coupled Reticulocyte Lysate System 40 reactions L4610 TnT® T7 Coupled Reticulocyte Lysate System, Trial Size 8 reactions L4611 TnT® T3 Coupled Reticulocyte Lysate System 40 reactions L4950 TnT® T7/T3 Coupled Reticulocyte Lysate System 40 reactions L5010 TnT® T7/SP6 Coupled Reticulocyte Lysate System 40 reactions L5020 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The TnT® Coupled Reticulocyte Lysate Systems offer researchers an alternative for eukaryotic cell-free protein expression: a single-tube, coupled transcription/translation system. The TnT® Lysate Systems greatly simplify the process and reduce the time required to obtain in vitro translation results. Standard rabbit reticulocyte lysate translations commonly use RNA synthesized in vitro from SP6, T3 or T7 RNA polymerase promoters and require three separate reactions with several steps between each reaction. The TnT® Systems bypass many of these steps by incorporating transcription directly in the translation mix. For optimal protein expression using the TnT® SP6 RNA polymerase, we recommend titrating magnesium acetate in 0.1mM increments between 0.1mM and 0.5mM. In some instances the addition of 0.2mM magnesium acetate has been shown to increase protein expression by 40%. Magnesium acetate is supplied only with Cat.# L4600 and L4601. Features: • Use in Multiple Applications: The TnT® Systems are widely used for protein:protein interaction, protein:nucleic acid interactions, and more. • Save Time: Using a one-tube reaction, proteins are generated in one hour, not days, as with in vivo methods. • Complete System: All the reagents you need are provided (except radioisotopes). • Reliable: Eliminate solubility issues by using an in vitro mammalian system. • Dependability You Can Count On: The TnT® Systems are rigorously quality controlled to ensure the highest level of performance. Storage Conditions: Store the polymerase at –20 to –70°C. Store Luciferase Assay Wells at room temperature. Store the other components at –70°C. Do not freeze-thaw the lysate more than two times. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 333 23Protein Expression For complete and up-to-date product information visit: www.promega.com TnT® Coupled Wheat Germ Extract System Product Size Cat.# TnT® SP6 Coupled Wheat Germ Extract System 40 reactions L4130 TnT® T7 Coupled Wheat Germ Extract System 40 reactions L4140 TnT® T7/SP6 Coupled Wheat Germ Extract System 40 reactions L5030 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The TnT® Coupled Wheat Germ Extract Systems offer researchers an alternative for eukaryotic cell-free protein expression: a one-tube, coupled transcription/translation system. The TnT® Extract Systems greatly simplify the process and reduce the time required to obtain in vitro translation results. Standard wheat germ extract translations commonly use RNA synthesized in vitro from SP6 or T7 RNA polymerase promoters. This entire process requires separate reactions with several steps between each reaction. The TnT® Extracts bypass many of these steps by incorporating transcription directly in the translation mix. Additionally, the TnT® Extract reactions often produce significantly more protein (two- to sixfold) in a 1.5-hour reaction than do standard in vitro wheat germ extract translations using RNA templates. Magnesium Acetate, 25mM, and Potassium Chloride, 2.5M, can be used to optimize in vitro translation reactions in the TnT® T7 Quick Coupled Transcription/Translation System, Flexi® Rabbit Reticulocyte Lysate System and TnT® Coupled Wheat Germ Extract System. Features: • Reliable: The TnT® Systems are rigorously quality controlled to ensure the highest level of transcription/translation, whether your template is a linear (T7 only) or circular plasmid. • Convenient: Single-tube procedure eliminates the time and effort required to prepare RNA for a standard wheat germ translation. Translation results can be visualized by autoradiography in 6–8 hours. • Versatile: The T7 system will produce protein from linear DNA. The SP6 system will produce protein from circular DNA. For PCR templates use TnT® T7 Quick for PCR DNA (Cat.# L5540). • Controls Included: Luciferase Control DNA and Luciferase Assay Reagents are included with the system as functional controls. Only fulllength luciferase is active. Storage Conditions: Store the polymerase at –20°C. Store the Luciferase Assay Wells at room temperature. Store the other components at –70°C. Avoid multiple freeze-thaw cycles. TnT® Starter Bundle Product Size Cat.# TnT® T7 Quick Starter Bundle, Chemiluminescent 1 each L1210 TnT® T7 Quick Starter Bundle, Colorimetric 1 each L1215 For Research Use Only. Not for Use in Diagnostic Procedures. Products may not be available in all countries. Please contact your local representative for more information. Description: Get the tools you need in one bundle to start cell-free expression and detection of your proteins of interest. Use the system for in vitro analysis of protein:protein or protein:nucleic acid interactions, or simply verify the ability of your clone to express protein. Purchase this special bundle, and get the popular TnT® T7 Quick Coupled Transcription/Translation System, your choice of Transcend™ Translation Detection System, and receive two cell-free expression-qualified expression vectors, pTnT™ and pCMVTnT™ Vectors, at no extra cost. Features: • TnT® T7 Quick Coupled Transcription/Translation System: Our most popular cell-free translation system—a simple one-hour, one-tube reaction. Requires only a protein coding sequence downstream of a T7 RNA polymerase promoter to produce protein. Produced protein may be used in a variety of applications including pull-downs, immunoprecipitations and gel shift assays. TnT® T7 Quick Coupled Transcription/Translation System Technical Manual #TM045. • Transcend™ Translation Detection Systems: A simple addition of the Transcend biotin-labeled lysine tRNA to the TnT® T7 Quick reaction provides a simple means of tagging a protein for easy detection. Detect proteins through simple Western blotting techniques with either chemiluminescent or colorimetric techniques. Transcend™ Translation Detection Systems Technical Bulletin #TB182. • pTnT™ Vector: Specifically designed to work with the TnT® Systems with added features to enhance cell-free expression. pTnT™ Vector Technical Bulletin #TB304. • pCMVTnT™ Vector: Specifically designed to work with the TnT® Systems with added features to enhance cell-free expression. Go from cell-free expression to mammalian expression directly with built-in CMV promoter. pCMVTnT™ Vector Technical Bulletin #TB305. Storage Conditions: Store the TnT® Quick System at –70°C. Do not freezethaw the lysate more than two times. Store the Transcend™ tRNA at –70°C. Do not subject the Transcend™ tRNA to more than five freeze-thaw cycles. Store all other Transcend™ System components at 4°C. Store the pTnT™ and pCMVTnT™ Vectors at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 334 For complete and up-to-date product information visit: www.promega.com pCMVTnT™ and pTnT™ Vectors Product Size Cat.# pCMVTnT™ Vector 20 μg L5620 pTnT™ Vector 20 μg L5610 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The pCMVTnT™ and pTnT™ Vectors are designed for onvenient expression of cloned genes in vitro or in vivo. SP6 and T7 promoters allow expression from SP6- or T7-based coupled in vitro transcription/translation systems. The presence of RNA phage promoters also allows highly efficient synthesis of RNA in vitro. Both vectors contain a 5´ β-globin leader sequence and synthetic poly(A)30 tail, which have been shown to enhance expression of certain genes. For in vivo expression, the pCMVTnT™ Vector contains a CMV enhancer/ promoter region, which allows strong constitutive expression in many cell types. Features: • Flexible: Tandem SP6 and T7 phage promoters allow use in the appropriate in vitro translation or transcription system. • Convenient: Multiple cloning site provides a selection of restriction sites. • In Vivo Expression: The CMV enhancer/promoter region in the pCMVTnT™ Vector allows strong constitutive expression in many cell types. Storage Conditions: Store at –20°C. TnT® T7 Quick for PCR DNA Product Size Cat.# TnT® T7 Quick for PCR DNA 40 reactions L5540 For Research Use Only. Not for Use in Diagnostic Procedures. Description: TnT® T7 Quick for PCR DNA is a rapid, convenient, coupled transcription/translation system designed for optimum protein expression from PCR templates. For most PCR templates, the TnT® T7 Quick for PCR DNA reactions produce up to 5 times more protein than other commercially available kits. The PCR-generated DNA can be used directly from the amplification reaction or purified by numerous commercially available kits and traditional methods. Features: • Convenient: Directly from PCR, no cleanup necessary. • High Yield: Up to 5 times more expressed protein than standard translation reactions with linear templates. • Quick: One-tube reaction. • Complete: Reagents including Recombinant RNasin® Ribonuclease Inhibitor are included in the Quick Master Mix. • Good Value: One-tube format means no leftover reagents. • Reliable: The TnT® Systems are rigorously quality controlled to ensure the highest level of transcription/translation. Storage Conditions: Store at –70°C. Do not freeze-thaw the Master Mix more than two times. Rabbit Reticulocyte Lysate System, Nuclease Treated Product Size Cat.# Rabbit Reticulocyte Lysate System, Nuclease Treated 30 reactions L4960 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Rabbit Reticulocyte Lysate Translation Systems are utilized in the identification of mRNA species, the characterization of their protein products and the investigation of transcriptional and translational control. Rabbit Reticulocyte Lysate is prepared from New Zealand white rabbits using a standard protocol that ensures reliable and consistent reticulocyte production in each lot. After the reticulocytes are lysed, the extract is treated with micrococcal nuclease to destroy endogenous mRNA and thus reduce background translation to a minimum. The lysate contains the cellular components necessary for protein synthesis (tRNA, ribosomes, amino acids, initiation, elongation and termination factors). Features: • Consistent: Reliable and consistent translation with each lot. • Optimized and Ready to Use: The treated Rabbit Reticulocyte Lysate is optimized for translation and contains an energy-regenerating system (phosphocreatine/phosphocreatine kinase), a mixture of tRNAs (to expand the range of mRNAs that can be translated), hemin (to prevent inhibition of initiation), and potassium chloride and magnesium acetate. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –70°C or below. Do not freeze-thaw the lysate more than two times. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 335 23Protein Expression For complete and up-to-date product information visit: www.promega.com Flexi® Rabbit Reticulocyte Lysate System Product Size Cat.# Flexi® Rabbit Reticulocyte Lysate System 30 reactions L4540 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Flexi® Rabbit Reticulocyte Lysate System allows translation reactions to be optimized for a wide range of parameters, including Mg2+ and K+ concentrations and the choice of adding DTT. To help optimize Mg2+ for a specific message, the endogenous Mg2+ concentration of each lysate batch is stated in the product information included with this product. The Flexi® System also offers the choice of three amino acid mixtures and includes a control RNA encoding the firefly luciferase gene. Features: • Improved Efficiency: In an optimized system, the quantity of protein produced can be increased as much as fourfold over that of a standard lysate reaction. • Easy Optimization: To aid in optimizing magnesium concentrations, the endogenous magnesium concentration is provided for each lot of Flexi® Lysate. • Choice: The Flexi® System contains three Amino Acid Mixtures, which enable different choices of radioisotopes. • Control Included: Luciferase Control RNA and Luciferase Assay Reagent are included with the system as a functional control. Only full-length luciferase is active. Storage Conditions: Store at –70°C, except Luciferase Assay Wells, which can be stored at room temperature. Do not freeze-thaw the lysate more than two times. Rabbit Reticulocyte Lysate/Wheat Germ Extract Combination System Product Size Cat.# Rabbit Reticulocyte Lysate/Wheat Germ Extract Combination System 24 reactions L4330 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Rabbit Reticulocyte Lysate/Wheat Germ Extract Combination System contains both Rabbit Reticulocyte Lysate and Wheat Germ Extract for comparing in vitro translation systems. Reticulocyte Lysate is prepared from New Zealand white rabbits. The Wheat Germ Extract is prepared by grinding wheat germ in an extraction buffer followed by centrifugation to remove cellular debris. Both systems contain the cellular components necessary for protein synthesis. The systems have been treated with micrococcal nuclease, which destroys endogenous mRNA and results in minimal background translation. Features: • Choice: Test both Rabbit Reticulocyte Lysate and Wheat Germ Systems to find optimal translation systems. • Consistent: Rigorous quality control ensures minimal lot-to-lot variability. • Optimal Expression: Potassium Acetate is provided to enhance the Wheat Germ Extract System for a wide range of mRNAs. Storage Conditions: Store at –70°C or below. Do not freeze-thaw the lysate more than two times. Wheat Germ Extract Product Size Cat.# Wheat Germ Extract 5 × 200 μl L4380 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Wheat Germ Extract contains the cellular components necessary for protein synthesis (tRNA, ribosomes, initiation, elongation and termination factors). Wheat Germ Extract is prepared by grinding wheat germ in an extraction buffer followed by centrifugation to remove cell debris. The supernatant is subjected to chromatography that separates endogenous amino acids and plant pigments from the extract. The extract is also treated with micrococcal nuclease to destroy endogenous mRNA and thus reduce background translation to a minimum. Features: • Optimized: Extract contains an energy-regenerating system (phosphocreatine/phosphocreatine kinase), spermidine (to stimulate the efficiency of chain elongation), magnesium acetate and potassium acetate. • Flexible: Three Amino Acid Mixtures are provided, which enable different choices of radioisotopes. • Robust: Potassium Acetate is provided to enhance translation for a wide range of mRNAs. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –70°C or below. Avoid freeze-thaw cycles. T7 Sample System Product Size Cat.# T7 Sample System 1 each L5900 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The T7 Sample System is designed to facilitate the optimization of individual gene expression by offering four unique in vitro translation systems to evaluate. The system consists of samples of: TnT® T7 Quick for PCR DNA, TnT® T7 Quick Coupled Transcription/Translation System, TnT® Coupled Wheat Germ Extract System and E. coli T7 S30 Extract System for Circular DNA. All of the coupled systems utilize RNA generated by a T7 phage promoter. Criteria such as post-translational modifications, ionic optimization and detection methods (i.e., non-isotopic) should be considered when choosing an in vitro system. In some cases only direct experimental results will confirm which system is best for specific genes. Features: • Variety: Four major in vitro translation systems to evaluate. • Value: No requirement for the purchase of several large expensive systems. • Reliability: Comprised of rigorously quality-controlled reagents to ensure the highest level of transcription/translation. • Optimization: Determine which system is best for individual genes. Storage Conditions: Store at –70°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 336 For complete and up-to-date product information visit: www.promega.com Rabbit Reticulocyte Lysate, Untreated Product Size Cat.# Rabbit Reticulocyte Lysate, Untreated 1 ml L4151 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Untreated Rabbit Reticulocyte Lysate contains the cellular components necessary for protein synthesis (tRNA, ribosomes, amino acids, initiation, elongation and termination factors) but has not been treated with micrococcal nuclease. Untreated Lysate is used primarily for the isolation of these components and as an abundant source of endogenous globin mRNA. Untreated Lysate is prepared from New Zealand white rabbits in the same manner as treated lysates with the exception that it is not treated with micrococcal nuclease. Features: • Reliable: Consistent reticulocyte production in each lot. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –70°C or below. Luciferase Control RNA Product Size Conc. Cat.# Luciferase Control RNA 20 μg 1 mg/ml L4561 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Luciferase Control RNA is a unique functional control for in vitro translation reactions. Luciferase Control RNA is an uncapped in vitrotranscribed RNA containing a 30-base poly(A) tail that produces functional luciferase when translated. Control reactions are monitored easily by a luciferase assay for the production of luminescence generated from the fulllength luciferase. Features: • Convenient: Control reactions are easily monitored by a luciferase assay for luminescence. • Safe: Non-radioactive format to monitor control activity. Storage Conditions: Store at –70°C. Luciferase SP6/T7 Control DNAs Product Size Cat.# Luciferase SP6 Control DNA 20 μg L4741 Luciferase T7 Control DNA 20 μg L4821 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Luciferase SP6 and T7 Control DNAs are used as functional controls in the TnT® Quick Coupled and TnT® Coupled Transcription/Translation Systems. The Control DNAs contain the gene for luciferase under transcriptional control of a phage RNA polymerase promoter. All constructs carry a 30-base pair poly[d(A)/d(T)] tail following the luciferase gene. Control reactions are monitored easily by the production of luminescence, which is generated from full-length luciferase and the addition of necessary components. Luciferase Control DNAs are supplied as 0.5mg/ml solutions in TE buffer. Storage Conditions: Store at –20°C. Canine Pancreatic Microsomal Membranes Product Size Cat.# Canine Pancreatic Microsomal Membranes 50 μl Y4041 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Microsomal vesicles are used to study co-translational and initial post-translational processing of proteins. Processing events such as signal peptide cleavage, membrane insertion, translocation and core glycosylation can be examined by the translation of the appropriate mRNA in vitro in the presence of these microsomal membranes. In addition, processing and glycosylation events may be studied by the transcription/translation of the appropriate DNA in the TnT® Lysate Systems when used with Canine Pancreatic Microsomal Membranes. To assure consistent performance with minimal translational inhibition and background, microsomes have been isolated free from contaminating membrane fractions and stripped of endogenous membranebound ribosomes and mRNA. Membrane preparations are assayed for both signal peptidase and core glycosylation activities using two different control mRNAs. The two control mRNAs supplied with this system are the precursor for β-lactamase (or ampicillin resistance gene product) from E. coli and the precursor for α-mating factor (or α-factor gene product) from S. cerevisiae. The Signal Sequence Control mRNA (E. coli β-lactamase) is transcribed by SP6 RNA polymerase from a plasmid bearing the coding region for the E. coli gene encoding the precursor to β-lactamase (the ampicillin resistance gene product). The RNA is synthesized without a cap analog. This control mRNA is used to assay for signal peptidase activity and is supplied with the Canine Pancreatic Microsomal Membranes System. The Core Glycosylation Control mRNA (S. cerevisiae α-factor) is transcribed by SP6 RNA polymerase from a plasmid bearing the coding region for the S. cerevisiae α-mating factor. The RNA is synthesized without a cap analog. This control mRNA is used to assay for core glycosylation activity and is supplied with the Canine Pancreatic Microsomal Membranes System. Features: • Reliable: Microsomes are stripped of endogenous membrane-bound ribosomes and mRNA to ensure consistent performance with minimal translational inhibition and background. Performance tested in rabbit reticulocyte lysate. Storage Conditions: Store at –70°C or below. Membranes are stable at –70°C for 1 year. After thawing, unused portions should be rapidly refrozen in liquid nitrogen. No detectable loss of activity results after two freeze-thaw cycles. Amino Acid Mixtures Product Size Conc. Cat.# Amino Acid Mixture, Complete 175 μl 1 mM L4461 Amino Acid Mixture Minus Cysteine 175 μl 1 mM L4471 Amino Acid Mixture Minus Methionine and Cysteine 175 μl 1 mM L5511 Amino Acid Mixture Minus Leucine 175 μl 1 mM L9951 Amino Acid Mixture Minus Methionine 175 μl 1 mM L9961 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Amino Acid Mixture, Complete, is an aqueous solution containing 1mM each of the 20 essential amino acids. This mixture is compatible for use in the Flexi® Lysate, TnT® Lysate and standard Rabbit Reticulocyte Lysate Systems as well as in the Wheat Germ Extract and E. coli S30 Systems. Amino Acid Mixtures are also available lacking cysteine, methionine and cysteine, leucine or methionine. Storage Conditions: Store at –70°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 337 23Protein Expression For complete and up-to-date product information visit: www.promega.com Prokaryotic Cell-Free Protein Expression S30 T7 High-Yield Protein Expression System Product Size Cat.# S30 T7 High-Yield Protein Expression System 24 reactions L1110 8 reactions L1115 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The E. coli S30 T7 High-Yield Protein Expression System is designed to express up to 500μg/ml of protein in 1 hour from plasmid vectors containing a T7 promoter and a ribosome binding site. The protein expression system provides an extract that contains T7 RNA polymerase for transcription and is deficient in OmpT endoproteinase and lon protease activity. All other necessary components in the system are optimized for protein expression. This results in greater stability and enhanced expression of target proteins. Features: • Obtain Data Faster: Protein expression in only one hour, not days as with cell-based expression. • Complete System: No requirement to purchase additional reagents. • Achieve High Protein Expression: Express up to 500μg/ml of protein for multiple applications. • Scalable: Convenient screening protocol for high-throughput protein expression. • Flexible: Detect expressed proteins by Coomassie® staining or incorporation of a fluorescence or biotinylated modified tRNA. Storage Conditions: Store at –70°C. E. coli T7 S30 Extract System for Circular DNA Product Size Cat.# E. coli T7 S30 Extract System for Circular DNA 30 reactions L1130 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The E. coli T7 S30 Extract System for Circular DNA simplifies the transcription/translation of DNA sequences cloned in plasmid or λ vectors containing a T7 promoter by providing an extract that contains T7 RNA polymerase for transcription and all components needed for translation. The investigator only supplies cloned DNA containing a T7 promoter and a ribosome binding site. This product is prepared by modifications of the method described by Zubay from an E. coli strain B deficient in OmpT endoproteinase and lon protease activity. This results in greater stability of expressed proteins that would otherwise be degraded by proteases if expressed in vivo. Features: • Flexible: Can translate using any clone that has a T7 promoter and a ribosome binding site. Other S30 extracts require an E. coli promoter. • Greater Stability: Reduced chance of expressed proteins degrading. • Complete: Contains all components needed for coupled transcription/translation. • Low Background: Synthesizes very low levels of endogenous proteins. • Optimized: Premix is optimized for each lot of S30 Extract and contains all other required components (except amino acids), such as ribonucleotides, tRNAs, PEP (phosphoenol pyruvate) and salts. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store extract at –70°C. Check individual components for storage temperatures. E. coli S30 Extract System for Linear Templates Product Size Cat.# E. coli S30 Extract System for Linear Templates 30 reactions L1030 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The E. coli S30 Extract System for Linear Templates is prepared using minor modifications of the protocol described by Lesley and colleagues and allows successful transcription/translation of linear DNA templates. The investigator need only provide linear DNA containing a prokaryotic E. coli-like promoter (such as lacUV5, tac, λPL (con) and λ-PR ). A ribosome binding site is required to direct the synthesis of proteins in vitro. In vitro-generated RNA from DNA templates lacking an E. coli promoter may also be used in this system, but protein yields will be decreased to 1–10% of that produced from linear DNA templates. Features: • Flexible: Many templates can be used: DNA fragments, PCR-synthesized DNA, ligated overlapping oligonucleotides, in vitro-generated RNA and prokaryotic RNA. • Greater Stability: Reduced chance of expressed proteins degrading. • Complete: Contains all necessary components for coupled transcription/translation. • Low Background: System synthesizes very low levels of endogenous proteins. • Optimized: Premix is optimized for each lot of S30 Extract and contains all other required components (except amino acids), such as ribonucleotides, tRNAs, PEP (phosphoenol pyruvate) and salts. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –70°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 338 For complete and up-to-date product information visit: www.promega.com E. coli S30 Extract System for Circular DNA Product Size Cat.# E. coli S30 Extract System for Circular DNA 30 reactions L1020 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The E. coli S30 Extract for Circular DNA simplifies the transcription/translation of DNA sequences cloned in plasmid or λ vectors, providing a powerful tool for identifying and characterizing polypeptides. The investigator needs only to supply the cloned DNA containing the appropriate prokaryotic promoter and ribosome binding sites. The S30 Extract for Circular DNA Templates is prepared by modifications of the method described by Zubay from an E. coli strain B deficient in OmpT endoproteinase and lon protease activity. This results in a greater stability of expressed proteins that would otherwise be degraded by proteases if expressed in vivo. The S30 in vitro system also allows higher expression levels of proteins that are normally expressed at low levels in vivo due to the action of host-encoded repressors. Features: • Greater Stability: Reduced chance of expressed proteins degrading. • Complete: Contains all necessary components for coupled transcription/translation. • Low Background: System synthesizes very low levels of endogenous proteins. • Optimized: Premix is optimized for each lot of S30 Extract and contains all other required components (except amino acids), such as ribonucleotides, tRNAs, PEP (phosphoenol pyruvate) and salts. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at –70°C. pGEM® β-Gal Control DNA Product Size Cat.# pGEM® β-Gal Control DNA 20 μg L4731 For Research Use Only. Not for Use in Diagnostic Procedures. Description: pGEM® β-Gal Control DNA contains the coding sequence of β-galactosidase downstream of an E. coli wildtype lacZ promoter. pGEM® β-Gal Control DNA can be used as a positive control in the E. coli S30 Extract System for Circular DNA. The wildtype lacZ promoter is not efficient for initiating transcription from a linear DNA template. Supplied as a 0.5mg/ml solution in TE buffer. Storage Conditions: Store at –20°C. Protease Inhibitor Cocktail Product Size Cat.# Protease Inhibitor Cocktail, 50X 1 ml G6521 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Protease Inhibitor Cocktail is used to prevent protein degradation after lysing cells. The product is a mixture of six different protease inhibitors with different target protease specificities. The inhibitor cocktail is EDTA-free and provided as a powder, ready for reconstitution in 1ml of either 100% ethanol or DMSO to obtain a 50X working solution. Features: • Broad Specificity: Inhibitor cocktail is effective against a diverse number of proteases. • Great Potency: Reagent provides the best-in-class level of protease inhibition. • Highly Compatible: Works with a wide array of protein fusion tags (e.g., Flag®, His tag, GST tag) and capture technologies. It is ideally suited for HaloTag® Technology-based approaches. Storage Conditions: Store powdered Protease Inhibitor Cocktail at –30 to –10°C. Reconstituted Protease Inhibitor Cocktail can be stored at 2–10°C for 12 months. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 339 24 For complete and up-to-date product information visit: www.promega.com Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Protein Quantitation and Detection Protein Quantitation 340 Protease Assays 342 Protein Labeling 344 Protein Quantitation and Detection Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 340 For complete and up-to-date product information visit: www.promega.com Protein Quantitation Nano-Glo® HiBiT Extracellular Detection System Product Size Cat.# Nano-Glo® HiBiT Extracellular Detection System 10ml N2420 Nano-Glo® HiBiT Extracellular Detection System 100ml N2421 Nano-Glo® HiBiT Extracellular Detection System 10 × 100ml N2422 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Nano-Glo® HiBiT Extracellular Detection System quantitates cell-surface or secreted protein expression in minutes using a simple add-mixread assay format. Using the nonlytic Nano-Glo® HiBiT Extracellular Detection Reagent, any proteins that are tagged with the 11-amino-acid HiBiT peptide and expressed outside of the cell can be specifically quantitated. The detection reagent contains the complementary polypeptide, LgBiT, which spontaneously interacts with the HiBiT tag to reconstitute the bright, luminescent NanoBiT® enzyme. Luminescence is proportional to the amount of HiBiT-tagged protein present outside of the cell over seven orders of magnitude. Features: • Specific, live-cell detection of extracellular expressed or secreted proteins. • Simple add-mix-read assay format—no antibodies required. • Quantitate over 7 logs of linear dynamic range. Storage Conditions: Store at –30°C to –10°C. Nano-Glo® HiBiT Lytic Detection System Product Size Cat.# Nano-Glo® HiBiT Lytic Detection System 10ml N3030 Nano-Glo® HiBiT Lytic Detection System 100ml N3040 Nano-Glo® HiBiT Lytic Detection System 10 × 100ml N3050 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Nano-Glo® HiBiT Lytic Detection System quantifies cellular protein in minutes with high sensitivity and a broad dynamic range using a simple add-mix-read assay format. The 11-amino-acid HiBiT peptide tag can be added easily to a protein of interest and the total amount of HiBiT-tagged protein in cells measured by adding the Nano-Glo® HiBiT Lytic Detection Reagent. The detection reagent contains the complementing polypeptide LgBiT, which spontaneously interacts with the HiBiT tag to reconstitute the bright, luminescent NanoBiT® enzyme. The luminescence intensity is directly proportional to the amount of HiBiT-tagged protein in the cell lysate over seven orders of magnitude. The glow-type luminescent signal is stable for hours. Features: • Sensitive bioluminescent protein detection. • Simple add-and-read assay—no antibodies required. • Quantitate over 7 logs of linear dynamic range. Storage Conditions: Store at –30°C to –10°C. Nano-Glo® HiBiT Blotting System Product Size Cat.# Nano-Glo® HiBiT Blotting System 100ml N2410 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Nano-Glo® HiBiT Blotting System visualizes HiBiT-tagged proteins on blots at subpicogram levels. The reaction uses a detection reagent containing LgBiT Protein, which complements the HiBiT tag to form the luminescent NanoBiT® enzyme. The blotting system requires as little as 5 minutes to detect HiBiT-tagged proteins on a nitrocellulose membrane. Standard antibody-based blotting protocols can take multiple hours to detect the protein of interest. Features: • Determine protein size and quantify expression on blots. • Protocol requires only minutes, with few processing steps. • Femtogram sensitivity proportional over five orders of magnitude. Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 341 24Protein Quantitation and Detection For complete and up-to-date product information visit: www.promega.com pBiT3.1 HiBiT MCS Vectors Product Size Conc. Cat.# pBiT3.1-N [CMV/HiBiT/Blast] Vector 20µg 1µg/µl N2361 pBiT3.1-C [CMV/HiBiT/Blast] Vector 20µg 1µg/µl N2371 pBiT3.1-secN [CMV/HiBiT/Blast] Vector 20µg 1µg/µl N2381 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The three pBiT3.1 HiBiT Vectors are configured to append the 11-amino-acid HiBiT peptide tag to the amino or carboxy terminus of the target protein. These vectors contain a multiple cloning region to generate an in-frame HiBiT fusion protein. The pBiT3.1 Vectors can be used for both stable and transient gene expression and encode kanamycin resistance for bacterial selection and blasticidin resistance for mammalian selection. The flexible linker between the protein of interest and the HiBiT tag will vary in length, depending on the restriction enzyme used. The pBiT3.1-N [CMV/HiBiT/Blast] Vector appends the HiBiT tag to the N terminus of the gene of interest. The insert should contain a stop codon at the 3´ end for termination of the translation. The pBiT3.1-C [CMV/HiBiT/Blast] Vector adds the HiBiT tag to the N terminus of the gene of interest. Note: The insert should not encode a stop codon, and the gene of interest should contain proper translation initiation sequences, including an N-terminal ATG codon or Kozak sequence. The pBiT3.1-secN [CMV/HiBiT/Blast] Vector attaches the HiBiT tag to the N terminus of the mature form of transmembrane or secreted proteins. This vector encodes the IL-6 secretion signal peptide N-terminal to the HiBiT tag for direct trafficking of HiBiT-tagged proteins to the plasma membrane of mammalian cells for cell surface expression or secretion. Note: The insert should also contain a stop codon at the 3´ end for termination of the translation. The HiBiT peptide tag, in combination with the Nano-Glo® HiBiT Detection Systems, offers bioluminescent detection of the protein of interest. This results in quantitation of proteins using bioluminescence with no need for antibodies. Notes: 1. Expression of the HiBiT-tagged protein will only occur when the proper reading frame is maintained between the HiBiT tag and the gene of interest. 2. The HiBiT peptide sequence is provided for reference only. To obtain rights to synthesize the HiBiT tag, please see the Terms and Conditions of Use at: www.promega.com/HiBiT-Synthesis Features: • Add an N- or C-terminal HiBiT tag to your protein of interest. • Generate an N-terminal HiBiT-tagged transmembrane or secreted protein. • Use for expression analysis and protein quantitation using luminescent detection reagents. Storage Conditions: Store at –30°C to –10°C. HiBiT CMV-Neo Flexi® Vectors Product Size Conc. Cat.# pFC37K HiBiT CMV-neo Flexi® Vector 20µg 1µg/µl N2391 pFN38K HiBiT CMV-neo Flexi® Vector 20µg 1µg/µl N2401 pFN39K secHiBiT CMV-neo Flexi® Vector 20µg 1µg/µl N2411 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The three HiBiT CMV-neo Flexi® Vectors are configured to facilitate simple, efficient transfer of the gene of interest into a vector designed for genetic attachment of the HiBiT peptide tag to the amino or carboxy terminus of the protein of interest using the Flexi® Cloning System (Cat.# C8640). The vectors can be used for both stable and transient gene expression and encode kanamycin resistance for bacterial selection and neomycin resistance for mammalian selection. The pFC37K HiBiT CMV-neo Flexi® Vector appends the HiBiT to the C terminus of the gene of interest. The pFN38K HiBiT CMV-neo Flexi® Vector adds the HiBiT tag to the N terminus of the gene of interest. The pFN39K secHiBiT CMV-neo Flexi® Vector attaches the HiBiT tag to the N terminus of the gene of interest. This vector encodes the IL-6 secretion signal peptide N-terminal to the HiBiT tag for direct trafficking of HiBiTtagged proteins to the plasma membrane of mammalian cells for cell surface expression and secreted proteins. Note: We recommend removing naturally encoded secretion signal sequences from the gene of interest for efficient cellsurface expression of the HiBiT-tagged protein. The HiBiT peptide tag, in combination with the Nano-Glo® HiBiT Detection Systems, offers bioluminescent detection of the protein of interest. This results in quantitation of proteins using bioluminescence with no need for antibodies. Features: • Add an N- or C-terminal HiBiT tag to your protein of interest. • Generate an N-terminal HiBiT-tagged transmembrane or secreted protein. • Use with the Flexi® Cloning System to transfer ORF insert. Storage Conditions: Store at –30°C to –10°C. Neo/Kanr Blastr Synthetic poly(A) signal pBiT3.1-N [CMV/HiBiT/Blast] Vector (4,326bp) CMV promoter EM7 bacterial promoter SV40 promoter SV40 late poly(A) signal ori intron T7 promoter HiBiT SacI XhoI EcoRI BamHI NheI BglII 1233 1241 1253 1266 1278 1287 XbaI HindIII PmeI SbfI 1296 1306 1320 1329 Neo/Kanr Synthetic poly(A) signal pFC37K HiBiT CMV-neo Flexi® Vector (4,654bp) CMV immediate/early enhancer/promoter EM7 bacterial promoter SV40 promoter and enhancer SV40 late poly(A) signal ori intron T7 promoter SgfI EcoICRI Barnase HiBiT Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 342 For complete and up-to-date product information visit: www.promega.com Protease Assays DPPIV-Glo™ Protease Assay Product Size Cat.# DPPIV-Glo™ Protease Assay 10 ml G8350 50 ml G8351 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The DPPIV-Glo™ Protease Assay is a homogeneous, luminescent assay that measures dipeptidyl peptidase IV (DPPIV) activity. DPPIV is a serine protease that cleaves N-terminal dipeptides from polypeptides with l-proline or l-alanine at the penultimate position. The DPPIV-Glo™ Assay provides a proluminescent DPPIV substrate, Gly-Pro-aminoluciferin, in a buffer system optimized for DPPIV and luciferase activities. The addition of a single DPPIV-Glo™ Reagent in an “add-mix-measure” format results in DPPIV cleavage of the substrate and generation of a “glow-type” luminescent signal produced by the luciferase reaction. In this homogeneous, coupled-enzyme format, the signal is proportional to the amount of DPPIV activity present. The assay is designed for use with purified enzyme preparations. Features: • Simplified Method: The homogeneous “add-mix-measure” protocol makes the assay highly amenable to automation. • Greater Sensitivity: The assay is more sensitive than fluorescent-based DPPIV assays. In contrast to fluorescent assays, the luminescent assay avoids inherent fluorescent background signals and thus provides excellent signal-to-background readings. The assay is linear over more than 3 logs of DPPIV concentration and can detect less than 1pg/ml enzyme. • Faster Results: The maximum signal (and maximum sensitivity) of the assay is reached in as little as 30 minutes after reagent addition and, unlike fluorescent assays, is not dependent on accumulation of cleaved product. • Amenable to Batch Processing: The stability of the signal means that plates can be read over an extended period of time. Storage Conditions: Store components at –20°C protected from light. Proteasome-Glo™ Assays Product Size Cat.# Proteasome-Glo™ Chymotrypsin-Like Assay 10 ml G8621 50 ml G8622 Proteasome-Glo™ Trypsin-Like Assay 10 ml G8631 50 ml G8632 Proteasome-Glo™ Caspase-Like Assay 10 ml G8641 50 ml G8642 Proteasome-Glo™ 3-Substrate System 10 ml G8531 50 ml G8532 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Proteasome-Glo™ Assays are homogeneous, luminescent assays that individually measure the chymotrypsin-like, trypsinlike and caspase-like protease activities associated with the proteasome in a purified enzyme-based format. The 26S proteasome is a 2.5MDa multiprotein complex found in all eukaryotic cells. Adding the Proteasome-Glo™ Cell-Based Reagent in an “add-mix-measure” format results in proteasome cleavage of the substrate and rapid generation of a luminescent signal produced by the luciferase reaction. The three luminogenic substrates used to monitor specific protease activities include: Suc-LLVY-aminoluciferin for chymotrypsin-like, Z-LRR-aminoluciferin for trypsin-like, and Z-nLPnLD-aminoluciferin for caspase-like activity. Each luminogenic substrate is added to a buffer system optimized for its specific proteasome activity and luciferase activity. The reagents are added to test samples containing proteasome enzyme that cleaves the substrates, releasing luciferin, which is consumed by luciferase, producing “glow-type” luminescence correlating to enzyme activity or inhibition. The Proteasome-Glo™ 3-Substrate System consists of three homogeneous bioluminescent assays in an enzyme-based format (each of these three assays also is available separately). The Proteasome-Glo™ Cell-Based 3-Substrate System consists of three homogeneous bioluminescent assays that measure the three proteolytic activities associated with the proteasome in a cell-based format (each of these three assays also is available separately). Features: • Simplified Method: The “add-mix-measure” protocol minimizes handling steps and makes the assays amenable to automation. • Faster Results: Maximum sensitivity is reached 10–30 minutes after reagent addition. • Greater Sensitivity: The luminescent assay format avoids inherent fluorescent background signals, providing excellent signal-to-background readings. The assays are miniaturizable to 384-well format. Storage Conditions: Store the Proteasome-Glo™ Assay components at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 343 24Protein Quantitation and Detection For complete and up-to-date product information visit: www.promega.com Cell-Based Proteasome-Glo™ Assays Product Size Cat.# Proteasome-Glo™ Chymotrypsin-Like Cell-Based Assay 10 ml G8660 5 × 10 ml G8661 2 × 50 ml G8662 Proteasome-Glo™ Trypsin-Like Cell-Based Assay 10 ml G8760 5 × 10 ml G8761 Proteasome-Glo™ Caspase-Like Cell-Based Assay 10 ml G8860 5 × 10 ml G8861 Proteasome-Glo™ 3-Substrate Cell-Based Assay System 10 ml G1180 50 ml G1200 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Proteasome-Glo™ Cell-Based Assays are homogeneous, luminescent assays that individually measure the chymotrypsin-like, trypsin-like and caspase-like protease activities associated with the proteasome complex in cultured cells. The 26S proteasome is a 2.5MDa multiprotein complex found in all eukaryotic cells. Proteasome-Glo™ Cell-Based Assays provide luminogenic proteasome substrates in buffers optimized for cell permeabilization, proteasome activity and luciferase activity. Addition of the Proteasome-Glo™ Cell-Based Reagent in an “add-mix-measure” format results in proteasome cleavage of the substrate and rapid generation of a luminescent signal produced by the luciferase reaction. The three luminogenic substrates used to monitor specific protease activities include: Suc-LLVY-aminoluciferin for chymotrypsin-like, Z-LRR-aminoluciferin for trypsin-like, and Z-nLPnLD-aminoluciferin for caspase-like activity. Each luminogenic substrate is added to a buffer system optimized for its specific proteasome activity and luciferase activity. The reagents are added to cells in culture, and the proteasome cleaves the substrates, releasing luciferin, which is consumed by luciferase, producing “glow-type” luminescence correlating to enzyme activity or inhibition. The Proteasome-Glo™ Cell-Based 3-Substrate System consists of three homogeneous bioluminescent assays that measure the three proteolytic activities associated with the proteasome in a cell-based format (each of these three assays also is available separately). The Proteasome-Glo™ 3-Substrate System consists of three homogeneous bioluminescent assays in a purified enzyme-based format (each of these three assays also is available separately). Features: • More Biologically Relevant Results: Obtain activity data directly from a cellular environment with the Proteasome-Glo™ Cell-Based Assay. • Simplified Method: The “add-mix-measure” protocol minimizes handling steps and makes the assays amenable to automation. • Faster Results: Maximum sensitivity is reached 10–30 minutes after reagent addition. • Greater Sensitivity: The luminescent assay format avoids inherent fluorescent background signals, providing excellent signal-to-background readings. The assays are miniaturizable to 384-well format. Storage Conditions: Store the Proteasome-Glo™ Assay components at –20°C. Calpain-Glo™ Protease Assay Product Size Cat.# Calpain-Glo™ Protease Assay 10 ml G8501 50 ml G8502 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Calpain-Glo™ Protease Assay is a homogeneous, luminescent assay that measures calpain 1 (μ) and 2 (m) activities. Calpains are a family of calcium-activated cysteine proteases involved in cleaving a wide variety of proteins. Calpains modulate the biological activities of their substrates via limited proteolysis. The Calpain-Glo™ Protease Assay provides a succinyl, proluminescent calpain substrate, Suc-LLVY-aminoluciferin, in a buffer system optimized for calpain and luciferase activities. The addition of the calpain reagent in an “addmix-measure” format results in calpain cleavage of the substrate and rapid development of a “glow-type” luminescent signal produced by the luciferase reaction. The signal is proportional to the amount of calpain activity present. The assay is designed for use with purified enzyme preparations. Features: • Faster Results: The homogeneous, enzyme-coupled format is especially well suited for rapidly autolysed enzymes like calpain; maximum sensitivity is reached in as little as 10 minutes, while the enzyme is fully active. • Simple Protocol: The homogeneous “add-mix-measure” protocol makes the assay easy to automate. • Greater Sensitivity: The assay is up to 1,000 times more sensitive than competitive fluorometric assays. The luminescent assay avoids inherent fluorescent background signals, providing excellent signal-to-background readings. The assay is linear over 4 logs of calpain concentration. Storage Conditions: Store components at –20°C protected from light. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 344 For complete and up-to-date product information visit: www.promega.com Tryptase, Human, Recombinant, β Product Size Cat.# rhSkin β Tryptase 100 μg G7061 rhLung β Tryptase 100 μg G5631 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Tryptase is the predominant protein in mast cell granules and cleaves proteins at arginine and lysine residues. Tryptase is stored and released from mast cell granules upon activation. Mast cells are found in many tissues but are present in greater numbers along epithelial linings of the body, such as the skin, respiratory tract and gastrointestinal tract, as well as the perivascular tissue surrounding blood vessels. They are involved in a variety of physiological and pathophysiological states, including immediate hypersensitivity, delayed-type hypersensitivity, cell growth regulation, defense against neoplasia, and pain and itch sensation. They have also been implicated in chronic inflammatory states and are involved in neuroimmune interactions. The availability of recombinant human tryptase will aid in research directed toward a more complete understanding of the biological role(s) of tryptase and mast cells and the identification of tryptase in vivo targets. Skin βI Tryptase, Human, Recombinant (rhSkin β Tryptase) and Lung βII Tryptase, Human, Recombinant (rhLung β Tryptase) are neutral serine proteases. The human β tryptase enzymes have been cloned and stably expressed in Pichia pastoris as fully active tetrameric enzymes and purified by affinity chromatography. The two enzymes differ in buffer formulation, enzyme concentration and glycosylation pattern. rhLung Tryptase is provided at a much higher concentration (2mg/ml) in minimal buffer without heparin for chromatographic studies and with glycosylation more closely resembling cadaveric enzyme as demonstrated by glycosidase digestion followed by Western analysis of the two recombinant enzymes and native lung tryptase. Specific Activity: Measured as the rate of hydrolysis of 0.4mM Nα CBZ-L-Lysine Thiobenzyl Ester as substrate coupled with Ellman’s Reagent [5,5´-Dithio-bis(5-Nitrobenzoic Acid)] in a final volume of 1ml, incubating for 1 minute at 25°C, and monitoring the absorbance change at 410nm. One unit is defined as 1.0 absorbance unit change per minute. • rhSkin β Tryptase: >1,000 units/mg protein. • rhLung β Tryptase: >1,200 units/mg protein. Concentration: • rhSkin β Tryptase: 200μg/ml. • rhLung β Tryptase: 2mg/ml. Features: • High Specific Activity: Specific activity is consistently 130–150% higher than native lung tryptase. • Consistent: Recombinant protein expression results in uniform enzyme from batch to batch. • Safe: Void of human pathogens associated with native cadaveric tryptase. • Pure: Skin β and Lung β Tryptase are free of other contaminating proteases, providing more active enzyme per milligram of protein and eliminating extraneous protein interactions observed with native tryptase. Storage Conditions: Store at –20°C. Protein Labeling HaloTag® Ligands for Super Resolution Microscopy Product Size Cat.# Janelia Fluor® 549 HaloTag® Ligand 5μg GA1110 3 × 5μg GA1111 Janelia Fluor® 646 HaloTag® Ligand 5μg GA1120 3 × 5μg GA1121 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Janelia Fluor® 549 HaloTag® Ligand and Janelia Fluor® 646 HaloTag® Ligand enable characterization of HaloTag® fusions in endogenous cellular settings. The enhanced brightness of the dyes associated with the HaloTag® ligands enables their use in detection and single-molecule imaging studies in live cells via: FACS, standard confocal imaging and in-gel detection with a fluoroimager. Features: • Single-molecule labeling • Rapid cell labeling • High signal-to-noise ratio and specificity Storage Conditions: Store at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 345 24Protein Quantitation and Detection For complete and up-to-date product information visit: www.promega.com HaloTag® Fluorescent Ligands Product Size Conc. Cat.# HaloTag® TMR Ligand 30 μl 5 mM G8251 15 μl 5 mM G8252 HaloTag® Oregon Green® Ligand 30 μl 1 mM G2801 15 μl 1 mM G2802 HaloTag® diAcFAM Ligand 30 μl 1 mM G8272 15 μl 1 mM G8273 HaloTag® Coumarin Ligand 30 μl 10 mM G8581 15 μl 10 mM G8582 HaloTag® Alexa Fluor® 488 Ligand 30 μl 1 mM G1001 15 μl 1 mM G1002 HaloTag® Alexa Fluor® 660 Ligand 30 μl 3.5 mM G8471 15 μl 3.5 mM G8472 HaloTag® TMRDirect™ Ligand 30 μl 0.1 mM G2991 HaloTag® R110Direct™ Ligand 30 μl 0.1 mM G3221 HaloTag® Biotin Ligand 30 μl 5 mM G8281 15 μl 5 mM G8282 HaloTag® PEG-Biotin Ligand 30 μl 5 mM G8591 15 μl 5 mM G8592 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Fluorescent Ligands can carry a variety of functionalities, including fluorescent labels, affinity tags and attachments to a solid phase. The covalent bond forms rapidly under general physiological conditions, is highly specific and essentially irreversible. The HaloTag® Fluorescent Ligands allow researchers to apply the chloroalkane group that HaloTag® protein reacts with to any compound or surface with a compatible chemical group, creating endless possible applications. HaloTag® Fluorescent Ligands for Cellular Imaging Cell-permeant fluorescent ligands (rapid labeling protocol): • HaloTag® TMR Ligand (555Ex/585Em) • HaloTag® Oregon Green® Ligand (496Ex/516Em) • HaloTag® diAcFAM Ligand (494Ex/526Em) • HaloTag® Coumarin Ligand (353Ex/434Em) Cell-impermeant fluorescent ligands for cell-surface labeling (rapid labeling protocol): • HaloTag® Alexa Fluor® 488 Ligand (494Ex/517Em) • HaloTag® Alexa Fluor® 660 Ligand (663Ex/690Em) Cell-permeant fluorescent ligands (“no wash” protocol): • HaloTag® TMRDirect™ Ligand (555Ex/585Em) • HaloTag® R110Direct™ Ligand (502Ex/527Em) The Alexa Fluor® 488 Ligand is impermeable to cell membranes and, therefore, used to label cell surface proteins. The TMR Ligand, Oregon Green® Ligand, diAcFAM Ligand and Coumarin Ligand readily cross the cell membrane and, therefore, can be used to label intracellular proteins. HaloTag® Ligands for Protein Detection The HaloTag® Biotin Ligand consists of a 12-atom linker arm to biotin and is used as an affinity tag to capture the HaloTag® protein-based fusion construct using the strong biotin-streptavidin interaction. The HaloTag® PEG-Biotin Ligand contains a spacer not found in the HaloTag® Biotin Ligand. This provides a significantly longer and more flexible linker between streptavidin and the HaloTag® protein, which may be advantageous in preserving the activity of a HaloTag® fusion partner protein upon immobilization or derivatization. Features: • Label in Solution or on a Solid Support: The HaloTag® Ligands bind to the HaloTag® protein or protein fusions with high specificity and affinity. • Label Your HaloTag® Protein in Live Cells: The HaloTag® TMR, diAcFAM, Coumarin and Biotin Ligands readily cross the cell membrane. • Pull Down Protein Complexes: The spacer and reactive linker of the HaloTag® PEG-Biotin Ligand provide ideal pull-down capabilities. Alternatively, pull down directly with the HaloLink™ Resin. • Image Fixed Cells: The covalent bond is stable, allowing imaging of fixed cells and analysis of the labeled protein under stringent conditions. • Introduce Novel Functionalities or Perform Sequential Labeling: The open architecture of the technology enables the use of different ligands for multiple applications. • Design Only One Genetic Construct for Multiple Experiments: Obtain new functionality by using a different HaloTag® Ligand without having to design and clone a new expression construct. • Analyze Labeled Fusion Proteins Using SDS-PAGE, Mass Spectrometry: The bound ligand is stable under denaturing conditions. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 346 For complete and up-to-date product information visit: www.promega.com HaloTag® Ligand Building Blocks Product Size Cat.# HaloTag® Amine (O4) Ligand 5 mg P6741 HaloTag® Amine (O2) Ligand 5 mg P6711 HaloTag® Iodoacetamide (O4) Ligand 5 mg P6771 HaloTag® Succinimidyl Ester (O4) Ligand 5 mg P6751 HaloTag® Succinimidyl Ester (O2) Ligand 5 mg P1691 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Ligand Building Blocks can carry a variety of functionalities, including fluorescent labels, affinity tags and attachments to a solid phase. The covalent bond forms rapidly under general physiological conditions, is highly specific and essentially irreversible. The HaloTag® Ligand Building Blocks allow researchers to apply the chloroalkane group that HaloTag® protein reacts with to any compound or surface with a compatible chemical group, creating endless possible applications. The HaloTag® Succinimidyl Ester (04) Ligand contains a reactive succinimidyl ester (SE) group connected to an alkyl chloride separated by three ethylene glycol repeats (04). The HaloTag® Succinimidyl Ester (04) Ligand can be successfully conjugated to any reporter group, protein, or nucleic acid derivative containing an amine, forming stable amide bond linkages. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. The HaloTag® Succinimidyl Ester (O2) Ligand contains a reactive succinimidyl ester (SE) group connected to an alkylchloride separated by an ethylene glycol repeat (O2). The HaloTag® Succinimidyl Ester (O2) Ligand can be successfully conjugated to any reporter group, protein, or nucleic acid derivative containing an amine, forming stable amide bond linkages. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. The HaloTag® Amine (04) Ligand contains a reactive amine group connected to an alkyl chloride, separated by an ethylene glycol repeat (04). The HaloTag® Amine (04) Ligand can be successfully conjugated to any reporter group, protein, or nucleic acid derivative containing an activated carboxylic acid, sulfonyl halide or isocyanate. Examples of activated carboxylic acids are succinimidyl esters, STP esters, acid halides, and TFP esters. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. The HaloTag® Amine (O2) Ligand contains a reactive amine group connected to an alkylchloride, separated by an ethylene glycol repeat (O2). The HaloTag® Amine (O2) Ligand can be successfully conjugated to any reporter group, protein, or nucleic acid derivative containing an activated carboxylic acid, sulfonyl halide or isocyanate. Examples of activated carboxylic acids are succinimidyl esters, STP esters, acid halides and TFP esters. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. The HaloTag® Iodoacetamide (04) Ligand contains a reactive iodoacetamide group connected an alkyl chloride separated by an ethylene glycol repeat (04). The HaloTag® Iodoacetamide (04) Ligand has been designed to rapidly react with sulfhydryl-containing molecules (see figure), whether small organic compounds, peptides or proteins. The ligand with functional group can then be used with the HaloTag® protein for any application of interest. Storage Conditions: Store Cat.# P1691 and P6751 at or below –70°C under inert atmosphere. Store Cat.# P6711 and P6741 at or below –20°C in an air-tight container in the absence of light. Store Cat.# P6771 at or below –20°C under inert atmosphere in the absence of light. See Promega Product Information for additional details on individual products. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 347 24Protein Quantitation and Detection For complete and up-to-date product information visit: www.promega.com HaloTag® Fusion (C-Terminal) Mammalian Expression Vectors Product Size Cat.# pHTC HaloTag® CMV-neo Vector 20 μg G7711 pFC27A HaloTag® CMV-neo Flexi® Vector 20 μg G8421 pFC27K HaloTag® CMV-neo Flexi® Vector 20 μg G8431 pFC14A HaloTag® CMV Flexi® Vector 20 μg G9651 pFC14K HaloTag® CMV Flexi® Vector 20 μg G9661 pFC15A HaloTag® CMVd1 Flexi® Vector 20 μg G1611 pFC15K HaloTag® CMVd1 Flexi® Vector 20 μg G1601 pFC16A HaloTag® CMVd2 Flexi® Vector 20 μg G1591 pFC16K HaloTag® CMVd2 Flexi® Vector 20 μg G1571 pFC17A HaloTag® CMVd3 Flexi® Vector 20 μg G1551 pFC17K HaloTag® CMVd3 Flexi® Vector 20 μg G1321 Available Separately HaloTag® Cloning Starter System 1 each G6050 HaloTag® Flexi® Vectors—CMV Deletion Series Sample Pack 9 × 2 μg G3780 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These vectors are designed for expression of C-terminaltagged HaloTag® fusion proteins in mammalian cells. Once expressed, the HaloTag® fusion protein may be used for cell imaging of protein localization or trafficking in conjunction with the fluorescent HaloTag® Ligands. In addition, the HaloTag® fusion protein can be purified or pulled down as a complex with its protein partners. We offer two types of HaloTag® fusion vectors to accommodate your cloning preferences: • pHT Vector Series: Simple Multiple Cloning Site (MCS) plasmids for traditional cloning. • pF Vector Series: Flexi® Vector Cloning System—a directional cloning method for protein-coding sequences. It is based on two rare-cutting restriction enzymes, SgfI and PmeI, and provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Versatility: You can choose between a variety of initial applications (e.g., bacterial protein, mammalian, or cell-free protein expression) and then transfer to others as required. • Time Savings: Efficient transfer allows direct use of recombinant clones, minimizing time wasted screening background colonies. • Enhanced Productivity: Adaptable to high-throughput formats for large screening projects. • Easy Access: No licensing fees or complicated transfer restrictions. Storage Conditions: Store vectors at –20°C. HaloTag® Fusion (N-Terminal) Mammalian Expression Vectors Product Size Cat.# pHTN HaloTag® CMV-neo Vector 20 μg G7721 pFN28A HaloTag® CMV-neo Flexi® Vector 20 μg G8441 pFN28K HaloTag® CMV-neo Flexi® Vector 20 μg G8451 pFN21A HaloTag® CMV Flexi® Vector 20 μg G2821 pFN21K HaloTag® CMV Flexi® Vector 20 μg G2831 pFN22A HaloTag® CMVd1 Flexi® Vector 20 μg G2841 pFN22K HaloTag® CMVd1 Flexi® Vector 20 μg G2851 pFN23A HaloTag® CMVd2 Flexi® Vector 20 μg G2861 pFN23K HaloTag® CMVd2 Flexi® Vector 20 μg G2871 pFN24A HaloTag® CMVd3 Flexi® Vector 20 μg G2881 pFN24K HaloTag® CMVd3 Flexi® Vector 20 μg G2981 Available Separately HaloTag® Cloning Starter System 1 each G6050 HaloTag® Flexi® Vectors—CMV Deletion Series Sample Pack 9 × 2 μg G3780 For Research Use Only. Not for Use in Diagnostic Procedures. Description: These vectors are designed for expression of N-terminaltagged HaloTag® fusion proteins in mammalian cells. Once expressed, the HaloTag® fusion protein may be used for cell imaging of protein localization or trafficking in conjunction with the fluorescent HaloTag® Ligands. In addition, the HaloTag® fusion protein can be purified or pulled down as a complex with its protein partners. We offer two types of HaloTag® fusion vectors to accommodate your cloning preferences: • pHT Vector Series: Simple Multiple Cloning Site (MCS) plasmids for traditional cloning. • pF Vector Series: Flexi® Vector Cloning System—a directional cloning method for protein-coding sequences. It is based on two rare-cutting restriction enzymes, SgfI and PmeI, and provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Versatility: You can choose between a variety of initial applications (e.g., bacterial protein, mammalian, or cell-free protein expression) and then transfer to others as required. • Time Savings: Efficient transfer allows direct use of recombinant clones, minimizing time wasted screening background colonies. • Enhanced Productivity: Adaptable to high-throughput formats for large screening projects. • Easy Access: No licensing fees or complicated transfer restrictions. Storage Conditions: Store vectors at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 348 For complete and up-to-date product information visit: www.promega.com HaloTag® Vectors for E. coli and Cell-Free Protein Expression Product Size Cat.# pH6HTN His6 HaloTag® T7 Vector 20 μg G7971 pH6HTC His6 HaloTag® T7 Vector 20 μg G8031 pF1A T7 Flexi® Vector 20 μg C8441 pF1K T7 Flexi® Vector 20 μg C8451 pFN18A HaloTag® T7 Flexi® Vector 20 μg G2751 pFN18K HaloTag® T7 Flexi® Vector 20 μg G2681 pFN19A HaloTag® T7 SP6 Flexi® Vector 20 μg G1891 pFN19K HaloTag® T7 SP6 Flexi® Vector 20 μg G1841 pFC20A HaloTag® T7 SP6 Flexi® Vector 20 μg G1681 pFC20K HaloTag® T7 SP6 Flexi® Vector 20 μg G1691 pFN29A His6 HaloTag® T7 Flexi® Vector 20 μg G8261 pFN29K His6 HaloTag® T7 Flexi® Vector 20 μg G8331 pFC30A His6 HaloTag® T7 Flexi® Vector 20 μg G8321 pFC30K His6 HaloTag® T7 Flexi® Vector 20 μg G8381 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The following vectors are used for inducible expression of HaloTag® fusion proteins in E. coli and cell-free systems using the T7 RNA polymerase promoter. Expression levels depend highly on the nature of the protein, but in general the N-terminal HaloTag® fusion protein (e.g., pFN18A/K, Cat.# G2751, G2681) can increase expression level, enhance refolding and boost solubility of the expressed protein. HaloTag® vectors are supplied in two formats: as multiple cloning site (MCS) vectors for traditional cloning and as Flexi® System vectors. The Flexi® Vector System is a simple, directional cloning method for proteincoding sequences. It is based on two rare-cutting restriction enzymes, SgfI and PmeI, and provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between a variety of Flexi® Vectors without the need to resequence. Direct transfers can only occur between two N-terminal tagged vectors or from an N-terminal to a C-terminal vector. The MCS vectors and several Flexi® system vectors contain a His6 -HaloTag® dual tag. The dual tag enables protein purification with the reusable Ni-resin while retaining the HaloTag® covalent labeling properties. Multiple Cloning Site (MCS) Vectors pH6HTN His6 HaloTag® T7 Vector (Cat.# G7971) is designed for protein expression with an N-terminal His6 -HaloTag® dual tag in E. coli and T7 cell-free expression systems. pH6HTC His6 HaloTag® T7 Vector (Cat.# G8031) is designed for protein expression with a C-terminal His6 -HaloTag® dual tag in E. coli and T7 cell-free expression systems. Flexi® System Vectors pF1A/K T7 Flexi® Vectors (Cat.# C8441, C8451) are designed for untagged protein expression. pFN18A/K HaloTag® T7 Flexi® Vectors (Cat.# G2751, G2681) are designed for protein expression with an N-terminal HaloTag® in E. coli and T7 cell-free expression systems. pFN19A/K HaloTag® T7 SP6 Flexi® Vectors (Cat.# G1891, G1841) are designed for protein expression with an N-terminal HaloTag® in T7 and SP6 cell-free expression systems. These vectors are optimized for cell-free expression systems. pFC20A/K HaloTag® T7 SP6 Flexi® Vectors (Cat.# G1681, G1691) are designed for protein expression with a C-terminal HaloTag® in E. coli and SP6 cell-free expression systems. These vectors are optimized for cell-free expression systems. pFN29A/K His6 HaloTag® T7 Flexi® Vectors (Cat.# G8261, G8331) are designed for protein expression with an N-terminal His6 -HaloTag® dual tag in E. coli T7 cell-free expression systems. pFC30A/K His6 HaloTag® T7 Flexi® Vectors (Cat.# G8321, G8381) are designed for protein expression with a C-terminal His6 -HaloTag® dual tag in E. coli T7 cell-free expression systems. Note: Flexi® Vectors contain the lethal barnase gene to reduce background colonies without inserts during the subcloning procedure. Using the Flexi® Vector Cloning System replaces the barnase gene with your insert. These vectors, as purchased, cannot be cultured in normal laboratory strains of E. coli without an insert. Features: • Choice of Systems: Choose between traditional (MCS) and Flexi® cloning to get the benefits of HaloTag® technology. • Dual Tag: Couple the protein solubility and labeling benefits of HaloTag® technology with the reusability and the throughput of Ni-affinity technology. • Versatile Cloning: Choose from a variety of expression systems and fusion tag orientations and then transfer to others as required (for Flexi® system). • Time Savings: Barnase insert (Flexi® system) decreases the number of background colonies, allowing efficient transfer of genetic constructs. Storage Conditions: Store vectors at –20°C. 4815MA pF1A T7 Flexi ® Vector (3455bp) ori cer Pme I Barnase T7 Terminator Ampr T7 Sgf I rrnB Terminator Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 349 24Protein Quantitation and Detection For complete and up-to-date product information visit: www.promega.com FluoroTect™ GreenLys in vitro Translation Labeling System Product Size Cat.# FluoroTect™ GreenLys in vitro Translation Labeling System 40 reactions L5001 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The FluoroTect™ GreenLys in vitro Translation Labeling System allows the fluorescent labeling and detection of proteins synthesized in vitro. The system is based on a lysine-charged tRNA that is labeled at the ε position of the lysine with the fluorophore BODIPY®-FL. Fluorescent lysine residues will be incorporated into synthesized proteins during in vitro translation reactions, eliminating the need for radioactivity. Detection of the labeled proteins is accomplished in 2–5 minutes directly “in-gel” by use of a laser-based fluorescent gel scanner. This eliminates any requirements for protein gel manipulation such as fixing/drying or any safety, regulatory and waste disposal issues associated with the use of radioactively labeled amino acids use. The convenience of “in-gel” detection also avoids the time-consuming electroblotting and detection steps of conventional nonisotopic systems. Features: • Fast: Data can be obtained in minutes, eliminating overnight exposures associated with radioactive-based systems or time-consuming steps utilized by traditional non-isotopic methodologies. • Convenient: Results based on “in-gel” detection. No requirement to transfer, fix, or dry gels. • Non-Radioactive: No safety, regulatory or waste disposal issues associated with radioactivity. • Flexible: The modified charged tRNA can be used with a variety of Promega translation systems including: Rabbit Reticulocyte Lysate, TnT® Coupled Transcription/Translation System, Wheat Germ Extract and E. coli S30 Extract. Storage Conditions: Store at –70°C. Transcend™ Non-Radioactive Translation Detection Systems Product Size Cat.# Transcend™ Colorimetric Translation Detection System 30 reactions L5070 Transcend™ Chemiluminescent Translation Detection System 30 reactions L5080 Available Separately Transcend™ tRNA 30 μl L5061 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Transcend™ Non-Radioactive Translation Detection Systems allow non-radioactive detection of proteins synthesized in vitro. Using these systems, biotinylated lysine residues are incorporated into nascent proteins during translation, eliminating the need for labeling with [35S]methionine or other radioactive amino acids. This biotinylated lysine is added to the translation reaction as a precharged ε-labeled biotinylated lysine-tRNA complex (Transcend™ tRNA) rather than a free amino acid. After SDS-PAGE and electroblotting, the biotinylated proteins can be visualized by binding either Streptavidin-Alkaline Phosphatase (Streptavidin-AP) or StreptavidinHorseradish Peroxidase (Streptavidin-HRP), followed either by colorimetric or chemiluminescent detection. Typically, these methods can detect 0.5–5ng of protein within 3–4 hours after gel electrophoresis. This sensitivity is equivalent to that achieved with [35S]methionine incorporation and autoradiographic detection 6–12 hours after gel electrophoresis. Features: • Sensitive: The biotin tag allows detection of 0.5–5ng of translated protein. • Safe: No radioisotope handling, storage or disposal is required. • Fast: Labeled proteins can be detected 3–4 hours after gel electrophoresis. • Flexible: Results can be visualized by using colorimetric or chemiluminescent detection. Storage Conditions: Store Transcend™ tRNA at –70°C. Do not subject the Transcend™ tRNA to more than five freeze-thaw cycles. Store all other components at 4°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 350 For complete and up-to-date product information visit: www.promega.com ECL Western Blotting Substrate Product Size Cat.# ECL Western Blotting Substrate 250 ml W1001 500 ml W1015 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The ECL Western Blotting Substrate is a highly sensitive non-radioactive, enhanced luminol-based chemiluminescent substrate for the detection of horseradish peroxidase (HRP) conjugates on immunoblots. The ECL Western Blotting Substrate detects and visualizes the presence of picogram (pg) amounts of antigen through the use of photographic or other suitable chemiluminescent imaging methods. Features: • High Sensitivity: Detect picogram levels of protein with minimal background. • Save Time: No optimization required; you can switch from other entry-level ECL substrates. Storage Conditions: Store at 2–8°C. TMB One Solution Product Size Cat.# TMB One Solution 100 ml G7431 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 72. AttoPhos® AP Fluorescent Substrate System Product Size Cat.# AttoPhos® AP Fluorescent Substrate System 3 × 36 mg S1000 AttoPhos® AP Fluorescent Substrate System Trial Size 1 × 36 mg S1001 Available Separately AttoPhos® Substrate 36 mg S1011 100 mg S1012 1 g S1013 AttoPhos® Buffer 60 ml S1021 240 ml S1022 For Research Use Only. Not for Use in Diagnostic Procedures. Description: AttoPhos® AP Fluorescent Substrate System contains a highly sensitive fluorescent alkaline phosphatase (AP) substrate. Features: • Sensitivity: Low fluorescence signal until enzymatically acted upon, yielding detection of AP to 0.1 attomole. • Low Background: Low fluorescence from interfering biological molecules. • Linearity: Linear kinetics over five orders of magnitude of AP concentration. • Additional Features: Excitation at 435nm, emission at 555nm and large Stokes’ shift (≈120nm). Storage Conditions: Store at 4°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 351 24Protein Quantitation and Detection For complete and up-to-date product information visit: www.promega.com Blocking Agents Product Size Conc. Cat.# Blot-Qualified BSA 10 g W3841 Tween® 20 2.5 ml 100 % W3831 For Research Use Only. Not for Use in Diagnostic Procedures. Description: This BSA (bovine serum albumin) has been tested and qualified for optimum performance in immunoblotting applications with alkaline phosphatase antibody conjugates. It is shown to be alkaline phosphatase-free. Tween® 20 is a nonionic detergent used as a buffer component for immunoscreening. In addition to blocking agents such as BSA, which saturate excess sites of antibody binding on membranes, this detergent acts in solution to dissociate nonspecific interactions with an antibody probe. Western Blue® Stabilized Substrate for Alkaline Phosphatase Product Size Cat.# Western Blue® Stabilized Substrate for Alkaline Phosphatase 100 ml S3841 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 280. TMB Stabilized Substrate for Horseradish Peroxidase Product Size Cat.# TMB Stabilized Substrate for Horseradish Peroxidase 200 ml W4121 For Research Use Only. Not for Use in Diagnostic Procedures. For additional information see page 279. BCIP/NBT Color Development Substrate (5-bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium) Product Size Cat.# BCIP/NBT Color Development Substrate 1.25/2.5 ml S3771 For Laboratory Use. For additional information see page 270. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 352 For complete and up-to-date product information visit: www.promega.com ISOQUANT® Isoaspartate Detection Kit Product Size Cat.# ISOQUANT® Isoaspartate Detection Kit 100 assays MA1010 Not For Medical Diagnostic Use. Description: The ISOQUANT® Isoaspartate Detection Kit is intended for quantitative detection of isoaspartic acid residues in proteins and peptides, which can result from the gradual, nonenzymatic deamidation of asparagine or rearrangement of aspartic acid residues during storage or handling. Because the kit does not depend on the monitoring of charge differences for detection, charge heterogeneity does not interfere with the assay. The ISOQUANT® Kit can be used on peptides or proteins such as monoclonal antibodies. Features: • Great Efficiency: Simple procedure with a test time of less than one hour. Automation possible with HPLC autosampler capability. • Economical: HPLC detection eliminates cost and inconvenience of radioactive materials handling. • Analytical: Quantitative results available. • Versatile: Perform individual samples or batches. Small sample size makes the assay suitable for research, analytical methods, formulations and process development work. • Robust: Not affected by common buffer components. • HPLC Detection Method: Fits with existing equipment and expertise. • Sensitive: Detects isoaspartate resulting from aspartic acid rearrangement as well as deamidation of asparagine. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system For complete and up-to-date product information visit: www.promega.com 353 Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Protein Interactions Live-Cell Protein Interactions 354 Protein:DNA Interactions 357 Pull-Down and Two-Hybrid Systems 358 25Protein Interactions Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 354 For complete and up-to-date product information visit: www.promega.com Live-Cell Protein Interactions NanoBiT® PPI Starter Systems Product Size Cat.# NanoBiT® PPI MCS Starter System 1 each N2014 NanoBiT® PPI Flexi® Starter System 1 each N2015 Available Separately Size Cat.# NanoBiT® PPI Control Pair (FKBP, FRB) 1 each N2016 For Research Use Only. Not for Use in Diagnostic Procedures. Description: NanoLuc® Binary Technology (NanoBiT) is a two-subunit system based on NanoLuc® luciferase that can be applied to the intracellular detection of protein:protein interactions (PPIs) in live cells. The NanoBiT® system is composed of two small subunits, Large BiT (LgBiT; 18kDa) and Small BiT (SmBiT; 11 amino acid peptide), that are expressed as fusions to target proteins of interest. The LgBiT and SmBiT subunits have been independently optimized for stability and minimal self-association. Interaction of the target proteins facilitates subunit complementation to give a bright, luminescent enzyme. The NanoBiT® PPI Starter Systems provide the vectors required to create the LgBiT and SmBiT protein fusions, a PRKACA:PRKAR2A constitutively interacting positive control pair and a negative control vector. Starter systems also include the Nano-Glo® Live Cell Assay System, a single-addition, nonlytic detection reagent used for monitoring NanoBiT® luminescence in living cells. The reagent is prepared by diluting the Nano-Glo® Live Cell Substrate with the Nano-Glo® LCS Dilution Buffer to make the Nano-Glo® Live Cell Reagent. Both substrate and buffer solutions are optimized to provide enhanced stability and reduce autoluminescence in the presence or absence of serum, increasing the sensitivity for detection of low levels of NanoBiT® luminescence. The FKBP:FRB pair is provided separately as an inducible positive control. Expression is driven by HSV-TK promoter, providing constitutive, low-level expression in mammalian cells. Using the NanoBiT® MCS Starter System, you can generate N- and C-terminal LgBiT and SmBiT fusions to proteins of interest using traditional cloning with a multiple cloning site (MCS). Using the NanoBiT® Flexi® Starter System, you can generate N- and C-terminal LgBiT and SmBiT fusions using the Flexi® Vector Cloning System, a directional cloning method based on two rare-cutting restriction enzymes, SgfI and PmeI, that provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between Flexi® Vectors without the need to resequence. To obtain your ORF clones already in Flexi® format for simple creation of fusions, visit: www.promega.com/findmygene Features: • Obtain Greater Sensitivity: Bright signal and reduced background improve sensitivity, signal:background ratio and dynamic range. • More Accurately Model PPI Biology: Minimize artifacts with small tags and low, natural expression levels; perform real-time kinetic analysis in live cells. • Precisely Measure Interaction Dynamics: Low affinity of tags minimizes spontaneous LgBiT:SmBiT association; complementation is easily reversible allowing accurate analysis of protein association and disassociation. • Perform Simple Measurement: Bright luminescent output is ideal for any luminometer with no specific filter or injector requirements. • Scale Your Assays: Assays can be scaled from bench to HTS, allowing use with any plate size up to 1,536-well format; detection reagent has been optimized for benchtop stability. Storage Conditions: Nano-Glo® LCS Dilution Buffer may be thawed and stored at room temperature. Store all other components at –30°C to –10°C. Nano-Glo® Live Cell Assay System Product Size Cat.# Nano-Glo® Live Cell Assay System 100 assays N2011 1,000 assays N2012 10,000 assays N2013 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Nano-Glo® Live Cell Assay System is a single-addition, nonlytic detection reagent used to measure NanoBiT® or NanoLuc® luminescence from living cells. The reagent is prepared by diluting the Nano-Glo® Live Cell Substrate with the Nano-Glo® LCS Dilution Buffer to make the Nano-Glo® Live Cell Reagent, a 5X stock that is added directly to cell culture medium. Both substrate and buffer solutions are optimized to provide enhanced stability. The Nano-Glo® Live Cell Reagent is designed to reduce autoluminescence in the presence or absence of serum, increasing the sensitivity for detection of low levels of NanoBiT® or NanoLuc® luminescence. The Nano-Glo® Live Cell Assay System can be used to monitor luminescence at a user-defined time point or continuously for up to 2 hours without compromising cell viability. Storage Conditions: Nano-Glo® LCS Dilution Buffer may be thawed and stored at room temperature. Store all other components at –30°C to –10°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 355 25Protein Interactions For complete and up-to-date product information visit: www.promega.com NanoBRET™ Bromodomain/Histone Interaction Assays Product Size Cat.# NanoBRET™ BRD4/Histone H3.3 Interaction Assay 1 each N1830 NanoBRET™ BRD4/Histone H4 Interaction Assay 1 each N1890 NanoBRET™ BRD9/Histone H3.3 Interaction Assay 1 each N1840 NanoBRET™ BRD9/Histone H4 Interaction Assay 1 each N1900 NanoBRET™ BRPF1/Histone H3.3 Interaction Assay 1 each N1860 NanoBRET™ BRPF1/Histone H4 Interaction Assay 1 each N1910 Available Separately NanoBRET™ Positive Control 2 × 20 μg N1581 NanoBRET™ PPI Control Pair (p53, MDM2) 2 × 20 μg N1641 NanoBRET™ Nano-Glo® Detection System 200 assays N1661 1,000 assays N1662 10,000 assays N1663 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Bromodomain (BRD)-containing proteins are critical components of nuclear protein complexes involved in the recruitment of chromatinmodifying enzymes and transcriptional regulation of acetylated chromatin. The protein:protein interaction (PPI) of the BRD-containing proteins with acetylated histones is an important method of epigenetic regulation critical for cell health and development and is of great interest for drug targeting because dysfunction in BRD modulation has been implicated as a critical event in disease formation. The NanoBRET™ Bromodomain Interaction Assays enable interaction studies of BRD-containing proteins with full-length histones in the context of natural chromatin. In addition to the full-length BRD protein, the BRD fragment alone is also included for users that may want to understand the interaction of this isolated domain. NanoBRET™ assay technology is dependent upon energy transfer from a luminescent donor (NanoLuc® luciferase) to a fluorescent acceptor (HaloTag® NanoBRET™ 618 Ligand). NanoLuc® luciferase HaloTag® protein are fused to the target proteins of interest and fusion proteins expressed at low cellular levels, enabling monitoring and screening studies of protein interactions that reflect true cellular physiology. The NanoBRET™ assay is fully reversible, enabling studies of both induction and inhibition of protein interactions. Features: • Understand Real Biology: Measure bromodomain/histone interactions in live cells in the context of natural chromatin using full-length proteins or domains. • Monitor Changes: Reversible assay technology allows you to study both induction and disruption of chromatin interactions. • See Improved Assay Performance: Bright, blue-shifted donor signal and red-shifted acceptor create optimal spectral overlap, increased signal and lower background compared to conventional BRET assays. • Scale Your Assays: Assays can be performed in 96- or 384-well formats with low variability and high reproducibility, ideal for screening applications. • Enjoy Convenience: Fully optimized assays provide a sensitive and specific method to study chromatin modulators; proven performance on GloMax® Discover System. Storage Conditions: Store at –20°C. NanoBRET™ Transcriptional Protein Assays Product Size Cat.# NanoBRET™ cMyc/MAX Interaction Assay 1 each N1870 Available Separately NanoBRET™ Positive Control 2 × 20 μg N1581 NanoBRET™ PPI Control Pair (p53, MDM2) 2 × 20 μg N1641 NanoBRET™ Nano-Glo® Detection System 200 assays N1661 1,000 assays N1662 10,000 assays N1663 For Research Use Only. Not for Use in Diagnostic Procedures. Description: NanoBRET™ Transcriptional Protein Assays are sensitive, reproducible live-cell assays designed for monitoring or screening the interaction of proteins involved in transcriptional regulation. Interactions between proteins are key events in the regulation of gene expression with protein homodimers and heterodimers interacting on DNA elements to regulate transcriptional events required for a variety of cellular responses. The NanoBRET™ cMyc/MAX Interaction Assay measures the specific interaction between the human cMyc and MAX transcription factors within their natural cellular context. The cMyc/MAX heterodimer regulates transcription related to cell proliferation, differentiation and apoptosis, making it an important candidate for drug targeting. NanoBRET™ assay technology is dependent upon energy transfer from a luminescent donor (NanoLuc® luciferase) to a fluorescent acceptor (HaloTag® NanoBRET™ 618 Ligand). NanoLuc® luciferase and HaloTag® protein are fused to the target proteins of interest and fusion proteins expressed at low cellular levels, enabling monitoring and screening studies of protein interactions that reflect true cellular physiology. The NanoBRET™ assay is fully reversible, enabling studies of both induction and inhibition of protein interactions. Features: • Understand Real Biology: Live-cell assay allows you to detect transcriptional protein interactions in real time using full-length proteins or fragments. • Monitor Changes: Reversible assay technology allows you to study both induction and inhibition of protein interactions. • See Improved Assay Performance: Bright, blue-shifted donor signal and red-shifted acceptor create optimal spectral overlap, increased signal and lower background compared to conventional BRET assays. • Scale Your Assays: Assays can be performed in 96- or 384-well formats with low variability and high reproducibility, ideal for screening applications. • Enjoy Convenience: Fully optimized assays provide a sensitive and specific method to detect interactions of transcriptional target proteins of interest; proven performance on GloMax® Discover System. Storage Conditions: Store at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 356 For complete and up-to-date product information visit: www.promega.com NanoBRET™ PPI Starter Systems Product Size Cat.# NanoBRET™ PPI MCS Starter System 1 each N1811 NanoBRET™ PPI Flexi® Starter System 1 each N1821 Available Separately NanoBRET™ Positive Control 2 × 20 μg N1581 NanoBRET™ PPI Control Pair (p53, MDM2) 2 × 20 μg N1641 NanoBRET™ Nano-Glo® Detection System 200 assays N1661 1,000 assays N1662 10,000 assays N1663 For Research Use Only. Not for Use in Diagnostic Procedures. Description: NanoBRET™ technology is an improved bioluminescence resonance energy transfer (BRET)-based technology that uses NanoLuc® luciferase as the BRET energy donor and HaloTag® protein labeled with the NanoBRET™ 618 fluorescent ligand as the energy acceptor to measure the interaction of two binding partners in live cells. NanoBRET™ Protein:Protein Interaction (PPI) Assays use NanoLuc® Luciferase and HaloTag® protein fused to target proteins of interest to enable sensitive, reproducible detection of protein interactions in the natural cellular environment. The use of full-length proteins expressed at low levels enables PPI monitoring and screening studies that reflect true cellular physiology. For more details on using NanoBRET™ technology for protein:protein interaction studies visit: NanoBRET™ Technology for Protein Interactions. The NanoBRET™ PPI Starter Systems provide the vectors required to create NanoLuc® Luciferase and HaloTag® protein fusions to target proteins of interest, the NanoBRET™ PPI Positive Control Pair (p53, MDM2) and the NanoBRET™ Nano-Glo® Detection System, which contains the NanoBRET™ Nano-Glo® Substrate used by NanoLuc® Luciferase to generate the donor signal and the HaloTag® NanoBRET™ 618 Ligand for the fluorescent energy acceptor. • MCS Starter System: Generate N- and C-terminal NanoLuc® Luciferase and HaloTag® protein fusions to target proteins using traditional cloning with a multiple cloning site (MCS). • Flexi® Starter System: Generate N- and C-terminal NanoLuc® Luciferase and HaloTag® protein fusions using the Flexi® Vector Cloning System, a directional cloning method based on two rare-cutting restriction enzymes, SgfI and PmeI, that provides a rapid, efficient and high-fidelity way to transfer protein-coding regions between Flexi® Vectors without the need to resequence. Utilize Find My Gene™ to obtain your ORF clones already in Flexi® format for simple creation of fusions. Features: • Understand Real Biology: Live-cell reagents allow you to detect protein:protein interactions in real time using full-length proteins or fragments. • Monitor Changes: Reversible assay technology allows you to study both induction and inhibition of protein interactions. • See Improved Assay Performance: Bright, blue-shifted donor signal and red-shifted acceptor create optimal spectral overlap, increased signal and lower background compared to conventional BRET assays. • Scale Your Assays: Assays can be performed in 96- or 384-well formats with low variability and high reproducibility. • Enjoy Convenience: The NanoBRET™ Nano-Glo® Starter Systems provide all of the components required to design and optimize a NanoBRET™ PPI assay for your protein interactions of choice. Storage Conditions: Store at –30°C to –10°C. NanoBRET™ Signaling Protein Assays Product Size Cat.# NanoBRET™ KRas/BRaf Interaction Assay 1 each N1880 Available Separately NanoBRET™ Positive Control 2 × 20 μg N1581 NanoBRET™ PPI Control Pair (p53, MDM2) 2 × 20 μg N1641 NanoBRET™ Nano-Glo® Detection System 200 assays N1661 1,000 assays N1662 10,000 assays N1663 For Research Use Only. Not for Use in Diagnostic Procedures. Description: NanoBRET™ Signaling Protein Assays are sensitive, reproducible live-cell assays designed for monitoring or screening the interaction of proteins involved in cell signaling events. Interactions between proteins are key events in normal cellular signal transduction pathways, and modulation of these interactions has been implicated in disease formation, making them important candidates for drug targeting. The NanoBRET™ KRas/BRaf Interaction Assay measures the specific interaction between mutant KRas (G12C) and BRaf human proteins in their natural cellular context. In epidermal growth factor receptor (EGFR) pathway-associated oncogenesis, mutations in KRas result in constitutive binding to BRaf even in the absence of growth factor, resulting in cell proliferation and suppressed apoptosis. NanoBRET™ assay technology is dependent upon energy transfer from a luminescent donor (NanoLuc® luciferase) to a fluorescent acceptor (HaloTag® NanoBRET™ 618 Ligand). NanoLuc® luciferase and HaloTag® protein are fused to the target proteins of interest and fusion proteins expressed at low cellular levels, enabling monitoring and screening studies of protein interactions that reflect true cellular physiology. The NanoBRET™ assay is fully reversible, enabling studies of both induction and inhibition of protein interactions. Features: • Understand Real Biology: Live-cell assay allows you to measure signaling protein interactions in natural cellular context using full-length proteins expressed at low cellular levels. • Monitor Changes: Reversible assay technology allows you to study both induction and inhibition of protein interactions. • See Improved Assay Performance: Bright, blue-shifted donor signal and red-shifted acceptor create optimal spectral overlap, increased signal and lower background compared to conventional BRET assays. • Scale Your Assays: Assays can be performed in 96- or 384-well formats with low variability and high reproducibility, ideal for screening applications. • Enjoy Convenience: Fully optimized assays provide a sensitive and specific method to detect interactions of signaling protein targets; proven performance on GloMax® Discover System. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 357 25Protein Interactions For complete and up-to-date product information visit: www.promega.com NanoBRET™ Nano-Glo® Detection System Product Size Cat.# NanoBRET™ Nano-Glo® Detection System 200 assays N1661 1,000 assays N1662 10,000 assays N1663 Available Separately NanoBRET™ Nano-Glo® Substrate 50 μl N1571 5 × 50 μl N1572 2 × 1.25 ml N1573 HaloTag® NanoBRET™ 618 Ligand 20 μl G9801 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The NanoBRET™ assay is a bioluminescence resonance energy transfer (BRET)-based assay that uses NanoLuc® Luciferase as the BRET energy donor and HaloTag® protein labeled with the HaloTag® NanoBRET™ 618 fluorescent Ligand as the energy acceptor to measure the interaction of two binding partners in live cells. The NanoBRET™ Nano-Glo® Detection System provides the NanoBRET™ Nano-Glo® Substrate used by NanoLuc® Luciferase to generate the donor signal and the HaloTag® NanoBRET™ 618 Ligand for the fluorescent energy acceptor. The HaloTag® NanoBRET™ 618 Ligand is added directly to the cells during plating, and the NanoBRET™ Nano-Glo® Substrate is added to the sample just prior to measuring donor and acceptor emission. Features: • Understand Real Biology: Live-cell reagents allow you to detect protein:protein interactions in real time using full-length proteins or fragments. • Monitor Changes: Reversible assay technology allows you to study both induction and inhibition of protein interactions. • See Improved Assay Performance: Bright, blue-shifted donor signal and red-shifted acceptor create optimal spectral overlap, increased signal and lower background compared to conventional BRET assays. • Scale Your Assays: Assays can be performed in 96- or 384-well formats with low variability and high reproducibility. • Enjoy Convenience: The NanoBRET™ Nano-Glo® Detection System is compatible with a diverse set of pre-built or custom NanoBRET™ PPI Assays. Storage Conditions: Store at –30°C to –10°C, protected from light. Protein:DNA Interactions HaloCHIP™ System Product Size Cat.# HaloCHIP™ System 20 reactions G9410 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloCHIP™ System is a novel method designed for the covalent capture of intracellular protein:DNA complexes without the use of antibodies and offers an efficient and robust alternative to the standard chromatin immunoprecipitation (ChIP) method. Proteins of interest are expressed in cells as HaloTag® fusion proteins, crosslinked to DNA with formaldehyde and then captured on HaloLink™ Resin, which forms a highly specific, covalent interaction with the HaloTag® portion of the fusion protein. Stringent washing removes nonspecific proteins and DNA, and heating reverses the crosslinks between the DNA and the fusion protein and releases the captured DNA fragment, which subsequently can be purified. Features: • No Requirement for Antibody: No need to make your own or purchase expensive, qualified antibodies. • Obtain Results Faster: Obtain data in 24–48 hours with fewer steps to minimize potential experimental errors. • Improved Signal-to-Noise Ratios: Enables detection of small changes in protein binding patterns using a minimal number of cells. Storage Conditions: The TE Buffer (pH 8.0), Reversal Buffer and Nuclease-Free Water may be stored at room temperature. Store the HaloLink™ Resin, Mammalian Lysis Buffer and High Salt Wash Buffer at 4°C. Store the HaloCHIP™ Blocking Ligand at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 358 For complete and up-to-date product information visit: www.promega.com Gel Shift Assay Systems Product Size Cat.# Gel Shift Assay Core System 100 reactions E3050 Gel Shift Assay System 100 reactions E3300 Available Separately HeLaScribe® Nuclear Extract, Gel Shift Assay Grade 3 × 40 μl E3521 Gel Shift Binding 5X Buffer 5 × 200 μl E3581 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The gel shift or electrophoretic mobility shift assay provides a simple and rapid method for detecting DNA-binding proteins. This method is widely used to study sequence-specific DNA-binding proteins such as transcription factors. The assay is based on the observation that complexes of protein and DNA migrate through a nondenaturing polyacrylamide gel more slowly than free DNA fragments or double-stranded oligonucleotides. The gel shift assay is performed by incubating a purified protein or a complex mixture of proteins (such as nuclear or cell extract preparations) with a 32P end-labeled DNA fragment containing the putative protein binding site. The reaction products are then analyzed on a nondenaturing polyacrylamide gel. The specificity of the DNA-binding protein for the putative binding site is established by competition experiments using unlabeled DNA fragments or oligonucleotides containing a binding site for the protein of interest or other unrelated DNA sequences. The Core System (Cat.# E3050) includes HeLa Nuclear Extract and SP1 and AP2 Consensus Oligos that can be used as positive controls and serve as a reliable system for obtaining experience with gel shift assays. In addition, the Core System contains T4 Polynucleotide Kinase and Kinase 10X Buffer for labeling oligonucleotides as well as Gel Shift Binding 5X Buffer. Cat.# E3300 contains all of the above plus consensus oligos for AP1, OCT1, CREB, NF-κB, and TFIID. Features: • Positive Controls: The Gel Shift Assay Core System includes a HeLa Nuclear Extract and consensus oligonucleotides for AP2 and SP1. • Versatile: Oligonucleotides can be 5´ end-labeled and used as proteinspecific probes or used as unlabeled oligonucleotides in competition assays. Storage Conditions: Store HeLa Nuclear Extract at –70°C. Store other components at –20°C. Pull-Down and Two-Hybrid Systems Magne™ HaloTag® Beads Product Size Cat.# Magne™ HaloTag® Beads, 20% Slurry 1 ml G7281 5 ml G7282 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Magne™ HaloTag® Beads provide a convenient method to covalently capture HaloTag® fusion proteins with magnetic particles for protein pull-downs and purification. These magnetic beads offer a high binding capacity (≥20mg/ml) for purified HaloTag® fusion proteins with low nonspecific protein binding. The magnetic handling properties allow streamlined protein purification and eliminate the need for multiple centrifugation steps, facilitating automated applications on robotic platforms. The Magne™ HaloTag® Beads (Cat.# G7281 and G7282) are the recommended replacement for the discontinued HaloLink™ Magnetic Beads (Cat.# G9311). Features: • Maximize Recovery of HaloTag® Fusion Proteins: Binding capacity ≥20mg of purified HaloTag® fusion protein per milliliter of settled particles. • Experience Superior Magnetic Handling for High-Throughput Applications: Magnetic particles encapsulated with macroporous cellulose. Storage Conditions: Store at 2–10°C. MagneGST™ Pull-Down System Product Size Cat.# MagneGST™ Pull-Down System 80 reactions V8870 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagneGST™ Pull-Down System is designed for detection of protein interactions between GST-fusion proteins expressed in bacterial lysates and prey proteins expressed in the TnT® Systems. Prey protein synthesized in the TnT® Quick Coupled Transcription/Translation Reaction is captured using bait protein (GST-fusion protein) immobilized on MagneGST™ Particles. Nonspecifically bound proteins are then washed away, and the prey protein is analyzed. Prey proteins can be detected by incorporating radioactively labeled methionine in the TnT® Quick reaction, followed by SDS-PAGE and autoradiography or by incorporating the supplied non-radioactive methionine in the TnT® reaction and detecting by Western blotting with protein-specific antibodies. Storage Conditions: Store the TnT® T7 Quick Master Mix and Methionine at –70°C. Store the RQ1 RNase-Free DNase at –20°C. Store the Nuclease-Free Water, MagneGST™ Glutathione Particles, MagneGST™ Binding/Wash Buffer and Cell Lysis Reagent at 4°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 359 25Protein Interactions For complete and up-to-date product information visit: www.promega.com HaloTag® Mammalian Pull-Down Systems Product Size Cat.# HaloTag® Complete Pull-Down System 1 each G6509 HaloTag® Mammalian Pull-Down and Labeling System 24 reactions G6500 HaloTag® Mammalian Pull-Down System 24 reactions G6504 HaloTag® Control Vector 20 μg G6591 Available Separately Protease Inhibitor Cocktail, 50X 1 ml G6521 Mammalian Lysis Buffer 40 ml G9381 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Mammalian Pull-Down Systems (Cat.# G6500, G6504 and G6509) are designed to capture and purify intracellular binary and higher order protein complexes, including transient or weakly interacting partners. HaloTag® Mammalian Pull-Down System (Cat.# G6504) includes buffers and resin necessary to perform a HaloTag® pull-down. HaloTag® Mammalian Pull-Down and Labeling System (Cat.# G6500) includes everything in G6504 plus the HaloTag® TMRDirect™ Ligand, which allows correlative cellular localization and real-time imaging studies. HaloTag® Complete Pull-Down System (Cat.# G6509) includes everything in G6500 plus a starter cloning system, Wizard® SV Gel and PCR Clean-Up System, and FuGENE® HD Transfection Reagent. The HaloTag® Control Vector provides protein expression of the HaloTag® protein in mammalian cells, E. coli or in vitro expression systems dependent on human cytomegalovirus (CMV) intermediate early enhancer, T7 or SP6 RNA polymerase promoters. It can be used as a control for any HaloTag® experimental system and can be used for both stable and transient HaloTag® expression in mammalian cells; for stable expression, co-transfection with a vector containing a selectable marker is required. The Protease Inhibitor Cocktail, 50X, is a mixture of six different protease inhibitors with different target protease specificities. This product is provided in a freeze-dried format and can be reconstituted using either 100% ethanol or DMSO. The Mammalian Lysis Buffer is designed for use with HaloTag® Mammalianbased expression systems such as the HaloTag® Mammalian Pull-Down and Labeling Systems (referenced here) as well as the HaloCHIP™ System (Cat.# G9410). Formulation consists of 50mM Tris-HCl, 150mM NaCl, 1% Triton® X-100 and 0.1% sodium deoxycholate (pH 7.5). Related Services: Mass Spec Services. Features: • Rapid, Efficient and Covalent Capture of Binary and Higher Order Complexes Directly from Lysates: Improved capture of protein partners, including transient interactions. • High Purity and Low Background: Improved accuracy in identification of proteins; covalent attachment allows bait protein to remain behind if desired. • Ability to Fluorescently Label the Same Genetic Fusion: Correlate complex capture with cellular localization. • Compatibility with All Downstream Methods of Analysis: Freedom to identify complexes in variety of applications including mass spectrometry. Storage Conditions: Store the 10X TBS Buffer and SDS Elution Buffer at room temperature. Store the HaloLink™ Resin and Mammalian Lysis Buffer at 4°C. Store the HaloTag® TMRDirect™ Ligand and powdered Protease Inhibitor Cocktail at –30 to –10°C. Reconstituted Protease Inhibitor Cocktail can be stored at 2–10°C for 12 months. HaloLink™ Resin Product Size Cat.# HaloLink™ Resin 1.25 ml G1912 2.5 ml G1913 10 ml G1914 25 ml G1915 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloLink™ Resin provides a method for covalent and oriented attachment of HaloTag® fusion proteins onto a solid surface. The resin consists of a HaloTag® ligand bound to Sepharose® beads that specifically and rapidly binds HaloTag® fusion proteins. HaloLink™ Resin has high binding capacity. Due to covalent linkage, HaloTag® fusion proteins cannot be eluted from the resin, allowing extensive washing to remove nonspecifically bound protein without the danger of eluting HaloTag® fusion proteins. The binding rate is very rapid and equivalent to biotin-streptavidin. The HaloLink™ Resin can be used in a variety of applications including: detection and analysis of protein:protein interactions (in vivo and in vitro), detection of enzymatic activity of immobilized HaloTag® fusions and one-step purification of fusion protein in conjunction with proteolytic cleavage. A variety of vectors for the expression of HaloTag® fusion proteins in bacterial, mammalian or cell-free systems are available. Please see the HaloTag® Technology Products page for more information. The HaloTag® technology offers a quick and convenient way to test protein expression of HaloTag® fusion proteins as well as monitor the efficiency of immobilization to HaloLink™ Resin by labeling with fluorescent HaloTag® TMR Ligand followed by SDS-PAGE analysis. Guidelines can be found in the HaloLink™ Resin Technical Manual #TM250. Features: • Covalent Attachment: Enables stringent washing, minimizing nonspecific background without dissociation of bound HaloTag® fusion proteins. • Fast Binding Kinetics: Enhances the detection of protein:protein interactions and enables binding of proteins at low concentrations. • Oriented Immobilization: Allows maximal enzyme activity of bound protein. • High Binding Capacity: One milliliter of settled resin binds >7mg of HaloTag® fusion proteins. Storage Conditions: Store at 4°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 360 For complete and up-to-date product information visit: www.promega.com CheckMate™ Mammalian Two-Hybrid System Product Size Cat.# CheckMate™ Mammalian Two-Hybrid System 1 system E2440 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Two-hybrid systems are extremely powerful methods for detecting protein:protein interactions in vivo. The basis of two-hybrid systems is the modular domains found in some transcription factors: a DNA-binding domain, which binds to a specific DNA sequence, and a transcriptional activation domain, which interacts with the basal transcriptional machinery. A transcriptional activation domain in association with a DNA-binding domain will promote the assembly of RNA polymerase II complexes at the TATA box and increase transcription. In the CheckMate™ Mammalian Two-Hybrid System the DNA-binding domain and the transcriptional activation domain, produced by separate plasmids, are closely associated when one protein (“X”) fused to a DNA-binding domain interacts with a second protein (“Y”) fused to a transcriptional activation domain. In this system, interaction between proteins X and Y results in transcription of a reporter gene. Features: • Mammalian System: Interactions can be studied in the cell line of choice. Proteins are more likely to be in their native conformation. Posttranslational modifications, such as glycosylation, phosphorylation and acylation, are better maintained. • Convenient Quantitation: The Dual-Luciferase® Reporter Assay System is used for detection. • Internal Control: Renilla luciferase normalizes transfection efficiency. • Fast Transient Assay: Results obtained two days after transfection, as compared to 3–4 days with the yeast system. • Stable Transfectants: The pACT Vector contains the neomycin phosphotransferase gene, which allows selection of stable transfectants. Storage Conditions: Store at –20°C. CheckMate™/Flexi® Vector Mammalian Two-Hybrid System Product Size Cat.# CheckMate™/Flexi® Vector Mammalian Two-Hybrid System 1 each C9360 Available Separately pFN10A (ACT) Flexi® Vector 20 μg C9331 pFN11A (BIND) Flexi® Vector 20 μg C9341 pGL4.31[luc2P/GAL4UAS/Hygro] Vector 20 μg C9351 CheckMate™ Positive Control Vectors 1 set C9370 CheckMate™ Negative Control Vectors 1 set C9380 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The CheckMate™/Flexi® Vector Mammalian Two-Hybrid System provides a means to confirm, validate and study suspected interactions between two proteins or domains and can also be used to generate stable cell lines for cell-based assays. Developed primarily for mammalian proteins of interest, the system can allow protein expression and post-translational modifications in an environment mimicking the native cell milieu. It is patterned on the yeast two-hybrid system with one protein of interest (“X”) fused to a DNA-binding domain and the other protein (“Y”) fused to a transcriptional activation domain. The system relies upon three plasmids that are co-transfected into mammalian cells, each plasmid having unique features. The pFN10A (ACT) Flexi® Vector contains a herpes simplex virus VP16 transcriptional activation domain upstream of the cloning site, and the pFN11A (BIND) Flexi® Vector contains the yeast GAL4DNA-binding domain upstream of the cloning site. The pFN11A (BIND) Flexi® Vector also expresses the Renilla reniformis luciferase under the control of the SV40 promoter, allowing normalization for differences in transfection efficiency. The third vector, pGL4.31[luc2P/GAL4UAS/Hygro] Vector, contains five GAL4 binding sites upstream of a minimal TATA box, which is upstream of a firefly luciferase gene that acts as a reporter for interactions between proteins X and Y. This system differs from the original CheckMate™ Mammalian Two-Hybrid System in that the vectors are compatible with the Flexi® Vector System, which allows directional cloning and rapid, efficient and high-fidelity transfer of protein coding regions between a variety of Flexi® Vectors. Features: • Mammalian-Based System: Interactions can be studied in the cell line of choice. Proteins are more likely to be in their native conformation. Post-translational modifications, such as glycosylation, phosphorylation and acylation, are better maintained. • Versatile: Vectors are based on the Flexi® Cloning technology, enabling convenient transfer of protein-coding regions for additional functional proteomics applications. • Convenient: The Dual-Luciferase® Reporter Assay System is used for detection. Storage Conditions: Store at –20°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 361 25Protein Interactions For complete and up-to-date product information visit: www.promega.com Protease Inhibitor Cocktail Product Size Cat.# Protease Inhibitor Cocktail, 50X 1 ml G6521 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Protease Inhibitor Cocktail is used to prevent protein degradation after lysing cells. The product is a mixture of six different protease inhibitors with different target protease specificities. The inhibitor cocktail is EDTA-free and provided as a powder, ready for reconstitution in 1ml of either 100% ethanol or DMSO to obtain a 50X working solution. Features: • Broad Specificity: Inhibitor cocktail is effective against a diverse number of proteases. • Great Potency: Reagent provides the best-in-class level of protease inhibition. • Highly Compatible: Works with a wide array of protein fusion tags (e.g., Flag®, His tag, GST tag) and capture technologies. It is ideally suited for HaloTag® Technology-based approaches. Storage Conditions: Store powdered Protease Inhibitor Cocktail at –30 to –10°C. Reconstituted Protease Inhibitor Cocktail can be stored at 2–10°C for 12 months. Table of Contents Section Contents Available in the Helix® on-site stocking system Sensitive enough to operate beyond the limits of other protein tags. Bright enough to detect and quantify proteins at endogenous levels. The HiBiT Protein Tagging System allows direct detection of protein abundance in cells or at the cell surface with a simple bioluminescent signal—no antibodies and no overexpression required. A New Frontier in Protein Detection Glo where none have glowed before: www.promega.com/HiBiTprotein © 2020 Promega Corporation. All Rights Reserved. PERFORMANCE TESTED CRISPR Knock-Ins GPCR Trafficking Protein Degradation For complete and up-to-date product information visit: www.promega.com 363 Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Protein Purification Antibody Purification 364 Protein Purification Kits 365 26Protein Purification Available in the Helix® on-site stocking system Table of Contents Life Science Catalog 2020 364 For complete and up-to-date product information visit: www.promega.com Antibody Purification High Capacity Magne® Streptavidin Beads and Goat Anti-Human Biotinylated IgG Product Size Cat.# High Capacity Magne® Streptavidin Beads 3 ml V7820 Goat Anti-Human Biotinylated IgG 4 ml V7830 For Research Use Only. Not for Use in Diagnostic Procedures. Description: High Capacity Magne® Streptavidin Beads are magnetic affinity beads with high specificity and high capacity for binding biotinylated antibodies and proteins. The magnetic beads are composed of iron encapsulated by macroporous cellulose, resulting in low nonspecific binding and making them ideal for use with complex biological samples. The beads also have excellent magnetic properties for rapid and efficient capture using a variety of magnetic stands. The affinity of biotin for streptavidin (Kd = 10–15) is one of the strongest and most stable interactions in biology; hence, the biotin-streptavidin interaction cannot be reversed under non-denaturing conditions. Therefore, we do not recommend the use of beads for applications in which the biotinylated molecules need to be recovered from the beads. High Capacity Magne® Streptavidin Beads are well suited for pharmacokinetics studies of therapeutic antibodies during preclinical studies. For example, biotinylated anti-human IgG bound to the High Capacity Magne® Streptavidin Beads can be used for enrichment of Human IgG from serum or plasma samples of non-primate animals and analyzed using mass spectrometry. The high capacity of the beads enables enrichment of antibodies over a wide concentration range using small amount of beads. Enrichment can be automated for high throughput and scaled up to handle various sample volumes. Goat Anti-Human Biotinylated IgG is provided at a concentration of 0.5mg/ml in phosphate-buffered saline (pH 7.4) with 0.1% sodium azide. Features: • Improve Your Results: High binding capacity and low non-specific binding. • Use in High-Throughput Formats with Robotics: Rapid magnetic response. • Characterize Large Dynamic Range: High binding capacity. Storage Conditions: Store at 4°C. Do not freeze the solution or let it dry during storage or use. Magne™ Protein G and Magne™ Protein A Beads Product Size Cat.# Magne™ Protein G Beads, 20% Slurry 1 ml G7471 5 ml G7472 50 ml G7473 Magne™ Protein A Beads, 20% Slurry 1 ml G8781 5 ml G8782 50 ml G8783 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Magne™ Protein G and Magne™ Protein A Beads are magnetic affinity beads with high specificity and high capacity for purification of immunoglobulins from cell culture media, ascites and serum samples. These paramagnetic beads are composed of iron encapsulated in macroporous cellulose with low nonspecific binding. The magnetic beads use a novel attachment chemistry to immobilize recombinant Protein G or Protein A protein molecules in the same orientation on the surface of the bead. The oriented attachment is known to improve the functionality of immobilized proteins. These beads offer a convenient method for achieving high purity and high recovery of monoclonal and polyclonal antibodies from a variety of biological samples. The superb magnetic properties of Magne™ Protein G and Magne™ Protein A Beads allow rapid and efficient capture of antibodies either with manually processed samples or in a high-throughput manner using the Promega ReliaPrep™ LV 32 HSM Instrument or a robotic platform such as the Beckman Coulter Biomek® FX. Features: • High Capacity: Binding capacities in excess of 25mg per milliliter of settled beads are observed depending on antibody species and isotype. • Ease of Handling: Minimize losses during purification and increase sample throughput due to exceptional magnetic properties. • High Purity: Ensure high-quality purification because of low nonspecific binding on beads. • Optimized Performance: Use validated antibody purification methods for small (20µl) to medium (50ml) sample volumes. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 4°C. Do not freeze. Do not allow beads to dry during storage or use. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 365 26Protein Purification For complete and up-to-date product information visit: www.promega.com Protein Purification Kits HaloTag® Protein Purification System Product Size Cat.# HaloTag® Protein Purification System 1 each G6280 HaloTag® Protein Purification System Sample Pack 1 each G6270 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Protein Purification System is designed to purify proteins fused to the HaloTag® protein tag that enhances the expression and solubility of recombinant proteins. HaloTag® Technology enables the covalent, efficient and specific capture of a protein of interest onto HaloLink™ Resin, thus overcoming the equilibrium-based limitations associated with affinity tags (i.e., poor capture of proteins expressed at low levels and protein loss during washing of the purification resin). HaloTag® technology offers a quick and convenient way to test expression of HaloTag® fusion proteins as well as monitor the efficiency of immobilization to HaloLink™ Resin by labeling with fluorescent HaloTag® TMR Ligand followed by SDS-PAGE analysis. Guidelines can be found in the HaloLink™ Resin Technical Manual #TM250, the HaloLink™ Protein Array Technical Manual #TM310 and the HaloCHIP™ System Technical Manual #TM075. Outline of Procedure The HaloTag® protein, a 34kDa mutated hydrolase, covalently attaches to HaloLink™ Resin via an immobilized chloroalkane ligand. TEV Protease cleaves the target protein from the HaloLink™ Resin. The TEV Protease, which has an N-terminal (HQ) tag, is removed from the protein of interest using HisLink™ Resin, and the purified protein of interest is recovered. The appropriate vector that encodes the HaloTag® protein and expresses protein optimally in E. coli is pFN18A HaloTag® T7 Flexi® Vector (G2751) or pFN18K HaloTag® T7 Flexi® Vector (G2681). These vectors can be purchased separately. Features: • Experience Superior Yield, Purity and Specific Activity of Soluble, Functional Proteins Compared to His-Tag, GST and MBP Affinity Tags: Specific and covalent HaloTag® fusion protein capture and immobilization on HaloLink™ Resin. • Achieve Enhanced Target Protein Expression in Prokaryotic, Mammalian and Cell-Free Systems: Proteins are expressed as HaloTag® fusion proteins. • Purify Poorly Expressed Fusion Proteins: Rapid, specific and covalent capture of HaloTag® protein onto HaloLink™ Resin is a nonequilibrium process. • Efficiently Recover Tag-Free Target Protein using TEV Protease Cleavage: Optimized TEV protease recognition site within the interconnecting polypeptide separating the HaloTag® protein and the fusion partner. HaloTag® protein remains immobilized on the resin due to covalent capture. • Save Time: One buffer compatible with downstream applications for all purification steps. • Perform Easy In-Gel Detection and Quantification of Protein Expression Levels with Fluorescent HaloTag® Ligands: Highly stable HaloTag® protein-ligand interaction permits boiling with SDS sample buffer followed by resolving on SDS-PAGE. Storage Conditions: Store the HaloLink™ Resin and HisLink™ Resin at 4°C. Do not freeze the resins. Store the TEV Protease at –20°C. HaloTag® Mammalian Protein Purification System Product Size Cat.# HaloTag® Mammalian Protein Detection and Purification System 1 each G6795 HaloTag® Mammalian Protein Purification System 1 each G6790 HaloTag® Mammalian Protein Detection and Purification System Sample Pack 1 each G6799 Available Separately Size Conc. Cat.# HaloTEV Protease 200 μl 5 u/µl G6601 800 μl 5 u/µl G6602 HaloTag® TMRDirect™ Ligand 30 μl 0.1 mM G2991 Protease Inhibitor Cocktail, 50X 1 ml G6521 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Mammalian Protein Purification System (Cat.# G6790) is an optimized kit for purification of HaloTag® fusion proteins from mammalian cell culture lysates. HaloTag® fusion proteins form a highly specific and covalent bond with the HaloLink™ Resin. The covalent binding coupled with the low nonspecific binding of the HaloLink™ Resin provides superior purity and recovery of recombinant proteins from cultured mammalian cells, even at low expression levels. The HaloTag® Mammalian Protein Detection and Purification System (Cat.# G6795) also includes HaloTag® TMRDirect™ Ligand. The simple-to-use fluorescent detection of the HaloTag® fusion facilitates rapid optimization of expression and purification conditions. Features: • Purify More Protein: HaloLink™ Resin covalently binds >7mg/ml of HaloTag® fusion protein (10X more capacity compared to FLAG®). Recovery is highly efficient, commonly >75%. • Higher Purity: Covalent capture allows extensive and/or stringent washes without loss of bound protein, resulting in very low (<0.1%) nonspecific binding and a highly pure protein. • Easily Scalable: Scale up and down, important for obtaining mg-plus quantities. • Optimized for Mammalian Protein Expression: The HaloTag® platform allows flexibility to move between purification, pull-downs and cellular imaging with a single construct. Storage Conditions: Store Spin Columns at room temperature. Store HaloLink™ Resin at 4°C. Store HaloTEV Protease below –65°C. Store HaloTag® TMRDirect™ Ligand and powdered Protease Inhibitor Cocktail at –30 to –10°C. Reconstituted Protease Inhibitor Cocktail can be stored at 2–10°C for 12 months. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 366 For complete and up-to-date product information visit: www.promega.com Magne™ HaloTag® Beads Product Size Cat.# Magne™ HaloTag® Beads, 20% Slurry 1 ml G7281 5 ml G7282 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The Magne™ HaloTag® Beads provide a convenient method to covalently capture HaloTag® fusion proteins with magnetic particles for protein pull-downs and purification. These magnetic beads offer a high binding capacity (≥20mg/ml) for purified HaloTag® fusion proteins with low nonspecific protein binding. The magnetic handling properties allow streamlined protein purification and eliminate the need for multiple centrifugation steps, facilitating automated applications on robotic platforms. The Magne™ HaloTag® Beads (Cat.# G7281 and G7282) are the recommended replacement for the discontinued HaloLink™ Magnetic Beads (Cat.# G9311). Features: • Maximize Recovery of HaloTag® Fusion Proteins: Binding capacity ≥20mg of purified HaloTag® fusion protein per milliliter of settled particles. • Experience Superior Magnetic Handling for High-Throughput Applications: Magnetic particles encapsulated with macroporous cellulose. Storage Conditions: Store at 2–10°C. HaloTag® Standard Protein Product Size Cat.# HaloTag® Standard Protein 30µg G4491 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The HaloTag® Standard Protein is a 61kDa purified HaloTag®-GST fusion protein supplied at a concentration of 3.0mg/ml. HaloTag® Standard Protein can be used to estimate the expression level of your HaloTag® fusion protein. Features: • 61kDa purified HaloTag®-GST fusion protein • Supplied at a concentration of 3.0mg/ml • Estimate the expression level of your HaloTag® fusion protein Storage Conditions: Store at –20°C. Magne™ Protein G and Magne™ Protein A Beads Product Size Cat.# Magne™ Protein G Beads, 20% Slurry 1 ml G7471 5 ml G7472 50 ml G7473 Magne™ Protein A Beads, 20% Slurry 1 ml G8781 5 ml G8782 50 ml G8783 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Magne™ Protein G and Magne™ Protein A Beads are magnetic affinity beads with high specificity and high capacity for purification of immunoglobulins from cell culture media, ascites and serum samples. These paramagnetic beads are composed of iron encapsulated in macroporous cellulose with low nonspecific binding. The magnetic beads use a novel attachment chemistry to immobilize recombinant Protein G or Protein A protein molecules in the same orientation on the surface of the bead. The oriented attachment is known to improve the functionality of immobilized proteins. These beads offer a convenient method for achieving high purity and high recovery of monoclonal and polyclonal antibodies from a variety of biological samples. The superb magnetic properties of Magne™ Protein G and Magne™ Protein A Beads allow rapid and efficient capture of antibodies either with manually processed samples or in a high-throughput manner using the Promega ReliaPrep™ LV 32 HSM Instrument or a robotic platform such as the Beckman Coulter Biomek® FX. Features: • High Capacity: Binding capacities in excess of 25mg per milliliter of settled beads are observed depending on antibody species and isotype. • Ease of Handling: Minimize losses during purification and increase sample throughput due to exceptional magnetic properties. • High Purity: Ensure high-quality purification because of low nonspecific binding on beads. • Optimized Performance: Use validated antibody purification methods for small (20µl) to medium (50ml) sample volumes. • Choose Your Configuration: Learn more about our custom options for this product at: www.promega.com/custom/ Storage Conditions: Store at 4°C. Do not freeze. Do not allow beads to dry during storage or use. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 367 26Protein Purification For complete and up-to-date product information visit: www.promega.com MagneGST™ Pull-Down System Product Size Cat.# MagneGST™ Pull-Down System 80 reactions V8870 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagneGST™ Pull-Down System is designed for detection of protein interactions between GST-fusion proteins expressed in bacterial lysates and prey proteins expressed in the TnT® Systems. Prey protein synthesized in the TnT® Quick Coupled Transcription/Translation Reaction is captured using bait protein (GST-fusion protein) immobilized on MagneGST™ Particles. Nonspecifically bound proteins are then washed away, and the prey protein is analyzed. Prey proteins can be detected by incorporating radioactively labeled methionine in the TnT® Quick reaction, followed by SDS-PAGE and autoradiography or by incorporating the supplied non-radioactive methionine in the TnT® reaction and detecting by Western blotting with protein-specific antibodies. Storage Conditions: Store the TnT® T7 Quick Master Mix and Methionine at –70°C. Store the RQ1 RNase-Free DNase at –20°C. Store the Nuclease-Free Water, MagneGST™ Glutathione Particles, MagneGST™ Binding/Wash Buffer and Cell Lysis Reagent at 4°C. HaloTEV Protease Product Size Conc. Cat.# HaloTEV Protease 200 μl 5 u/µl G6601 800 μl 5 u/µl G6602 For Research Use Only. Not for Use in Diagnostic Procedures. Description: HaloTEV Protease (81kDa) is a fusion between the HaloTag® protein and TEV protease, a highly specific proteolytic enzyme that cleaves at a specific TEV site, a specific seven-amino-acid sequence (ENLYFQ(G/S)). HaloTEV Protease allows covalent immobilization on HaloLink™ Resin and removal from a cleavage reaction in a single-step purification. The covalent capture of HaloTEV Protease improves purity of the final target protein and assures the improved recovery of the TEV protease. Features: • Improve Final Protein Purity: Covalently remove HaloTEV from your purified protein with HaloLink™ Resin. • Optimized for HaloTag® Purifications: Proteins can be purified tag-free in a single step as the HaloLink™ Resin will bind both HaloTag® protein tag and the HaloTEV protease. Storage Conditions: Store below –65°C. Streptavidin Product Size Cat.# Streptavidin 1 mg Z7041 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Promega Streptavidin is purified by affinity chromatography and is of the highest quality available. Storage Conditions: Store at –20°C. Streptavidin Alkaline Phosphatase Product Size Cat.# Streptavidin Alkaline Phosphatase 0.5 ml V5591 For Research Use Only. Not for Use in Diagnostic Procedures. Description: Streptavidin Alkaline Phosphatase is used for the detection of biotinylated molecules. Composition: Conjugated Streptavidin Alkaline Phosphatase in PBS, 1mg/ml BSA, 1mM MgCl2 , 0.1mM ZnCl2 and 0.02% sodium azide. Features: • Quality Tested: Streptavidin Alkaline Phosphatase is quality tested to ensure optimal performance for the detection of biotinylated molecules. Storage Conditions: Store at 4°C. Do not freeze! MagZ™ Protein Purification System Product Size Cat.# MagZ™ Protein Purification System 30 reactions V8830 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagZ™ Protein Purification System provides a simple, rapid and reliable method for the purification of expressed polyhistidine- or HQtagged proteins, which are 99% free of hemoglobin contamination, from rabbit reticulocyte lysate. Based on the use of proprietary, paramagnetic precharged particles, polyhistidine- or HQ-tagged protein can be isolated from 50–500μl of TnT® Coupled Transcription/Translation reactions. Polyhistidine- or HQ-tagged proteins bind to the particles in minutes, while unbound proteins are washed away, and the target protein is eluted with imidazole. Features: • Specific: Minimal hemoglobin (<0.1%) binding to the MagZ™ Binding Particles. • Quick: No long incubations are required. • Versatile: Binding/wash and elution conditions can be further optimized for individual polyhistidine- or HQ-tagged proteins. Storage Conditions: Store at 4°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 368 For complete and up-to-date product information visit: www.promega.com HisLink™ Protein Purification Systems Product Size Cat.# HisLink™ Spin Protein Purification System 25 reactions V1320 HisLink™ Protein Purification Resin 5 ml V8823 50 ml V8821 For Research Use Only. Not for Use in Diagnostic Procedures. Description: HisLink™ Protein Purification System is designed for purification of polyhistidine (His)-tagged or HQ-tagged proteins directly from culture medium containing bacterial cells expressing the tagged protein of interest. The product uses the HisLink™ Protein Purification Resin, a macroporous silica resin derivatized with a high level of tetradentate-chelated nickel (>20mmol Ni/ ml settled resin). The resin performs well in either column, batch or vacuumbased methods with a binding capacity of >15mg/ml of resin. The HisLink™ Protein Purification Resin is useful in all general immobilized metal affinity chromatography (IMAC) applications matrix as well as in low- to mediumpressure liquid chromatography systems. The bacterial cells are lysed using the FastBreak™ Cell Lysis Reagent (Cat.# V8573), and the crude lysate is combined with the HisLink™ Resin. The addition of these reagents results in simultaneous bacterial lysis and binding of the polyhistidine- or HQ-tagged proteins. The samples are transferred to userprovided columns or to included Spin Columns, where the untagged proteins are washed away and the His-tagged protein is recovered by elution with imidazole. If desired, the resin may be used in vacuum filtration devices (e.g., Vac-Man® Vacuum Manifold [Cat.# A7231]) to rapidly process simultaneous samples. Features: • Save Time: No centrifugation (pre-clearing) required; polyhistidine- or HQ-tagged proteins are purified directly from cleared or crude cell lysates. • Quick: No long lysozyme incubations are required for cell lysis. • Flexible and Versatile: Perform purification manually in batch, using a vacuum manifold, using liquid chromatography or liquid handling platform. Storage Conditions: Store the system and resin at 4°C. Plates may be stored at 4°C or room temperature. Store Spin Columns, Collection Tubes and FastBreak™ Cell Lysis Reagent at room temperature. After reconstitution, store the DNase I in aliquots at –20°C. MagneGST™ Protein Purification System Product Size Cat.# MagneGST™ Protein Purification System 40 reactions V8600 200 reactions V8603 MagneGST™ Glutathione Particles 4 ml V8611 20 ml V8612 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagneGST™ Protein Purification System provides a simple, rapid and reliable method for the purification of glutathione-S-transferase (GST) fusion proteins. Immobilized glutathione paramagnetic particles (MagneGST™ Particles) are used to isolate GST-tagged protein directly from a crude or cleared lysate using either a manual or automated procedure and requires use of a magnetic stand. GST-tagged proteins can be purified on a small scale from 1ml of culture or on a large scale using more than 50ml of culture. Samples also can be processed using a robotic platform. MagneGST™ particles are supplied as a 25% slurry and have a binding capacity of 5–10mg of GST protein per 1ml of settled resin. Features: • Simple: One-step purification of multiple samples with easy handling. • Quick: After cell lysis, no requirement for high-speed centrifugation to clear lysate. • Scalable: Scalable protocol using 1–50ml of cell culture. • Efficient: Achieve high yields with little or no nonspecific background. Storage Conditions: The complete system consists of two individual parts, each with a different storage condition. Store individual boxes at specified temperatures of 4°C and –70°C. FastBreak™ Cell Lysis Reagent Product Size Cat.# FastBreak™ Cell Lysis Reagent, 10X 15 ml V8571 60 ml V8572 100 ml V8573 For Research Use Only. Not for Use in Diagnostic Procedures. Description: FastBreak™ Cell Lysis Reagent is designed for the efficient, gentle lysis of E. coli cultures without the need for centrifugation or mechanical cell disruption. The reagent is provided as a 10X concentrate and contains a proprietary nonionic detergent to facilitate lysis. Add the reagent directly to E. coli cultures. Following a brief incubation, the cells are disrupted, and the protein of interest is released. Recombinant proteins can be directly screened in the cell extract or purified by the addition of the appropriate affinity matrix such as the MagneHis™ Protein Purification System. This product is suitable for both manual and automated protocols. Features: • Save Time: Eliminate centrifugation or mechanical disruption. • Easy to Use: Add and incubate. • Flexible: Use manually or on a robotic platform. Storage Conditions: Store at 4–25°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 369 26Protein Purification For complete and up-to-date product information visit: www.promega.com MagneHis™ Protein Purification System Product Size Cat.# MagneHis™ Protein Purification System 65 reactions V8500 325 reactions V8550 MagneHis™ Ni-Particles 2 ml V8560 10 ml V8565 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The MagneHis™ Protein Purification System provides a simple, rapid and reliable method for the purification of polyhistidine- or HQ-tagged, expressed proteins. Paramagnetic precharged nickel particles (MagneHis™ Ni-Particles) are used to isolate polyhistidine- or HQ-tagged protein directly from a crude cell lysate using either a manual (requires use of a magnetic stand) or automated procedure. Using a tube format, polyhistidineor HQ-tagged protein can be purified on a small scale using less than 1ml of culture or on a large scale using more than 1 liter of culture. Samples can be processed in a high-throughput manner using a robotic platform such as the Beckman Coulter Biomek® 2000 or FX or Tecan Genesis® RSP. Features: • Simple: No centrifugation or vacuum is required once the cells are lysed. • Flexible: MagneHis™ Ni-Particles are compatible with a variety of common buffers. • Efficient: Binding capacity is up to 1mg of polyhistidine-tagged protein per 1ml of MagneHis™ Ni-Particles. Storage Conditions: Store at 4°C. PinPoint™ Xa Protein Purification System Product Size Cat.# PinPoint™ Xa Protein Purification System 1 system V2020 For Research Use Only. Not for Use in Diagnostic Procedures. Description: The PinPoint™ Xa Protein Purification System is designed for the production and purification of fusion proteins that are biotinylated in vivo. The DNA coding for the protein of interest is cloned into a PinPoint™ Vector downstream of a sequence encoding a peptide that becomes biotinylated in vivo. Biotinylated fusion proteins are produced in E. coli and are affinitypurified using the SoftLink™ Soft Release Avidin Resin. This proprietary resin allows elution of the fusion protein under nondenaturing conditions. The PinPoint™ Vectors feature the encoded endoproteinase Factor Xa (pronounced “ten a”) proteolytic site that provides a way to separate the purification tag from the native protein, and the vectors carry a convenient multiple cloning region for ease in construction of fusion proteins. The system contains vectors in all possible sense reading frames, an avidinconjugated resin, Streptavidin-Alkaline Phosphatase, a purification column and biotin. The PinPoint™ Xa Control Vector contains the chloramphenicol acetyltransferase (CAT) gene and is provided as a means of monitoring protein expression, purification and processing conditions. The system generally yields 1–5mg of protein per liter of culture. Features: • In vivo Biotinylation Tag: Allows purification of fusion proteins; many proteins produced have been soluble. • Easy to Use: Purification of biotinylated proteins with the SoftLink™ Resin can be performed by column or batch purification. • Easy Detection: Streptavidin Alkaline Phosphatase can be used to detect the biotinylated fusion protein in a pseudo-Western format to monitor purification. • Flexible: PinPoint™ Vectors are supplied for all reading frames. • Gentle Release Conditions: SoftLink™ Resin allows release of the fusion protein under nondenaturing conditions. • tac Promoter: Allows tightly regulated expression. Storage Conditions: Store the PinPoint™ Purification Column at room temperature. Store all remaining components at 4°C. The vectors may be stored at –20°C. Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 370 For complete and up-to-date product information visit: www.promega.com SoftLink™ Soft Release Avidin Resin Product Size Cat.# SoftLink™ Soft Release Avidin Resin 1 ml V2011 5 ml V2012 For Research Use Only. Not for Use in Diagnostic Procedures. Description: SoftLink™ Avidin Resin can be used for the isolation and purification of biotinylated molecules. SoftLink™ Resin is a rigid, methacrylate polymeric gel filtration matrix, functionalized with covalently bound, monomeric avidin. Monomeric avidin binds biotin with a Kd value of 10–7M, allowing reversible binding of bound biotinylated proteins under mild elution conditions. Native, or tetrameric, avidin binds biotin with a very strong affinity (Kd = 10–15M), which in turn requires strong denaturing conditions for eluting bound material. Monomeric avidin allows the specificity of capture but also the mildness of release appropriate for the purification of sensitive biological materials. Features: • Sensitive: Binds 20–40nmol of biotinylated protein per milliliter of resin. • Easy to Use: Bound biotinylated molecules can be eluted under mild nondenaturing conditions (5mM biotin). • Versatile: Retains biotin binding ability following exposure to a wide range of pH, low or high ionic strength, 6M guanidine and 1% SDS. • Reusable: Regenerates at least 10 times without loss of binding capacity. • Robust: Supports high flow rates (300cm/hour) and centrifugal forces (1,500 × g) in batch applications. • Flexible: Purifications by batch or column method. Storage Conditions: Store at 4°C. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 371 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com Index: A–Z Index and Legal Reference Products tagged with the Helix® icon are available for distribution through our convenient on-site stocking program in a freezer, refrigerated unit or an ambient cabinet. For more information visit: www.promega.com/helix Index: A–Z 372 Index by Catalog Number 380 Legal Reference 402 Table of Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 372 For complete and up-to-date product information visit: www.promega.com Index: A–Z 2800M Control DNA…………………34, 35, 259, 260, 261, 262, 265, 312, 313 4-1BB Bioassay…………………………………………………………………………..237 4-CORE® Buffer Pack……………………………………………………………………114 5M Sodium Chloride, Molecular Biology Grade……………………………………268 5X PCR Buffer A…………………………………………………………………………..314 5X PCR Buffer B ………………………………………………………………………….314 5X PCR Buffer C ………………………………………………………………………….314 5X PCR Buffer D ………………………………………………………………………….314 5X PCR Buffer E…………………………………………………………………………..314 5X PCR Buffer F…………………………………………………………………………..314 5X PCR Buffer G ………………………………………………………………………….314 5X PCR Buffer H ………………………………………………………………………….314 6 × 5 LC-MS/MS Peptide Reference Mix……………………………………180, 321 Access RT-PCR System…………………………………………………………………193 AccessQuick™ RT-PCR System………………………………………………………192 AccuMAP™ Low pH Protein Digestion Kit ………………………………….243, 322 Acrylamide, Molecular Grade ………………………………………………………….268 ADCC Bioassays………………………………………………………………………….236 ADCP Bioassays ………………………………………………………………………….235 ADP-Glo™ Kinase Assay…………………………………………………………………47 ADP-Glo™ Max Assay……………………………………………………………………52 Agarose, LE, Analytical Grade………………………………………………………….268 Agarose, LMP, Preparative Grade for Large Fragments (>1,000bp)……………………………………………………..268 Agarose, LMP, Preparative Grade for Small Fragments (10 to 1,000bp) ……………………………………………….269 Agarose, Low Melting Point, Analytical Grade……………………………………..269 AgeI ………………………………………………………………………………………….105 Alkaline Phosphatase, Calf Intestinal (CIAP)………………………………………..115 Alkaline Phosphatase-Conjugated Antibodies……………………………………….71 AluI …………………………………………………………………………………………..105 Amino Acid Mixtures …………………………………………………………………….336 Ammonium Sulfate, Molecular Biology Grade……………………………………..269 AMP-Glo™ Assay………………………………………………………………………….51 AMV Reverse Transcriptase……………………………………………………..171, 193 Anti-ACTIVE® Caspase-3 pAb ……………………………………………………..18, 69 Anti-ACTIVE® JNK pAb, Rabbit, (pTPpY)………………………………………………69 Anti-ACTIVE® MAPK pAb, Rabbit, (pTEpY)……………………………………………69 Anti-β-Galactosidase mAb……………………………………………………………….69 Anti-βIII Tubulin mAb………………………………………………………………………71 Anti-HaloTag® Monoclonal Antibody …………………………………………………..70 Anti-HaloTag® pAb …………………………………………………………………………72 Anti-Human p75 pAb ……………………………………………………………………..70 Anti-Luciferase pAb ……………………………………………………………………….70 Anti-PARP p85 Fragment pAb……………………………………………………..18, 70 Antibiotic G-418 Sulfate ………………………………………………………………..270 ApaI ………………………………………………………………………………………….105 Apo-ONE® Homogeneous Caspase-3/7 Assay ……………………………………..16 ApoLive-Glo™ Multiplex Assay…………………………………………………………14 ApoTox-Glo™ Triplex Assay………………………………………………………13, 179 Arg-C, Sequencing Grade ………………………………………………………………325 Asp-N, Sequencing Grade ……………………………………………………………..325 AttoPhos® AP Fluorescent Substrate System………………………………………350 Autophagy Assay …………………………………………………………………………..18 Bacterial Strains…………………………………………………………………………..132 BacTiter-Glo™ Microbial Cell Viability Assay…………………………………….5, 21 BamHI……………………………………………………………………………………….105 BCIP/NBT Color Development Substrate (5-bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium) ………………270 BclI …………………………………………………………………………………………..106 Beetle Luciferin, Potassium Salt …………………………………………………81, 270 BenchTop DNA Markers…………………………………………………………………..98 β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer…………….83 Beta-Glo® Assay System …………………………………………………………………83 BglI …………………………………………………………………………………………..106 BglII …………………………………………………………………………………..106, 131 Bio-Glo™ Luciferase Assay System…………………………… 233, 234, 240, 241 Bisacrylamide, Molecular Grade (N,N´-Methylenebisacrylamide)………………………………………………………..270 BL21(DE3)pLysS Competent Cells……………………………………………………330 Blocking Agents…………………………………………………………………………..351 Blue/Orange Loading Dye, 6X …………………………………………………………271 Bone DNA Extraction Kit, Custom…………………………………………………….254 Boric Acid, Molecular Biology Grade (orthoboric acid) …………………………..271 Bovine Serum Albumin, Acetylated ……………………………………………114, 271 Bright-Glo™ Luciferase Assay System……………………………………………….80 Broad Range Protein Molecular Weight Markers………………………………….103 Calpain-Glo™ Protease Assay………………………………………………………..343 cAMP-Dependent Protein Kinase, Catalytic Subunit……………………………….49 cAMP-Glo™ Assay………………………………………………………………………..39 cAMP-Glo™ Max Assay………………………………………………………………….40 Canine Pancreatic Microsomal Membranes……………………………………….336 Casework Direct Kit, Custom…………………………………………………………..252 CaspACE™ FITC-VAD-FMK In Situ Marker ………………………………………….16 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 373 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com Index: A–Z Caspase Inhibitor Z-VAD-FMK…………………………………………………………..17 Caspase-Glo® 1 Inflammasome Assay………………………………………………..29 Caspase-Glo® 3/7 Assay Systems……………………………………………………..14 Caspase-Glo® 8 Assay Systems………………………………………………………..15 Caspase-Glo® 9 Assay Systems………………………………………………………..15 Cell-Based Proteasome-Glo™ Assays………………………………………………343 CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay (MTS)…………………………………………………………………23 CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS)…………………………………………………………………22 CellTiter 96® Non-Radioactive Cell Proliferation Assay (MTT)…………………………………………………………………23 CellTiter-Blue® Cell Viability Assay……………………………………………………..24 CellTiter-Glo® 2.0 Assay…………………………………………………………….19, 61 CellTiter-Glo® 3D Cell Viability Assay ………………………………………………….21 CellTiter-Glo® Luminescent Cell Viability Assay……………………………………..20 CellTiter-Glo® One Solution Assay ……………………………………………………..20 CellTox™ Green Cytotoxicity Assay……………………………………………………26 CfoI…………………………………………………………………………………………..106 CheckMate™ Mammalian Two-Hybrid System ……………………………219, 360 CheckMate™/Flexi® Vector Mammalian Two-Hybrid System…………..218, 360 Chymotrypsin, Sequencing Grade…………………………………………………….324 ClaI …………………………………………………………………………………………..106 ClickFit Microtube, 1.5ml. 134, 137, 138, 142, 143, 149, 203, 204, 205, 253, 255, 256, 304, 306, 307 Coelenterazines……………………………………………………………………..82, 271 Coincidence Reporter Vectors……………………………………………………86, 226 Competent Cells ………………………………………………………………………….132 Conventional DNA Markers…………………………………………………………….101 CTLA-4 Blockade Bioassay…………………………………………………………….239 CW Microfuge Tubes, 1.5ml…………………………………………………….135, 256 CW Spin Baskets………………………………………………………………….135, 256 CYP450 Assay Systems…………………………………………………………………….8 CytoTox 96® Non-Radioactive Cytotoxicity Assay…………………………………..28 CytoTox-Fluor™ Cytotoxicity Assay……………………………………………………27 CytoTox-Glo™ Cytotoxicity Assay………………………………………………………27 CytoTox-ONE™ Homogeneous Membrane Integrity Assay………………………28 DdeI………………………………………………………………………………………….107 DeadEnd™ Colorimetric TUNEL System……………………………………………..17 DeadEnd™ Fluorometric TUNEL System …………………………………………….17 Deoxynucleotide Triphosphates (dNTPs)………………………………189, 195, 316 Deoxyuridine Triphosphate (dUTP) …………………………………………….189, 316 Diamond™ Nucleic Acid Dye………………………………………………………….271 Differex™ System ……………………………………………………………………….253 Digitonin………………………………………………………………………………………28 DNA 5´ End-Labeling System………………………………………………………….119 DNA IQ™ Casework Pro Kit for Maxwell® 16……………………………………..256 DNA IQ™ Reference Sample Kit for Maxwell® 16 ……………………………….255 DNA IQ™ System………………………………………………………………………..255 DNA Ladders………………………………………………………………………………100 DNA Polymerase I ………………………………………………………………………..115 DNA Polymerase I Large (Klenow) Fragment ………………………………………115 DNA Polymerase I Large (Klenow) Fragment, Exonuclease Minus……………116 DNA Step Ladders………………………………………………………………………….99 DNA-Dependent Protein Kinase…………………………………………………………49 DNA-Dependent Protein Kinase Peptide Substrate ………………………………..49 dNTP Mix …………………………………………………………………………………..188 DpnI………………………………………………………………………………………….107 DPPIV-Glo™ Protease Assay………………………………………………………….342 DTT, Molecular Grade (DL-Dithiothreitol) ……………………………………………272 Dual-Glo® Luciferase Assay System …………………………………………………..76 Dual-Luciferase® Reporter Assay System…………………………………………….77 E. coli S30 Extract System for Circular DNA ……………………………………….338 E. coli S30 Extract System for Linear Templates………………………………….337 E. coli T7 S30 Extract System for Circular DNA …………………………………..337 ECL Western Blotting Substrate……………………………………………………….350 EcoRI ………………………………………………………………………………………..107 EcoRV ……………………………………………………………………………………….107 EDTA, 0.5M (pH 8.0), Molecular Biology Grade……………………..138, 205, 272 EDTA, Disodium Salt (Dihydrate), Molecular Biology Grade …………………….272 Elastase …………………………………………………………………………………….325 EnduRen™ In Vivo Renilla Luciferase Substrate……………………………………67 EnduRen™ Live Cell Substrate…………………………………………………………82 ENLITEN® ATP Assay System……………………………………………………………..5 ENLITEN® rLuciferase/Luciferin Reagent……………………………………………….5 Epidermal Growth Factor, Human, Recombinant ……………………………………53 Ethidium Bromide Solution, Molecular Grade………………………………………272 Exonuclease III…………………………………………………………………………….120 Factor Xa Protease……………………………………………………………………….328 FastBreak™ Cell Lysis Reagent………………………………………………………368 Fixed-Tissue Genomic DNA Purification …………………………………………….140 Flexi® Cloning System…………………………………………………………………..123 Flexi® Rabbit Reticulocyte Lysate System…………………………………………..335 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 374 For complete and up-to-date product information visit: www.promega.com Index: A–Z Fluorescent Cell Viability Assay………………………………………………………….22 FluoroTect™ GreenLys in vitro Translation Labeling System…………………….349 Forensic Grade Consumables ………………………………………………….134, 256 Formamide, Molecular Grade………………………………………………………….273 FuGENE® 6 Transfection Reagent………………………………………………………95 FuGENE® HD Transfection Reagent…………………………………………………….96 GDP-Glo™ Glycosyltransferase Assay………………………………………………..38 Gel Drying Film……………………………………………………………………………283 Gel Drying Kit………………………………………………………………………………283 Gel Shift Assay Systems…………………………………………………………167, 358 GenePrint® 10 System ……………………………………………………………………34 GenePrint® 24 System …………………………………………………………….35, 312 GenePrint® 5C Matrix Standard………………………………………………….35, 312 Genetic Identity Automation Hardware and Software…………………………….257 Genomic DNA……………………………………………………………………………..281 Glo Lysis Buffer, 1X ………………………………………………………………………..80 GloMax® 20/20 Luminometer…………………………………………………………300 GloMax® Discover System ……………………………………………….296, 298, 310 GloMax® Explorer System………………………………………………..296, 298, 311 GloMax® Navigator System……………………………………………………..297, 299 GloResponse™ Luciferase Reporter Cell Lines……………………………….11, 92 GloSensor™ cAMP Assay ……………………………………………………………….40 Glu-C, Sequencing Grade ………………………………………………………………325 Glucose Uptake-Glo™ Assay……………………………………………………………57 Glucose-Glo™ Assay……………………………………………………………………..56 Glutamate-Glo™ Assay…………………………………………………………………..56 Glutamine/Glutamate-Glo™ Assay…………………………………………………….56 Glycerol, Molecular Biology Grade ……………………………………………………273 Glycine, Molecular Biology Grade …………………………………………………….273 Glycosidases ……………………………………………………………………….320, 326 Goat Anti-Human Biotinylated IgG …………………………………………….246, 364 GoScript™ Reverse Transcriptase……………………………………..171, 191, 315 GoScript™ Reverse Transcription Mix, Oligo(dT)……………………171, 191, 315 GoScript™ Reverse Transcription Mix, Random Primers…………171, 191, 315 GoScript™ Reverse Transcription System……………………………171, 191, 315 GoTaq® Amplification Family…………………………………………………………..186 GoTaq® G2 Hot Start Polymerase and Master Mixes…………………………….184 GoTaq® G2 Polymerase and Master Mixes…………………………………………185 GoTaq® Hot Start Polymerase …………………………………………………………184 GoTaq® Long PCR Master Mix…………………………………………………………185 GoTaq® MDx DNA Polymerases……………………………………………………….314 GoTaq® PCR Core System………………………………………………………………187 GoTaq® Reaction Buffers and Magnesium Chloride ……………………………..186 GoTaq® Real-Time qPCR and RT-qPCR Systems for Dye-Based Detection………………………………………………….170, 190, 210 GoTaq® Real-Time qPCR and RT-qPCR Systems for Probe-Based Detection……………………………………………….169, 190, 209 Griess Reagent System ……………………………………………………………..31, 60 GSH-Glo™ Glutathione Assay……………………………………………………..31, 58 GSH/GSSG-Glo™ Assay…………………………………………………………….30, 58 GTPase-Glo™ Assay ………………………………………………………………..39, 41 Guanidine Thiocyanate, Molecular Grade (Guanidinium Thiocyanate)……………………………………………………………..273 Guanidine-HCl, Molecular Biology Grade (Guanidinium Hydrochloride) …………………………………………………………..274 HaeIII…………………………………………………………………………………………108 HaloCHIP™ System………………………………………………………………182, 357 HaloLink™ Resin…………………………………………………………………………359 HaloTag® Fluorescent Ligands …………………………………………………..64, 345 HaloTag® Fusion (C-Terminal) Mammalian Expression Vectors……..65, 68, 347 HaloTag® Fusion (N-Terminal) Mammalian Expression Vectors……..65, 68, 347 HaloTag® Ligand Building Blocks………………………………………………..66, 346 HaloTag® Ligands for Super Resolution Microscopy……………………………..344 HaloTag® Mammalian Protein Purification System………………………..181, 365 HaloTag® Mammalian Pull-Down Systems………………………………….182, 359 HaloTag® Protein Purification System ………………………………………..181, 365 HaloTag® Standard Protein …………………………………………………………….366 HaloTag® Vectors for E. coli and Cell-Free Protein Expression…………………124 HaloTEV Protease………………………………………………………………….181, 365 HDAC-Glo™ Class IIa and HDAC-Glo™ 2 Assays……………………………….177 HDAC-Glo™ I/II Assays and Screening Systems …………………………………177 HeLaScribe® Nuclear Extract in vitro Transcription System…………………….166 HEPES, Molecular Biology Grade (free acid) ……………………………………….274 Herring Sperm DNA………………………………………………………………………281 HhaI………………………………………………………………………………………….108 HiBiT CMV-neo Flexi® Vectors…………………………………………………………341 HiBiT Control Protein ………………………………………………………………………74 High Capacity Magne® Streptavidin Beads………………………………….246, 364 HindIII………………………………………………………………………………………..108 HinfI………………………………………………………………………………………….108 HisLink™ Protein Purification Systems……………………………………………..368 Horseradish Peroxidase-Conjugated Antibodies…………………………………….71 HpaII …………………………………………………………………………………………109 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 375 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com Index: A–Z HQ and GST Tag Flexi® Vectors for E. coli and Cell-Free Protein Expression………………………………………………126, 219 HSM 2.0 Instrument……………………………………………………….136, 200, 294 I-PpoI (Intron-Encoded Endonuclease) ………………………………………………109 IdeS Protease and IdeZ Protease……………………………………….180, 244, 328 IL-2 Bioassay………………………………………………………………………………232 IL-15 Bioassay…………………………………………………………………………….232 Immobilized Trypsin………………………………………………………………………325 ImProm-II™ Reverse Transcription System………………………………………..192 In Vitro Transcription Systems Related Products ………………………………….166 In Vitro Translation Specialty Vectors…………………………………………………222 InCELLect™ AKAP St-Ht31 Inhibitor Peptide ……………………………………….49 InCELLect™ St-Ht31P Control Peptide……………………………………………….49 Internal Lane Standard 600 ……………………………………….. 34, 262, 265, 317 Intracellular TE Nano-Glo® Substrate/Inhibitor …………………………………….176 IPTG, Dioxane-Free ………………………………………………………………………274 ISOQUANT® Isoaspartate Detection Kit ………………………………………245, 352 K562 DNA High Molecular Weight……………………………………………………282 Kemptide (PKA) Peptide Substrate……………………………………………………..49 Kinase Enzyme Systems………………………………………………………………….44 Kinase Selectivity Profiling Systems……………………………………………………45 Kinase-Glo® Luminescent Kinase Assays…………………………………………….47 KpnI ………………………………………………………………………………………….109 Lactate-Glo™ Assay………………………………………………………………………56 LAG-3/MHCII Blockade Bioassay……………………………………………………..237 Lambda DNA ………………………………………………………………………………281 LDH-Glo™ Cytotoxicity Assay…………………………………………………………..25 LigaFast™ Rapid DNA Ligation System…………………………………………….118 Lipid Kinase Assays and Reagents …………………………………………………….46 L-Rhamnose Monohydrate……………………………………………………………..330 Luciferase Assay System…………………………………………………………………80 Luciferase Control RNA …………………………………………………………………336 Luciferase SP6/T7 Control DNAs……………………………………………………..336 Luciferin Detection Reagent……………………………………………………………..10 Luciferin-EF™ Endotoxin-Free Luciferin Na………………………………….81, 274 LY 294002 …………………………………………………………………………………..49 Lys-C, Mass Spec Grade, and Lys-N, Mass Spec Grade…………………242, 322 Lysis Solution………………………………………………………………………………..26 M-MLV Reverse Transcriptase………………………………………………….170, 193 M-MLV Reverse Transcriptase, RNase H Minus ……………………………171, 194 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant………….171, 194 MagaZorb® DNA Mini-Prep Kit…………………………………………………141, 201 MagnaBot® 384 Magnetic Separation Device …………………………………….284 MagnaBot® FLEX 96 Magnetic Separation Device ……………………………….285 Magne™ HaloTag® Beads………………………………………………………358, 366 Magne™ Protein G and Magne™ Protein A Beads……………….243, 246, 364 MagneGST™ Protein Purification System………………………………………….368 MagneGST™ Pull-Down System ………………………………………182, 358, 367 MagneHis™ Protein Purification System……………………………………368, 369 MagneSil® Blood Genomic, Max Yield System…………………………………….139 MagneSil® Genomic, Large Volume System ……………………………………….140 MagneSil® KF, Genomic System………………………………………………………141 MagneSil® ONE, Fixed Yield Blood Genomic System…………………………….139 MagneSil® Total RNA mini-Isolation System ……………………………………….151 MagneSphere® Technology Magnetic Separation Stands………………………152 Magnetic Stands and Spacers…………………………………………………………284 MagZ™ Protein Purification System ………………………………………………..367 MAO-Glo™ Assay Systems……………………………………………………………..10 Mass Spec-Compatible Yeast and Human Protein Extracts…………………….321 Maxprep™ Liquid Handler Qualification Products……………………………….290 Maxprep™ Liquid Handler with the Maxwell® RSC 48 Instrument…………..288 Maxwell® 16 Flexi Method Firmware …………………………………………142, 153 Maxwell® 16 System DNA Purification Kits ………………………………………..142 Maxwell® 16 System RNA Purification Kits…………………………………………153 Maxwell® 16 Viral Total Nucleic Acid Purification System ………………………154 Maxwell® CSC Blood DNA Kit………………………………………………………….303 Maxwell® CSC DNA FFPE Kit…………………………………………………………..303 Maxwell® CSC Instrument……………………………………………………….290, 302 Maxwell® CSC RNA Blood Kit………………………………………………………….303 Maxwell® CSC RNA FFPE Kit…………………………………………………………..303 Maxwell® CSC Service and Support Products………………………………291, 302 Maxwell® FSC DNA IQ™ Casework Kit………………………………………134, 257 Maxwell® FSC Instrument……………………………………………………….257, 292 Maxwell® HT 96 gDNA Blood Isolation System…………………………….137, 201 Maxwell® HT DNA FFPE Isolation System……………………………………134, 200 Maxwell® RSC 48 Instrument………………………………………………………….288 Maxwell® RSC 48 Qualification Products…………………………………………..289 Maxwell® RSC FFPE Plus DNA Kit ……………………………………………………135 Maxwell® RSC Instrument………………………………………… 143, 203, 292, 304 Maxwell® RSC miRNA Plasma and Serum Kit………………………………153, 305 Maxwell® RSC PureFood Pathogen Kit…………………………………………..2, 135 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 376 For complete and up-to-date product information visit: www.promega.com Index: A–Z Maxwell® RSC Service and Support Products……………………………………..293 Maxwell® RSC System DNA Purification Kits……………………………….143, 203 Maxwell® RSC System RNA Purification Kits ………………………………………153 MboI …………………………………………………………………………………………109 MEK Inhibitor U0126………………………………………………………………………49 MethylEdge™ Bisulfite Conversion System………………………………………..174 Microsatellite Instability (MSI) Analysis………………………………………………317 Mitochondrial Toxicity Assay………………………………………………………..29, 60 MluI ………………………………………………………………………………………….110 Molecular Biology Lab Guide…………………………………………………………..134 Monster Green® Fluorescent Protein phMGFP Vector……………………………..94 MOPS/EDTA Buffer……………………………………………………………………….191 Mouse ADCC Bioassay Effector Cells, Propagation Model ……………………..234 Mouse ADCC Reporter Bioassays…………………………………………………….234 MspI …………………………………………………………………………………………110 MTase-Glo™ Methyltransferase Assay……………………………………………..175 MULTI-CORE™ Buffer Pack……………………………………………………………114 MultiTox-Fluor Multiplex Cytotoxicity Assay ………………………………………….26 MultiTox-Glo Multiplex Cytotoxicity Assay……………………………………..25, 179 Mung Bean Nuclease ……………………………………………………………………120 NAD/NADH-Glo™ Assay…………………………………………………………………61 NAD(P)H-Glo™ Detection System……………………………………………………..62 NADP/NADPH-Glo™ Assay……………………………………………………………..62 NanoBiT® PPI Starter Systems………………………………………………………..354 NanoBRET™ Bromodomain/Histone Interaction Assays………………………..355 NanoBRET™ Nano-Glo® Detection System …………………………355, 356, 357 NanoBRET™ PPI Starter Systems……………………………………………………356 NanoBRET™ Signaling Protein Assays……………………………………………..356 NanoBRET™ Target Engagement BET BRD Assays……………………………..176 NanoBRET™ Target Engagement HDAC Assays………………………………….176 NanoBRET™ TE Intracellular Kinase Assay………………………………………….42 NanoBRET™ Tracer K-4-Compatible Kinase-NanoLuc® Fusion Vectors……..42 NanoBRET™ Tracer K-5-Compatible Kinase-NanoLuc® Fusion Vectors……..43 NanoBRET™ Transcriptional Protein Assays………………………………………355 Nano-Glo® Dual-Luciferase® Reporter Assay System……………………………..76 Nano-Glo® Endurazine™ and Vivazine™ Live Cell Substrates…………………75 Nano-Glo® HiBiT Blotting System …………………………………………………….340 Nano-Glo® HiBiT Extracellular Detection System………………………………….340 Nano-Glo® HiBiT Lytic Detection System……………………………………………340 Nano-Glo® In-Gel Detection System …………………………………………………..74 Nano-Glo® Live Cell Assay System……………………………………………..74, 354 Nano-Glo® Luciferase Assay System ………………………………………………….75 NanoLuc® Genetic Reporter Vectors……………………………………………84, 224 NanoLuc® Protein Fusion Vectors……………………………………………….85, 225 NanoLuc® Stability Sensors for Cell Signaling ……………………………….85, 225 NcoI ………………………………………………………………………………………….110 NdeI………………………………………………………………………………………….110 Nerve Growth Factor, 2.5S, Murine…………………………………………………….53 NheI………………………………………………………………………………………….111 Non-Radioactive Phosphatase Assay Systems………………………………………52 NotI…………………………………………………………………………………………..111 Nuclear Receptor Analysis Luciferase Vectors …………………………………54, 89 Nuclease-Free Water…………….119, 134, 136, 148, 151, 165, 200, 256, 275 Oligonucleotides and Primers: cDNA Synthesis and Cloning…………………..196 ONE-Glo™ EX Luciferase Assay System……………………………………………..78 ONE-Glo™ Luciferase Assay System …………………………………………………78 ONE-Glo™ + Tox Luciferase Reporter and Cell Viability Assay …………………79 Optical Plate Seals………………………………………………………………..253, 266 P450-Glo™ CYP450 Screening Systems……………………………………………..9 pAdVAntage™ Vector …………………………………………………………………..220 pALTER®-MAX Vector…………………………………………………………….126, 217 pBiT3.1 HiBiT MCS Vectors…………………………………………………………….341 pBR322 Vector …………………………………………………………………….212, 281 pCI Mammalian Expression Vector……………………………………………………221 pCI-neo Mammalian Expression Vector……………………………………………..221 pCMVTnT™ and pTnT™ Vectors…………………………………………………….334 PCR Master Mix…………………………………………………………………………..187 PCR Nucleotide Mix……………………………………………………………….188, 315 PCR Optimization Kit …………………………………………………………………….314 PD-1/PD-L1 Blockade Bioassays…………………………………………………….240 PD-1 + TIGIT Combination Bioassay…………………………………………………238 PDE-Glo™ Phosphodiesterase Assay…………………………………………………41 PEG 8000, Molecular Biology Grade (Polyethylene Glycol 8000)……………..275 Pepsin……………………………………………………………………………………….325 PepTag® Non-Radioactive cAMP-Dependent Protein Kinase Assay……………49 Pfu DNA Polymerase …………………………………………………………………….187 pGEM®-11Zf(+) Vector………………………………………………………………….130 pGEM®-3Z Vector ………………………………………………………………………..127 pGEM®-3Zf(+/–) Vectors……………………………………………………………….127 pGEM®-4Z Vector ………………………………………………………………………..128 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 377 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com Index: A–Z pGEM®-5Zf(+) Vector…………………………………………………………….128, 197 pGEM®-7Zf(+/–) Vectors……………………………………………………………….129 pGEM®-9Zf(–) Vector ……………………………………………………………………129 pGEM® β-Gal Control DNA …………………………………………………………….338 pGEM® Express Positive Control Template …………………………………………165 pGEM®-luc DNA…………………………………………………………………………….92 pGEM®-T Easy Vector Systems……………………………………………………….197 pGEM®-T Vector Systems………………………………………………………………197 pGL2 Luciferase Reporter Vectors……………………………………………………..91 pGL3 Luciferase Reporter Vectors……………………………………………………..91 pGL4 in vivo Imaging Vectors……………………………………………………………68 Pgp-Glo™ Assay Systems……………………………………………………………….10 pHAb Reactive Dyes……………………………………………………………………..244 ΦX174 DNA/HinfI Dephosphorylated Markers…………………………………….102 ΦX174, RF DNA ………………………………………………………………………….282 PinPoint™ Xa Protein Purification System………………………………….217, 369 Plates………………………………………………………………………………………..283 Plexor® HY System………………………………………………………………..163, 258 PMA……………………………………………………………………………………………49 pmirGLO Dual-Luciferase miRNA Target Expression Vector ……………………..90 PNGase F …………………………………………………………………….245, 320, 326 PolyATtract® mRNA Isolation Systems ………………………………………………152 PolyATtract® System 1000 ……………………………………………………..152, 284 PowerPlex® 16 HS System …………………………………………………………….262 PowerPlex® 18D System ……………………………………………………………….261 PowerPlex® 21 System………………………………………………………………….261 PowerPlex® 4-Dye Matrix Standards ………………………………………………..263 PowerPlex® 5C Matrix Standards…………………………………………………….263 PowerPlex® CS7 System ……………………………………………………………….262 PowerPlex® ESX and ESI Fast Systems……………………………………………..259 PowerPlex® Fusion 6C System…………………………………………………259, 312 PowerPlex® Fusion System……………………………………………………..260, 313 PowerPlex® Y23 System…………………………………………………………260, 313 PowerQuant™ System………………………………………………………………….258 PowerSeq™ CRM Nested System, Custom ……………………………………….266 PowerSeq™ Quant MS System………………………………………………………266 Prime-a-Gene® Labeling System……………………………………………………..119 Primer Extension System—AMV Reverse Transcriptase………………………..167 pRL Renilla Luciferase Control Reporter Vectors……………………………………90 ProFection® Mammalian Transfection System ………………………………………96 Promega Barrier Tips…………………………………………………………………….284 ProMega-Markers® Lambda Ladders……………………………………………….102 Promoter-Driven Control Firefly and NanoLuc® Luciferase Vectors……………………………………………………..86 Promoter-Driven Control Firefly and Renilla Luciferase Vectors ………………………………………………………….87 Promoterless Firefly Luciferase Vectors……………………………………………….87 Promoterless Renilla Luciferase Vectors………………………………………………88 ProNex® DNA QC Assay…………………………………………………………………206 ProNex® NGS Library Quant Kit……………………………………………………….206 ProNex® Size-Selective Purification System ……………………………………….208 Protease Inhibitor Cocktail ……………………………………………….275, 338, 361 ProteaseMAX™ Surfactant, Trypsin Enhancer…………………………………….327 Proteasome-Glo™ Assays……………………………………………………………..342 Proteinase K (Lyophilized) ……………………………………………………….276, 328 Proteinase K (PK) Solution ……………………………………………………………..276 ProTEV Plus………………………………………………………………………………..327 pSI Mammalian Expression Vector……………………………………………………220 psiCHECK™-2 Vector …………………………………………………………………..169 pSP-luc+NF Fusion Vector……………………………………………………………….93 pSP64 Poly(A) Vector…………………………………………………………………….130 pSP72 Vector………………………………………………………………………………131 pSP73 Vector………………………………………………………………………………131 PstI …………………………………………………………………………………………..111 pSV-β-Galactosidase Control Vector…………………………………………………..94 pTargeT™ Mammalian Expression Vector System ……………………………….198 pTargeT™ Sequencing Primer ………………………………………………………..198 pUC/M13 Sequencing Primers………………………………………………………..214 PureYield™ Plasmid Maxiprep System……………………………………………..145 PureYield™ Plasmid Midiprep System ……………………………………………..145 PureYield™ Plasmid Miniprep System ……………………………………………..144 PureYield™ RNA Midiprep System…………………………………………………..150 PvuI ………………………………………………………………………………………….111 QuantiFluor® dsDNA System……………………………………………………160, 309 QuantiFluor® ONE dsDNA System …………………………………………….160, 309 QuantiFluor® RNA System……………………………………………………….161, 310 QuantiFluor® ssDNA System…………………………………………………………..161 QuantiLum® Recombinant Luciferase …………………………………………………83 Quantus™ Fluorometer ………………………………………………….162, 297, 308 Quantus™ NGS Starter Package ………………………………………162, 298, 308 Rabbit Reticulocyte Lysate System, Nuclease Treated …………………………..334 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 378 For complete and up-to-date product information visit: www.promega.com Index: A–Z Rabbit Reticulocyte Lysate, Untreated……………………………………………….336 Rabbit Reticulocyte Lysate/Wheat Germ Extract Combination System …………………………………………………………………….335 Rapid Digestion–Trypsin ………………………………………………………………..322 Rapid Digestion–Trypsin/Lys-C………………………………………………………..322 rAsp-N, Mass Spec Grade ………………………………………………………242, 322 ReadyAmp™ Genomic DNA Purification System………………………….140, 204 RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay……………………….13 RealTime-Glo™ MT Cell Viability Assay……………………………………….19, 178 Regulated Mammalian Expression System………………………………….218, 330 ReliaPrep™ Blood gDNA Miniprep System…………………………………136, 204 ReliaPrep™ DNA Clean-Up and Concentration System…………………………156 ReliaPrep™ FFPE gDNA Miniprep System…………………………..137, 204, 306 ReliaPrep™ FFPE Total RNA Miniprep System …………………………….149, 307 ReliaPrep™ gDNA Tissue Miniprep System…………………………136, 201, 306 ReliaPrep™ Large Volume HT gDNA Isolation System…………………..136, 200 ReliaPrep™ miRNA Cell and Tissue Miniprep System…………….149, 154, 307 ReliaPrep™ RNA Clean-Up and Concentration System…………………………155 ReliaPrep™ RNA Miniprep Systems………………………………………….150, 307 Renilla-Glo® Luciferase Assay System………………………………………………..81 Renilla Luciferase Assay System ……………………………………………………….81 Reporter Vector Sequencing Primers………………………………………………….93 Reverse Transcription System ………………………………………………….172, 192 rhFGF, Basic …………………………………………………………………………………53 rhTNF-α ………………………………………………………………………………………53 Ribo m7 G Cap Analog ……………………………………………………………………165 RiboMAX™ Large Scale RNA Production Systems………………………………164 Ribonuclease H……………………………………………………………………………120 Ribonucleotide Triphosphates (rNTPs)……………………………………………….195 Riboprobe® Combination Systems……………………………………………………165 Riboprobe® System Components and Buffers …………………………………….165 Riboprobe® Systems…………………………………………………………………….164 rLys-C, Mass Spec Grade ………………………………………………………………324 RNA Markers……………………………………………………………………….103, 163 RNA Polymerase Promoter Sequencing Primer……………………………………117 RNAgents® Denaturing Solution ………………………………………………………151 RNase A Solution ……………………………………………. 136, 137, 200, 201, 205 RNase ONE™ Ribonuclease…………………………………………………………..120 RNasin® Ribonuclease Inhibitors………………………………………………122, 167 ROS-Glo™ H2 O2 Assay………………………………………………………………30, 57 RQ1 RNase-Free DNase …………………………………………………………121, 165 RsaI ………………………………………………………………………………………….112 S1 Nuclease ……………………………………………………………………………….121 S30 T7 High-Yield Protein Expression System…………………………………….337 SacI ………………………………………………………………………………………….112 SacII………………………………………………………………………………………….112 SalI …………………………………………………………………………………………..112 ScaI ………………………………………………………………………………………….112 SDS Solution, Molecular Biology Grade (10% w/v)……………………………….276 Sephacryl® S-400…………………………………………………………………196, 277 Septa Mat, 96-Well……………………………………………………………….253, 266 Sequencing Grade Modified Trypsin………………………………………………….323 Sequencing Grade Modified Trypsin, Frozen……………………………………….323 SgfI…………………………………………………………………………………………..113 Signaling Pathway Analysis (Minimal Promoter-Driven) Firefly Luciferase Vectors………………………………………………. 12, 59, 88, 226 SignaTECT® Protein Kinase Assay Systems………………………………………….48 Single Step (KRX) Competent Cells……………………………………………132, 330 Single-Stranded DNA Binding Protein……………………………………………….121 SIRT-Glo™ Assays and Screening Systems……………………………………….178 Slicprep™ 96 Device……………………………………………………………………254 SmaI …………………………………………………………………………………………113 Sodium Chloride, Molecular Biology Grade…………………………………………277 Sodium Dodecyl Sulfate, Molecular Biology Grade (SDS)……………………….277 SoftLink™ Soft Release Avidin Resin ……………………………………………….370 SP6 RNA Polymerase ……………………………………………………………………116 SpeI ………………………………………………………………………………………….113 SphI ………………………………………………………………………………………….113 SSC Buffer, 20X, Molecular Grade……………………………………………………277 Steady-Glo® Luciferase Assay System………………………………………………..79 Streptavidin …………………………………………………………………………277, 367 Streptavidin Alkaline Phosphatase…………………………………………….278, 367 Streptavidin MagneSphere® Paramagnetic Particles…………………………….152 Strip Cap, 8-Well ………………………………………………………………….253, 266 Subcloning Tools Bundle………………………………………………………………..123 Succinate-Glo™ JmjC Demethylase/Hydroxylase Assay……………………….174 SV 96 Total RNA Isolation System…………………………………………………….151 SV Total RNA Isolation System…………………………………………………………150 SwabSolution™ Kit, PunchSolution™ Kit and 5X AmpSolution™ Reagent ……………………………………………………..252 T3 RNA Polymerase ……………………………………………………………………..117 T4 DNA Ligase…………………………………………………………………………….118 T4 DNA Polymerase ……………………………………………………………………..116 T4 Polynucleotide Kinase……………………………………………………………….119 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 379 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com Index: A–Z T4 RNA Ligase…………………………………………………………………………….118 T7 RiboMAX™ Express Large Scale RNA Production System…………………164 T7 RiboMAX™ Express RNAi System……………………………………………….168 T7 RNA Polymerase ……………………………………………………………………..117 T7 Sample System……………………………………………………………………….335 T Cell Activation Bioassays……………………………………………………………..241 TAE Buffer, Molecular Biology Grade (Tris-acetate-EDTA) ………………………278 TaqI…………………………………………………………………………………………..113 TBE Buffer, 10X, Molecular Biology Grade………………………………………….278 TE Buffer, 1X, Molecular Biology Grade……………………………………………..278 Terminal Deoxynucleotidyl Transferase, Recombinant……………………………121 Thermolysin………………………………………………………………………………..325 TIGIT/CD155 Blockade Bioassay……………………………………………………..239 TMB One Solution ………………………………………………………………………….72 TMB Stabilized Substrate for Horseradish Peroxidase …………………………..279 TnT® Coupled Reticulocyte Lysate Systems………………………………………..332 TnT® Coupled Wheat Germ Extract System………………………………………..333 TnT® Quick Coupled Transcription/Translation System ………………………….332 TnT® SP6 High-Yield Wheat Germ Protein Expression System………………..331 TnT® Starter Bundle ……………………………………………………………………..333 TnT® T7 Insect Cell Extract Protein Expression System …………………………331 TnT® T7 Quick for PCR DNA……………………………………………………………334 Transcend™ Non-Radioactive Translation Detection Systems………………..349 Transcription Factor Consensus Oligonucleotides………………………………..166 TransFast™ Transfection Reagent……………………………………………………..96 Tris Base, Molecular Biology Grade…………………………………………………..279 Tris-HCl, Molecular Biology Grade (Tris-Hydrochloride)………………………….279 Triton® X-100, Molecular Biology Grade…………………………………………….279 Trypsin Gold, Mass Spectrometry Grade ……………………………………………326 Trypsin/Lys-C Mix, Mass Spec Grade………………………………………………..324 Tryptase, Human, Recombinant, β……………………………………………………344 TSAP Thermosensitive Alkaline Phosphatase………………………………………115 Tween® 20, Molecular Biology Grade………………………………………………..280 UDP-Glo™ Glycosyltransferase Assay………………………………………………..50 Ultra Pure GDP-Sugar Substrates………………………………………………………38 UMP/CMP-Glo™ Glycosyltransferase Assay………………………………………..38 Universal RiboClone® cDNA Synthesis System ……………………………………196 Unmethylated Lambda DNA……………………………………………………………281 Untagged Flexi® Mammalian Expression Vectors…………………………………124 Urea………………………………………………………………………………………….280 Vac-Man® 96 Vacuum Manifold ………………………………………………………285 Vac-Man® Jr. Laboratory Vacuum Manifold………………………………………..285 Vac-Man® Laboratory Vacuum Manifold ……………………………………………285 VEGF Bioassays…………………………………………………………………………..233 VersaPlex™ 27PY System……………………………………………………………..265 ViaFect™ Transfection Reagent………………………………………………………..95 Viral ToxGlo™ Assay………………………………………………………………………24 ViviRen™ In Vivo Renilla Luciferase Substrate ……………………………………..67 ViviRen™ Live Cell Substrate …………………………………………………………..82 VivoGlo™ Caspase 3/7 Substrate (Z-DEVD-Aminoluciferin Sodium Salt) …………………………………………………66 VivoGlo™ Luciferin-β-Galactosidase Substrate (6-O-β-galactopyranosyl luciferin)……………………………………………………..67 VivoGlo™ Luciferin, In Vivo Grade……………………………………………………..67 Water-Glo™ Microbial Water Testing Kit……………………………………………….4 WEN Internal Lane Standard 500 ESS ………………………………………………264 WEN Internal Lane Standard 500 Y23 ………………………………………………264 Western Blue® Stabilized Substrate for Alkaline Phosphatase ……………………………………………………………….280 Wheat Germ Extract ……………………………………………………………………..335 Wizard® DNA Clean-Up System……………………………………………………….157 Wizard® Genomic DNA Purification Kit………………………………………………137 Wizard® MagneSil® Plasmid Purification System…………………………………148 Wizard® MagneSil® Sequencing Reaction Clean-Up System…………………..158 Wizard MagneSil Tfx™ System……………………………………………………….149 Wizard® Magnetic 96 DNA Plant System……………………………………142, 202 Wizard® Magnetic DNA Purification System for Food …………………2, 142, 202 Wizard® PCR Preps DNA Purification System……………………………………..157 Wizard® Plus Maxipreps DNA Purification System ……………………………….147 Wizard® Plus Megapreps DNA Purification System………………………………147 Wizard® Plus Midipreps DNA Purification System………………………………..146 Wizard® Plus Minipreps DNA Purification Systems ………………………………146 Wizard® Plus SV Minipreps DNA Purification Systems…………………………..144 Wizard® SV 96 and SV 9600 Plasmid DNA Purification Systems…………….148 Wizard® SV 96 Genomic DNA Purification System………………………..138, 205 Wizard® SV 96 PCR Clean-Up System………………………………………………158 Wizard® SV Gel and PCR Clean-Up System…………………………………155, 208 Wizard® SV Genomic DNA Purification System…………………………….138, 205 X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) …………………..280 x-tracta™ Gel Extractor ………………………………………………………………..156 XbaI ………………………………………………………………………………………….114 XhoI ………………………………………………………………………………………….114 Y Chromosome Deletion Detection System, Version 2.0………………………..318 Y Chromosome AZF Analysis System………………………………………………..318 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 380 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number 24 Cat# Product Size Page A1071 Eluator™ Vacuum Elution Device 4 each 145, 150, 285 A1120 Wizard® Genomic DNA Purification Kit 100 isolations × 300 μl 137 A1125 Wizard® Genomic DNA Purification Kit 500 isolations × 300 μl 137 A1222 PureYield™ Plasmid Miniprep System 250 preps 144 A1223 PureYield™ Plasmid Miniprep System 100 preps 144 A1250 Access RT-PCR System 100 reactions 193 A1260 Access RT-PCR Introductory System 20 reactions 193 A1280 Access RT-PCR System 500 reactions 193 A1311 Column Wash Solution (CWA) 185 ml 138, 144, 148, 205 A1318 Column Wash Solution (CWA) 370 ml 148 A1330 Wizard® Plus SV Minipreps DNA Purification System 50 preps 144 A1331 Vacuum Adapters 20 each 144, 155, 208, 285 A1340 Wizard® Plus SV Minipreps DNA Purification System + Vacuum Adapters 50 preps 144 A1360 pGEM®-T Easy Vector System I 20 reactions 197 A1380 pGEM®-T Easy Vector System II 20 reactions 197 A1410 pTargeT™ Mammalian Expression Vector System 20 reactions 198 A1441 Alkaline Protease Solution 3 ml 144, 148 A1460 Wizard® Plus SV Minipreps DNA Purification System 250 preps 144 A1465 Wizard® Plus SV Minipreps DNA Purification System 1,000 preps 144 A1470 Wizard® Plus SV Minipreps DNA Purification System + Vacuum Adapters 250 preps 144 A1481 Wizard® SV 96 Neutralization Solution 500 ml 148 A1485 Neutralization Solution (NSB) 500 ml 145 A1488 Wizard® SV 96 Neutralization Solution 950 ml 148 A1491 Promega 10 Barrier Tips, 960/pk 0.5–10 μl 284 A1501 Promega 10E Barrier Tips, 960/pk 0.5–10 μl 284 A1511 Promega 10F Barrier Tips, 960/pk 0.5–10 μl 284 A1521 Promega 20 Barrier Tips, 960/pk 2–20 μl 284 A1541 Promega 100 Barrier Tips, 960/pk 10–100 μl 284 A1551 Promega 200 Barrier Tips, 960/pk 50–200 μl 284 A1563 Promega 1000 Barrier Tips, 768/pk 100–1,000 μl 284 A1620 Wizard® Genomic DNA Purification Kit 100 isolations × 10 ml 137 A1630 Wizard® MagneSil® Plasmid Purification System 4 × 96 preps 148 A1631 Wizard® MagneSil® Plasmid Purification System 8 × 96 preps 148 A1635 Wizard® MagneSil® Plasmid Purification System, HTP1 100 × 96 preps 148 A1641 MagneSil® RED 100 ml 148 A1655 Elution Buffer 500 ml 148 A1701 AccessQuick™ RT-PCR System 20 reactions 192 A1702 AccessQuick™ RT-PCR System 100 reactions 192 A1703 AccessQuick™ RT-PCR System 500 reactions 192 A1721 Alkaline Protease (APA) 130 ml 136, 200 A1731 Cell Lysis Buffer (CLD) 1,400 ml 136, 200 A1741 Binding Buffer (BBA) 1,600 ml 136, 200 A1752 ReliaPrep™ Resin 115 ml 136, 200 A1831 Wizard® MagneSil® Sequencing Reaction Clean-Up System 4 × 96 preps 158 A1832 Wizard® MagneSil® Sequencing Reaction Clean-Up System 8 × 96 preps 158 A1835 Wizard® MagneSil® Sequencing Reaction Clean-Up System, HTP1 100 × 96 preps 158 A2051 ReliaPrep™ gDNA Tissue Miniprep System 100 preps 136, 201, 306 A2052 ReliaPrep™ gDNA Tissue Miniprep System 250 preps 136, 201, 306 Cat# Product Size Page A2121 x-tracta™ Gel Extractor 25 /pack 156, 285 A2122 x-tracta™ Gel Extractor 100 /pack 156, 285 A2180 Wizard® PCR Preps DNA Purification System 250 preps 157 A2191 Endotoxin Removal Resin 100 ml 149 A2201 MagneSil® BLUE 100 ml 148 A2221 4/40 Wash Solution 115 ml 149 A2241 Wizard® SV 96 Lysate Clearing Plates 10 pack 148, 283 A2248 Wizard® SV 96 Lysate Clearing Plates 100 pack 148, 283 A2250 Wizard® SV 96 Plasmid DNA Purification System 1 × 96 preps 148, 283 A2255 Wizard® SV 96 Plasmid DNA Purification System 5 × 96 preps 148, 283 A2258 Wizard® SV 9600 Plasmid DNA Purification System 100 × 96 preps 148, 283 A2271 Wizard® SV 96 Binding Plates 10 pack 138, 148, 151, 158, 205, 283 A2278 Wizard® SV 96 Binding Plates 100 pack 148, 283 A2291 Vac-Man® 96 Vacuum Manifold 1 each 285 A2351 ReliaPrep™ FFPE gDNA Miniprep System 10 reactions 137, 204, 306 A2352 ReliaPrep™ FFPE gDNA Miniprep System 100 reactions 137, 204, 306 A2360 Wizard® SV Genomic DNA Purification System 50 preps 138, 205 A2361 Wizard® SV Genomic DNA Purification System 250 preps 138, 205 A2370 Wizard® SV 96 Genomic DNA Purification System 1 × 96 preps 138, 205 A2371 Wizard® SV 96 Genomic DNA Purification System 4 × 96 preps 138, 205 A2380 Wizard MagneSil Tfx™ System 4 × 96 preps 149 A2392 PureYield™ Plasmid Maxiprep System 10 preps 145 A2393 PureYield™ Plasmid Maxiprep System 25 preps 145 A2492 PureYield™ Plasmid Midiprep System 25 preps 145 A2495 PureYield™ Plasmid Midiprep System 100 preps 145 A2496 PureYield™ Plasmid Midiprep System 300 preps 145 A2631 10mM EDTA (pH 8.0) 10 ml 137, 201 A2641 25mM Tris-HCl (pH 8.0) 60 ml 137, 201 A2651 20X TE Buffer (pH 7.5) 25 ml 136, 137, 200, 201 A2661 Heat Block Adapter 1 each 137, 201 A2670 Maxwell® HT 96 gDNA Blood Isolation System 1 × 96 preps 137, 201 A2671 Maxwell® HT 96 gDNA Blood Isolation System 4 × 96 preps 137, 201 A2681 Prepared Wash Buffer (WBC) 3,500 ml 136, 200 A2691 Bottle for 50% Ethanol 1 each 136, 200 A2701 Integrated Reagent Caps 4 /pk 136, 200 A2712 HSM 2.0 Instrument Cover 1 each 136, 200, 294 A2713 HSM 2.0 Tube Rack 1 each 136, 200, 294 A2714 HSM 2.0 Tube Rack Stand 1 each 136, 200, 294 A2715 HSM 2.0 Instrument 1 each 136, 200, 294 A2751 ReliaPrep™ Large Volume HT gDNA Isolation System 1 each 136, 200, 294 A2790 GoScript™ Reverse Transcription Mix, Oligo(dT) 50 reactions 171, 191, 315 A2791 GoScript™ Reverse Transcription Mix, Oligo(dT) 100 reactions 171, 191, 315 A2800 GoScript™ Reverse Transcription Mix, Random Primers 50 reactions 171, 191, 315 A2801 GoScript™ Reverse Transcription Mix, Random Primers 100 reactions 171, 191, 315 A2891 ReliaPrep™ DNA Clean-Up and Concentration System 10 preps 156 A2892 ReliaPrep™ DNA Clean-Up and Concentration System 50 preps 156 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 381 Cat# Product Size Page A2893 ReliaPrep™ DNA Clean-Up and Concentration System 250 preps 156 A3500 Reverse Transcription System 100 reactions 172, 192 A3511 Magnesium Chloride Solution 1.5 ml 172, 186, 192, 314 A3513 Magnesium Chloride Solution 25 ml 186, 314 A3561 Reverse Transcription 10X Buffer 1.4 ml 172, 192 A3600 pGEM®-T Vector System I 20 reactions 197 A3610 pGEM®-T Vector System II 20 reactions 197 A3800 ImProm-II™ Reverse Transcription System 100 reactions 192 A3801 ImProm-II™ Reverse Transcriptase 10 reactions 192 A3802 ImProm-II™ Reverse Transcriptase 100 reactions 192 A3803 ImProm-II™ Reverse Transcriptase 500 reactions 192 A3811 Wash Buffer, Plant 40 ml 142, 202 A4082 MagneSil® Genomic, Large Volume System 48 preps 140 A4091 eLysis Buffer, Large Volume System 1 L 140 A5000 GoScript™ Reverse Transcription System 50 reactions 171, 191, 315 A5001 GoScript™ Reverse Transcription System 100 reactions 171, 191, 315 A5003 GoScript™ Reverse Transcriptase 100 reactions 171, 191, 315 A5004 GoScript™ Reverse Transcriptase 500 reactions 171, 191, 315 A5051 Proteinase K (PK) Solution 23 ml 136, 200 A5081 ReliaPrep™ Blood gDNA Miniprep System 100 preps 136, 204 A5082 ReliaPrep™ Blood gDNA Miniprep System 250 preps 136, 204 A5091 Tissue Lysis Buffer (TLA) 500 ml 136, 200 A6001 GoTaq® qPCR Master Mix 5 ml 170, 190, 210 A6002 GoTaq® qPCR Master Mix 25 ml 170, 190, 210 A6010 GoTaq® 2-Step RT-qPCR System 5 ml 170, 190, 210 A6020 GoTaq® 1-Step RT-qPCR System 5 ml 170, 190, 210 A6101 GoTaq® Probe qPCR Master Mix 2 ml 169, 190, 209 A6102 GoTaq® Probe qPCR Master Mix 10 ml 169, 190, 209 A6110 GoTaq® Probe 2-Step RT-qPCR System 2 ml 169, 190, 209 A6120 GoTaq® Probe 1-Step RT-qPCR System 2 ml 169, 190, 209 A6371 Buffer A (BWA) 125 ml 134, 200 A6372 Maxwell® HT DNA FFPE Isolation System 4 × 96 preps 134, 200 A7100 Wizard® Plus Minipreps DNA Purification System 50 preps 146 A7112 Cell Resuspension Solution (CRA) 150 ml 146, 147 A7113 Wizard® SV 96 Cell Resuspension Solution 500 ml 148 A7114 Cell Resuspension Solution 500 ml 148 A7115 Cell Resuspension Solution (CRA) 315 ml 145 A7118 Wizard® SV 96 Cell Resuspension Solution 800 ml 148 A7122 Cell Lysis Solution (CLA) 150 ml 146, 147 A7123 Wizard® SV 96 Cell Lysis Solution 500 ml 148 A7124 Cell Lysis Solution 500 ml 148 A7125 Cell Lysis Solution (CLA) 315 ml 145 A7128 Wizard® SV 96 Cell Lysis Solution 800 ml 148 A7131 Neutralization Solution (NSA) 150 ml 146, 147 A7132 Neutralization Solution 500 ml 148 A7141 Wizard® Minipreps DNA Purification Resin 250 ml 146 A7170 Wizard® PCR Preps DNA Purification System 50 preps 157 A7181 Wizard® PCR Preps DNA Purification Resin 250 ml 157 A7211 Wizard® Minicolumns 250 each 146, 157 A7231 Vac-Man® Laboratory Vacuum Manifold, 20-sample capacity 1 each 285 A7241 Direct Purification Buffer 25 ml 157 Cat# Product Size Page A7261 One-Way Luer-Lok® Stopcocks 10 each 285 A7270 Wizard® Plus Maxipreps DNA Purification System 10 preps 147 A7280 Wizard® DNA Clean-Up System 100 preps 157 A7300 Wizard® Plus Megapreps DNA Purification System 5 preps 147 A7401 Wizard® Maxipreps DNA Purification Resin 500 ml 147 A7421 Wizard® Maxi/Megapreps Filtering System 50 each 147 A7500 Wizard® Plus Minipreps DNA Purification System 100 preps 146 A7510 Wizard® Plus Minipreps DNA Purification System 250 preps 146 A7640 Wizard® Plus Midipreps DNA Purification System 25 preps 146 A7651 Wizard® Midicolumns 100 each 146 A7660 Vac-Man® Jr. Laboratory Vacuum Manifold, 2-sample capacity 1 each 146, 285 A7701 Wizard® Midipreps DNA Purification Resin 1,000 ml 146 A7710 ReadyAmp™ Genomic DNA Purification System 100 reactions 140, 204 A7933 Cell Lysis Solution (Genomic Purification) 1 liter 137 A7941 Nuclei Lysis Solution 50 ml 137, 138, 205 A7943 Nuclei Lysis Solution 1 liter 137 A7951 Protein Precipitation Solution 25 ml 137 A7953 Protein Precipitation Solution 350 ml 137 A7963 DNA Rehydration Solution 50 ml 137 A7973 RNase A Solution 1 ml 137, 138, 205, 276 A7974 RNase A Solution 5 ml 136, 137, 200, 201, 276 A8102 Column Wash Solution (CWB) 125 ml 146, 147 A8191 Lysis Buffer A, Food 100 ml 2, 142, 202 A8231 MagneSil® GREEN 100 ml 158 A8251 DNA IQ™ Resin 50 ml 255 A8261 Lysis Buffer 150 ml 255 A8271 2X Wash Buffer 70 ml 255 A8281 Elution Buffer 50 ml 255 A8501 Differex™ Digestion Buffer 150 ml 253 A8511 Differex™ Separation Solution 40 ml 253 A9161 Collection Plates (4-pack) 1 each 139, 148 A9281 Wizard® SV Gel and PCR Clean-Up System 50 preps 155, 208 A9282 Wizard® SV Gel and PCR Clean-Up System 250 preps 155, 208 A9283 Wizard® SV Gel and PCR Clean-Up System and x-tracta™ Gel Extractor Bundle 50 preps/25 extractors 155, 156, 208, 381 A9284 Wizard® SV Gel and PCR Clean-Up System and x-tracta™ Gel Extractor Bundle 250 preps/100 extractors 155, 156, 208, 285 A9285 Wizard® SV Gel and PCR Clean-Up System 1,000 preps 155, 208 A9301 Membrane Binding Solution 20 ml 155, 158, 208 A9340 Wizard® SV 96 PCR Clean-Up System 1 × 96 preps 158 A9341 Wizard® SV 96 PCR Clean-Up System 4 × 96 preps 158 A9342 Wizard® SV 96 PCR Clean-Up System 8 × 96 preps 158 A9345 Wizard® SV 96 PCR Clean-Up System 100 × 96 preps 158 AM1001 Water-Glo™ Complete Aqueous 1 each 4 AM1002 Water-Glo™ Reagents Aqueous 1 each 4 AM1003 Water-Glo™ 96 Reagents Aqueous 1 each 4 AM1004 Water-Glo™ Reagents Organic 1 each 4 AM1005 Water-Glo™ 96 Reagents Organic 1 each 4 AM1041 Water-Glo™ Organic Wash Solution 50ml 4 AS1010 Maxwell® 16 Blood DNA Purification Kit 48 preps 142 AS1015 Maxwell® 16 Blood DNA Purification System (IVD) 48 preps 142 AS1020 Maxwell® 16 Cell DNA Purification Kit 48 preps 142 AS1030 Maxwell® 16 Tissue DNA Purification Kit 48 preps 142 Index by Catalog Number Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 382 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page AS1040 DNA IQ™ Reference Sample Kit for Maxwell® 16 48 preps 255 AS1120 Maxwell® 16 Mouse Tail DNA Purification Kit 48 preps 142 AS1130 Maxwell® 16 FFPE Tissue LEV DNA Purification Kit 48 preps 142 AS1135 Maxwell® 16 FFPE Plus LEV DNA Purification Kit 48 preps 142 AS1140 Maxwell® 16 Cell LEV DNA Purification Kit 48 preps 142 AS1150 Maxwell® 16 Viral Total Nucleic Acid Purification Kit 48 preps 154 AS1155 Maxwell® 16 Viral Total Nucleic Acid Purification System (IVD) 48 preps 154 AS1220 Maxwell® 16 Tissue LEV Total RNA Purification Kit 48 preps 153 AS1225 Maxwell® 16 Cell LEV Total RNA Purification Kit 48 preps 153 AS1240 DNA IQ™ Casework Pro Kit for Maxwell® 16 48 preps 256 AS1260 Maxwell® 16 LEV RNA FFPE Kit 48 preps 153 AS1270 Maxwell® 16 LEV simplyRNA Cells Kit 48 preps 153 AS1280 Maxwell® 16 LEV simplyRNA Tissue Kit 48 preps 153 AS1290 Maxwell® 16 LEV Blood DNA Kit 48 preps 142 AS1295 Maxwell® 16 Buccal Swab LEV DNA Purification Kit 48 preps 142 AS1310 Maxwell® 16 LEV simplyRNA Blood Kit 48 preps 153 AS1321 Maxwell® CSC Blood DNA Kit 48 preps 303 AS1330 Maxwell® RSC Viral Total Nucleic Acid Purification Kit 48 preps 154 AS1331 RSC/CSC Plungers 50/pack 290, 302 AS1340 Maxwell® RSC simplyRNA Tissue Kit 48 preps 153 AS1350 Maxwell® CSC DNA FFPE Kit 48 preps 303 AS1360 Maxwell® CSC RNA FFPE Kit 48 preps 303 AS1370 Maxwell® RSC Cell DNA Purification Kit 48 preps 143, 203, 304 AS1380 Maxwell® RSC simplyRNA Blood Kit 48 preps 153 AS1390 Maxwell® RSC simplyRNA Cells Kit 48 preps 153, 305 AS1400 Maxwell® RSC Blood DNA Kit 48 preps 143, 203, 304 AS1410 Maxwell® CSC RNA Blood Kit 48 preps 303 AS1420 Maxwell® 16 LEV Plant DNA Kit 48 preps 4, 142, 306 AS1430 Maxwell® 16 LEV Plant RNA Kit 48 preps 4, 153 AS1440 Maxwell® RSC RNA FFPE Kit 48 preps 153, 305 AS1450 Maxwell® RSC DNA FFPE Kit 48 preps 143, 203, 304 AS1460 Maxwell® RSC miRNA Tissue Kit 48 preps 153, 305 AS1470 Maxwell® 16 miRNA Tissue Kit 48 preps 4, 153 AS1480 Maxwell® RSC ccfDNA Plasma Kit 48 preps 143, 203, 304 AS1490 Maxwell® RSC Plant DNA Kit 48 preps 2, 3, 143, 203 AS1500 Maxwell® RSC Plant RNA Kit 48 preps 3, 153 AS1520 Maxwell® RSC Whole Blood DNA Kit 48 preps 143, 203, 304 AS1540 Maxwell® RSC Buffy Coat DNA Kit 48 preps 143, 203, 304 AS1550 Maxwell® FSC DNA IQ™ Casework Kit 48 preps 134, 257 AS1600 Maxwell® RSC PureFood GMO and Authentication Kit 48 preps 2, 3, 143, 203, 304 AS1610 Maxwell® RSC Tissue DNA Kit 48 preps 143, 203, 304 AS1620 Maxwell® RSC Cultured Cells DNA Kit 48 preps 143, 203, 304 AS1630 Maxwell® RSC Stabilized Saliva DNA Kit 48 preps 143, 203, 304 AS1640 Maxwell® RSC Buccal Swab DNA Kit 48 preps 143, 203, 304 AS1651 LEV Plungers 50/pack 134, 256 AS1660 Maxwell® RSC PureFood Pathogen Kit 48 preps 2, 135 AS1670 RSC Plunger Pack 48/pack 288 AS1680 Maxwell® RSC miRNA Plasma and Serum Kit 48 preps 153, 305 AS1720 Maxwell® RSC FFPE Plus DNA Kit 48 preps 135 AS3200 Maxwell® Instrument Bar Code Reader 1 each 143, 203, 292, 304 Cat# Product Size Page AS4016 Maxwell® FSC Deck Tray 1 each 292 AS4500 Maxwell® RSC Instrument 1 each 2, 3, 143, 203, 292, 304 AS4600 Maxwell® FSC Instrument 1 each 257, 292 AS5101 SEV Elution Tubes 50 /pk 142, 153 AS5201 SEV Plungers 50 /pk 142, 153 AS6000 Maxwell® CSC Instrument 1 each 290, 302 AS6101 LEV Plungers 50 /pk 142, 153 AS6151 LEV Plungers 50 /pk 256 AS6201 LEV Elution Tubes 50 /pk 142, 153, 256 AS6411 Maxwell® 16 Flexi Method Firmware 1 each 142, 153 AS7151 FSC Plungers 50/pack 134, 256 AS7201 Elution Tubes, 0.5ml 50/pack 134, 256 AS8101 CW Spin Baskets 50/pack 135, 256 AS8201 CW Microfuge Tubes, 1.5ml 50/pack 135, 256 AS8500 Maxwell® RSC 48 Instrument 1 each 288 AS9100 Maxprep™ Liquid Handler, RSC Carriers 1 each 288 AS9101 Maxprep™ Liquid Handler, RSC Carriers w/UV Light 1 each 288 AS9200 Maxprep™ Liquid Handler, RSC 48 Carriers 1 each 288 AS9201 Maxprep™ Liquid Handler, RCS 48 Carriers w/UV Light 1 each 288 AS9307 Nunc 2.0ml Deep Well Plates 60/pack 288 AS9301 Maxprep™ 50µl Conductive Disposable Tips, Filtered 5,760 tips 288 AS9302 Maxprep™ 300µl Conductive Disposable Tips, Filtered 5,760 tips 288 AS9303 Maxprep™ 1000µl Conductive Disposable Tips, Filtered 3,840 tips 288 AS9304 Maxprep™ Reagent Reservoir, 50ml 28/pack 288 AS9305 Maxprep™ Waste Bags, Clear 100/pack 288 AS9310 Maxprep™ UV Lamp 1 each 288 AS9402 Maxprep™ Carrier, Maxwell RSC 1 each 288 AS9403 Maxprep™ Carrier, Maxwell RSC 48 Front 1 each 288 AS9404 Maxprep™ Carrier, Maxwell RSC 48 Back 1 each 288 AS9405 Maxprep™ Carrier, 12–13mm Sample Tubes 1 each 288 AS9406 Maxprep™ Carrier, 15–17mm Sample Tubes 1 each 288 AS9407 Maxprep™ Carrier, 10mm Sample Tubes 1 each 288 AS9408 Maxprep™ Plunger Holder 1 each 288 AS9409 Maxprep™ 3-Position Reagent Tube Holder 1 each 288 AS9410 Maxprep™ Gripper Paddle 1 each 288 AS9411 Maxprep™ Plunger Tool 1 each 288 AS9412 Maxprep™ Reagent Carrier 1 each 288 AX4560 Casework Direct Kit, Custom 1 each 252 AX5810 PowerSeq™ CRM Nested System, Custom 1 each 266 AX6780 Bone DNA Extraction Kit, Custom 100 preps 254 B1870 GenePrint® 24 System 100 reactions 35, 312 B1930 GenePrint® 5C Matrix Standard 5 preps 35, 312 B9510 GenePrint® 10 System 50 reactions 34 C1101 Oligo(dT)15 Primer 20 μg 196 C1141 PCR Nucleotide Mix 200 μl 188, 315 C1145 PCR Nucleotide Mix 1,000 μl 188, 315 C1181 Random Primers 20 μg 196 C1263 T4 DNA Ligase Buffer Pack 1.5 ml 118 C1281 Spin Columns 10 each 196 C1291 EcoRI Adaptors 150 pmol 196 C1313 T4 PNK Buffer Pack 1.5 ml 119 C1381 1.2kb Kanamycin Positive Control RNA 5 μg 196 C4360 Universal RiboClone® cDNA Synthesis System 1 system 196 C5411 CXR Reference Dye 100 μl 170, 210 C6711 2X Rapid Ligation Buffer 1.5 ml 118 C8021 psiCHECK™-2 Vector 20 μg 169 C8441 pF1A T7 Flexi® Vector 20 μg 124, 126, 219, 348 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 383 Index by Catalog Number Cat# Product Size Page C8451 pF1K T7 Flexi® Vector 20 μg 124, 126, 219, 348 C8461 pFN2A (GST) Flexi® Vector 20 μg 126, 219 C8471 pFN2K (GST) Flexi® Vector 20 μg 126, 219 C8481 pF4A CMV Flexi® Vector 20 μg 124 C8491 pF4K CMV Flexi® Vector 20 μg 124 C8511 pFN6A (HQ) Flexi® Vector 20 μg 126, 219 C8521 pFN6K (HQ) Flexi® Vector 20 μg 126, 219 C8531 pFC7A (HQ) Flexi® Vector 20 μg 126, 219 C8541 pFC7K (HQ) Flexi® Vector 20 μg 126, 219 C8640 Flexi® System, Entry/Transfer 5 entry and 20 transfer reactions 123, 341 C8820 Flexi® System, Transfer 100 transfer reactions 123 C9320 Carboxy Flexi® System, Transfer 50 transfer reactions 123 C9331 pFN10A (ACT) Flexi® Vector 20 μg 218, 360 C9341 pFN11A (BIND) Flexi® Vector 20 μg 218, 360 C9351 pGL4.31[luc2P/GAL4UAS/Hygro] Vector 20 μg 218, 360 C9360 CheckMate™/Flexi® Vector Mammalian TwoHybrid System 1 each 218, 360 C9361 pF9A CMV hRluc-neo Flexi® Vector 20 μg 124 C9370 CheckMate™ Positive Control Vectors 1 set 218, 360 C9380 CheckMate™ Negative Control Vectors 1 set 218, 360 C9401 pF5A CMV-neo Flexi® Vector 20 μg 124 C9411 pF5K CMV-neo Flexi® Vector 20 μg 124 C9421 pReg neo Vector 20 μg 218, 330 C9431 pF12A RM Flexi® Vector 20 μg 218, 330 C9441 pF12K RM Flexi® Vector 20 μg 218, 330 C9451 Coumermycin A1 5 mg 218, 330 C9461 Novobiocin Sodium Salt 1 g 218, 330 C9470 Regulated Mammalian Expression System 1 system 218, 330 CD4002 20-Position Microcentrifuge Tube Magnetic Separator 1.5 ml 141, 201 CE2696 Septa Mat, 96-Well 10 each 253, 266 D1501 Lambda DNA 250 μg 281 D1511 pBR322 Vector 10 μg 212, 281 D1521 Unmethylated Lambda DNA 250 μg 281 D1531 ΦX174, RF DNA 50 μg 282 D1811 Herring Sperm DNA 10 mg 281 D1815 Herring Sperm DNA 100 mg 281 D1816 Herring Sperm DNA 500 mg 281 D2301 5X PCR Buffer A 1 each 314 D2311 5X PCR Buffer B 1 each 314 D2321 5X PCR Buffer C 1 each 314 D2331 5X PCR Buffer D 1 each 314 D2341 5X PCR Buffer E 1 each 314 D2351 5X PCR Buffer F 1 each 314 D2361 5X PCR Buffer G 1 each 314 D2371 5X PCR Buffer H 1 each 314 D2381 PCR Optimization Kit 1 each 314 D4001 GoTaq® MDx DNA Polymerase 100 u 314 D4005 GoTaq® MDx DNA Polymerase 500 u 314 D4006 GoTaq® MDx DNA Polymerase 2,500 u 314 D4101 GoTaq® MDx DNA Polymerase, Glycerol-Free 500 u 314 D6001 GoTaq® MDx Hot Start Polymerase 100 u 314 D6005 GoTaq® MDx Hot Start Polymerase 500 u 314 D6006 GoTaq® MDx Hot Start Polymerase 2,500 u 314 D6008 GoTaq® MDx Hot Start Polymerase 10,000 u 314 D6101 GoTaq® MDx Hot Start Polymerase, High Concentration 1,000 u 314 D6201 GoTaq® MDx Hot Start Polymerase, Glycerol-Free 500 u 314 DC1000 Plexor® HY System 800 reactions 163, 258 DC1001 Plexor® HY System 200 reactions 163, 258 Cat# Product Size Page DC1500 Plexor® Calibration Kit, Set A 1 each 163, 258 DC1610 PowerPlex® ESX 16 Fast System 400 reactions 259 DC1611 PowerPlex® ESX 16 Fast System 100 reactions 259 DC1620 PowerPlex® ESI 16 Fast System 400 reactions 259 DC1621 PowerPlex® ESI 16 Fast System 100 reactions 259 DC1630 PowerPlex® ESX/ESI 16 Fast Systems Bundle 400 reactions 259 DC1631 PowerPlex® ESX/ESI 16 Fast Systems Bundle 100 reactions 259 DC1710 PowerPlex® ESX 17 Fast System 400 reactions 259 DC1711 PowerPlex® ESX 17 Fast System 100 reactions 259 DC1720 PowerPlex® ESI 17 Fast System 400 reactions 259 DC1721 PowerPlex® ESI 17 Fast System 100 reactions 259 DC1730 PowerPlex® ESX/ESI 17 Fast Systems Bundle 400 reactions each 259 DC1731 PowerPlex® ESX/ESI 17 Fast Systems Bundle 100 reactions each 259 DC1802 PowerPlex® 18D System 200 reactions 261 DC1808 PowerPlex® 18D System 800 reactions 261 DC2100 PowerPlex® 16 HS System 400 reactions 262 DC2101 PowerPlex® 16 HS System 100 reactions 262 DC2305 PowerPlex® Y23 System 50 reactions 260, 313 DC2320 PowerPlex® Y23 System 200 reactions 260, 313 DC2402 PowerPlex® Fusion System 200 reactions 260, 313 DC2408 PowerPlex® Fusion System 800 reactions 260, 313 DC2705 PowerPlex® Fusion 6C System 50 (or 100 direct-amp) reactions 259, 312 DC2720 PowerPlex® Fusion 6C System 200 (or 400 direct-amp) reactions 259, 312 DC6613 PowerPlex® CS7 System 100 reactions 262 DC6700 DNA IQ™ System 400 reactions 255 DC6701 DNA IQ™ System 100 reactions 255 DC6745 Casework Extraction Kit 100 reactions 255, 256 DC6800 Differex™ System 200 samples 253 DC6801 Differex™ System 50 samples 253 DC7020 VersaPlex™ 27PY System 200 reactions 265 DC8271 SwabSolution™ Kit 100 preps 252 DC8902 PowerPlex® 21 System 200 reactions 261 DC8942 PowerPlex® 21 System 4 × 200 reactions 261 DC9271 PunchSolution™ Kit 100 preps 252 DD2011 K562 DNA High Molecular Weight 30 μg 282 DD3021 PowerQuant™ Male gDNA Standard 150 μl 258 DD7101 2800M Control DNA 25 μl 34, 35, 259, 260, 261, 262, 265, 312, 313 DD7251 2800M Control DNA 500 μl 259, 260, 261, 262, 265, 313 DG1071 Internal Lane Standard 600 150 μl 34, 262, 265, 317 DG1820 STR Normalization Manager™ 3 CD-ROM 257 DG4640 PowerPlex® Matrix Standards, 310 50 μl 263 DG4800 PowerPlex® 4C Matrix Standard 5 preps 263 DG4850 PowerPlex® 5C Matrix Standard 5 preps 263 DG4900 PowerPlex® 6C Matrix Standard 5 preps 259, 312 DG4960 VersaPlex™ 6C Matrix Standard 5 preps 265 DG5001 WEN Internal Lane Standard 500 200 μl 35, 259, 312 DG5101 WEN Internal Lane Standard 500 ESS 200 µl 264 DG5201 WEN Internal Lane Standard 500 Y23 200 µl 264 DG5640 PowerPlex® 5C Matrix Standards, 310 50 µl 263 DM1231 5X AmpSolution™ Reagent 100 preps 252 DS1221 PowerQuant™ Calibration Kit 1 each 258 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 384 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page DW0991 Water, Amplification Grade 6,250 μl 34, 35, 163, 258, 259, 260, 261, 262, 312, 313 E1081 pSV-β-Galactosidase Control Vector 20 μg 94 E1171 pGloSensor™-20F cAMP Plasmid 20 μg 40 E1200 ProFection® Mammalian Transfection System—Calcium Phosphate 40 reactions 96 E1290 GloSensor™ cAMP Reagent 25 mg 40 E1291 GloSensor™ cAMP Reagent 250 mg 40 E1310 pGL4.50[luc2/CMV/Hygro] Vector 20 μg 68,86,87 E1320 pGL4.51[luc2/CMV/Neo] Vector 20 μg 68,86, 87 E1330 pmirGLO Dual-Luciferase miRNA Target Expression Vector 20 μg 90 E1340 pGL4.33[luc2P/SRE/Hygro] Vector 20 μg 12, 59, 88, 226 E1350 pGL4.34[luc2P/SRF-RE/Hygro] Vector 20 μg 12, 59, 88, 226 E1360 pGL4.36[luc2P/MMTV/Hygro] Vector 20 μg 54, 89 E1370 pGL4.35[luc2P/9XGAL4UAS/Hygro] Vector 20 μg 54, 89 E1380 pFN26A (BIND) hRluc-neo Flexi® Vector 20 μg 54, 89 E1390 pBIND-ERα Vector 20 μg 54, 89 E1483 Luciferase Assay Reagent 100 ml 80 E1500 Luciferase Assay System 100 assays 80 E1501 Luciferase Assay System, 10-Pack 1,000 assays 80 E1531 Luciferase Cell Culture Lysis 5X Reagent 30 ml 80 E1541 pGEM®-luc DNA 20 μg 92 E1581 pBIND-GR Vector 20 μg 54, 89 E1601 Beetle Luciferin, Potassium Salt 5 mg 81, 270 E1602 Beetle Luciferin, Potassium Salt 50 mg 81, 270 E1603 Beetle Luciferin, Potassium Salt 250 mg 81, 270 E1605 Beetle Luciferin, Potassium Salt 1 g 81, 270 E1611 pGL2-Control Vector 20 μg 91 E1621 pGL2-Enhancer Vector 20 μg 91 E1631 pGL2-Promoter Vector 20 μg 91 E1641 pGL2-Basic Vector 20 μg 91 E1701 QuantiLum® Recombinant Luciferase 1 mg 83 E1702 QuantiLum® Recombinant Luciferase 5 mg 83 E1711 pAdVAntage™ Vector 20 μg 220 E1721 pSI Mammalian Expression Vector 20 μg 220 E1731 pCI Mammalian Expression Vector 20 μg 221 E1741 pGL3-Control Vector 20 μg 91 E1751 pGL3-Basic Vector 20 μg 91 E1761 pGL3-Promoter Vector 20 μg 91 E1771 pGL3-Enhancer Vector 20 μg 91 E1841 pCI-neo Mammalian Expression Vector 20 μg 221 E1910 Dual-Luciferase® Reporter Assay System 100 assays 77 E1941 Passive Lysis 5X Buffer 30 ml 76, 77 E1960 Dual-Luciferase® Reporter Assay System 10-Pack 1,000 assays 77 E1980 Dual-Luciferase® Reporter 1000 Assay System 1,000 assays 77 E2000 β-Galactosidase Enzyme Assay System with Reporter Lysis Buffer 10 ml 83 E2231 pRL-SV40 Vector 20 μg 90 E2241 pRL-TK Vector 20 μg 90 E2261 pRL-CMV Vector 20 μg 90 E2271 pRL-null Vector 20 μg 90 E2301 pGloSensor™-22F cAMP Plasmid 20 μg 40 E2311 FuGENE® HD Transfection Reagent 1 ml 96 E2312 FuGENE® HD Transfection Reagent 5 × 1 ml 96 E2431 TransFast™ Transfection Reagent 1.2 mg 96 E2440 CheckMate™ Mammalian Two-Hybrid System 1 system 219, 360 E2510 Steady-Glo® Luciferase Assay System 10 ml 79 E2520 Steady-Glo® Luciferase Assay System 100 ml 79 Cat# Product Size Page E2550 Steady-Glo® Luciferase Assay System 10 × 100 ml 79 E2610 Bright-Glo™ Luciferase Assay System 10 ml 80 E2620 Bright-Glo™ Luciferase Assay System 100 ml 80 E2650 Bright-Glo™ Luciferase Assay System 10 × 100 ml 80 E2661 Glo Lysis Buffer, 1X 100 ml 80 E2670 QuantiFluor® dsDNA System 1 ml 160, 309 E2671 QuantiFluor® dsDNA Sample Kit 1 each 160, 309 E2691 FuGENE® 6 Transfection Reagent 1 ml 95 E2692 FuGENE® 6 Transfection Reagent 5 × 1 ml 95 E2693 FuGENE® 6 Transfection Reagent 0.5 ml 95 E2710 Renilla-Glo® Luciferase Assay System 10 ml 81 E2720 Renilla-Glo® Luciferase Assay System 100 ml 81 E2750 Renilla-Glo® Luciferase Assay System 10 × 100 ml 81 E2810 Renilla Luciferase Assay System 100 assays 81 E2820 Renilla Luciferase Assay System 1,000 assays 81 E2821 Thermal Serial Printer and Universal Power Cable 1 each 300 E2851 Thermal Printer Paper 1 each 300 E2920 Dual-Glo® Luciferase Assay System 10 ml 76 E2940 Dual-Glo® Luciferase Assay System 100 ml 76 E2980 Dual-Glo® Luciferase Assay System 10 × 100 ml 76 E3030 Primer Extension System—AMV Reverse Transcriptase 40 reactions 167 E3050 Gel Shift Assay Core System 100 reactions 167, 358 E3091 HeLaScribe® Nuclear Extract in vitro Transcription Grade 40 reactions 166 E3092 HeLaScribe® Nuclear Extract in vitro Transcription Grade 160 reactions 166 E3110 HeLaScribe® Nuclear Extract in vitro Transcription System 40 reactions 166 E3190 QuantiFluor® ssDNA System 1 ml 161 E3201 AP1 Consensus Oligonucleotide 175 pmol 166 E3202 AP1 Consensus Oligonucleotide 35 pmol 166 E3211 AP2 Consensus Oligonucleotide 175 pmol 166 E3212 AP2 Consensus Oligonucleotide 35 pmol 166 E3221 TFIID Consensus Oligonucleotide 175 pmol 166 E3222 TFIID Consensus Oligonucleotide 35 pmol 166 E3231 SP1 Consensus Oligonucleotide 175 pmol 166 E3232 SP1 Consensus Oligonucleotide 35 pmol 166 E3241 OCT1 Consensus Oligonucleotide 175 pmol 166 E3242 OCT1 Consensus Oligonucleotide 35 pmol 166 E3281 CREB Consensus Oligonucleotide 175 pmol 166 E3282 CREB Consensus Oligonucleotide 35 pmol 166 E3291 NF-κB Consensus Oligonucleotide 175 pmol 166 E3292 NF-κB Consensus Oligonucleotide 35 pmol 166 E3300 Gel Shift Assay System 100 reactions 167, 358 E3310 QuantiFluor® RNA System 1 ml 161, 310 E3511 ΦX174 DNA/HinfI Dephosphorylated Markers 2.5 μg 102 E3521 HeLaScribe® Nuclear Extract, Gel Shift Assay Grade 3 × 40 μl 167, 358 E3581 Gel Shift Binding 5X Buffer 5 × 200 μl 167, 358 E3621 HeLaScribe® Nuclear Extract Positive Control DNA 300 ng 166 E3641 pGL4.37[luc2P/ARE/Hygro] Vector 20 μg 12, 59, 88, 226 E3651 pGL4.38[luc2P/p53 RE/Hygro] Vector 20 μg 12, 59, 88, 226 E3661 pGL4.39[luc2P/ATF6 RE/Hygro] Vector 20 μg 12, 59, 88, 226 E3671 pGL4.48[luc2P/SBE/Hygro] Vector 20 μg 12, 59, 88, 226 E3751 pGL4.41[luc2P/HSE/Hygro] Vector 20 μg 12, 59, 88, 226 E3971 Reporter Lysis 5X Buffer 30 ml 80, 83 E4001 pGL4.42[luc2P/HRE/Hygro] Vector 20 μg 12, 59, 88, 226 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 385 Index by Catalog Number Cat# Product Size Page E4030 Luciferase Assay System with Reporter Lysis Buffer 100 assays 80 E4041 pGL4.47[luc2P/SIE/Hygro] Vector 20 μg 12, 59, 88, 226 E4111 pGL4.44[luc2P/AP1 RE/Hygro] Vector 20 μg 12, 59, 88, 226 E4121 pGL4.43[luc2P/XRE/Hygro] Vector 20 μg 12, 59, 88, 226 E4131 pGL4.40[luc2P/MRE/Hygro] Vector 20 μg 12, 59, 88, 226 E4141 pGL4.45[luc2P/ISRE/Hygro] Vector 20 μg 12, 59, 88, 226 E4471 pSP-luc+NF Fusion Vector 20 μg 93 E4481 RVprimer3 (clockwise) 2 μg 93 E4491 RVprimer4 (counterclockwise) 2 μg 93 E4530 Luciferase Assay System Freezer Pack 1,000 assays 80 E4550 Luciferase 1000 Assay System 1,000 assays 80 E4611 pGL4.49[luc2P/TCF-LEF RE/Hygro] Vector 20 μg 12, 59, 88, 226 E4651 pGL4.52[luc2P/STAT5RE/Hygro] Vector 20 μg 12, 59, 88, 226 E4720 Beta-Glo® Assay System 10 ml 83 E4740 Beta-Glo® Assay System 100 ml 83 E4780 Beta-Glo® Assay System 10 × 100 ml 83 E4851 GloMax® 20/20 Replacement Tubing (2), Valves (4), Tips (30) 1 each 300 E4870 QuantiFluor® ONE dsDNA System 500 reactions 160, 309 E4871 QuantiFluor® ONE dsDNA System 100 reactions 160, 309 E4881 Transfection Carrier DNA 5 × 20 μg 85, 176, 225 E4931 K562 Genomic DNA 80 μg 160, 282, 309 E4941 0.5ml PCR Tubes 50 pack 160, 161, 162, 283, 297, 308, 309, 310 E4942 0.5ml PCR Tubes 200 pack 160, 161, 162, 283, 297, 308, 309, 310 E4981 ViaFect™ Transfection Reagent 0.75 ml 95 E4982 ViaFect™ Transfection Reagent 2 × 0.75 ml 95 E5011 pGL4.53[luc2/PGK] Vector 20 μg 86, 87 E5061 pGL4.54[luc2/TK] Vector 20 μg 86, 87 E5150 Quantus™ NGS Starter Package 1 each 162, 207, 298, 308 E5311 GloMax® 20/20 Luminometer 1 each 300 E5321 GloMax® 20/20 Luminometer w/Single AutoInjector 1 each 300 E5331 GloMax® 20/20 Luminometer w/Dual AutoInjector 1 each 300 E5341 GloMax® 20/20 Light Standard 1 each 300 E5351 GloMax® 20/20 Fluorescent Module, UV 1 each 300 E5361 GloMax® 20/20 Fluorescent Module, Blue 1 each 300 E5371 GloMax® 20/20 Test Tube Holder (1.5ml Microcentrifuge Tubes) 1 each 300 E5391 GloMax® 20/20 Replacement Valves 4 sets 300 E5411 GloMax® 20/20 Replacement Power Supply 1 each 300 E6000 rCTP, rATP, rUTP, rGTP, 100mM each 4 × 400 μl 166, 195 E6011 rATP, 100mM 400 μl 166, 195 E6021 rUTP, 100mM 400 μl 166, 195 E6031 rGTP, 100mM 400 μl 166, 195 E6041 rCTP, 100mM 400 μl 166, 195 E6110 ONE-Glo™ Luciferase Assay System 10 ml 78 E6120 ONE-Glo™ Luciferase Assay System 100 ml 78 E6130 ONE-Glo™ Luciferase Assay System 1 L 78 E6150 Quantus™ Fluorometer 1 each 162, 297, 308 Cat# Product Size Page E6421 Monster Green® Fluorescent Protein phMGFP Vector 20 μg 94 E6481 EnduRen™ Live Cell Substrate 0.34 mg 82 E6482 EnduRen™ Live Cell Substrate 3.4 mg 82 E6485 EnduRen™ Live Cell Substrate 34 mg 82 E6491 ViviRen™ Live Cell Substrate 0.37 mg 82 E6492 ViviRen™ Live Cell Substrate 3.7 mg 82 E6495 ViviRen™ Live Cell Substrate 37 mg 82 E6532 Light Plate, ABS/Fluor 1 each 296, 298, 299, 310, 311 E6551 Luciferin-EF™ 25 mg 81, 274 E6552 Luciferin-EF™ 250 mg 81, 274 E6651 pGL4.10[luc2] Vector 20 μg 87 E6661 pGL4.11[luc2P] Vector 20 μg 87 E6671 pGL4.12[luc2CP] Vector 20 μg 87 E6681 pGL4.13[luc2/SV40] Vector 20 μg 86, 87 E6691 pGL4.14[luc2/Hygro] Vector 20 μg 87 E6701 pGL4.15[luc2P/Hygro] Vector 20 μg 87 E6711 pGL4.16[luc2CP/Hygro] Vector 20 μg 87 E6721 pGL4.17[luc2/Neo] Vector 20 μg 87 E6731 pGL4.18[luc2P/Neo] Vector 20 μg 87 E6741 pGL4.19[luc2CP/Neo] Vector 20 μg 87 E6751 pGL4.20[luc2/Puro] Vector 20 μg 87 E6761 pGL4.21[luc2P/Puro] Vector 20 μg 87 E6771 pGL4.22[luc2CP/Puro] Vector 20 μg 87 E6881 pGL4.70[hRluc] Vector 20 μg 88 E6891 pGL4.71[hRlucP] Vector 20 μg 88 E6901 pGL4.72[hRlucCP] Vector 20 μg 88 E6911 pGL4.73[hRluc/SV40] Vector 20 μg 87 E6921 pGL4.74[hRluc/TK] Vector 20 μg 87 E6931 pGL4.75[hRluc/CMV] Vector 20 μg 87 E6941 pGL4.76[hRluc/Hygro] Vector 20 μg 88 E6951 pGL4.77[hRlucP/Hygro] Vector 20 μg 88 E6961 pGL4.78[hRlucCP/Hygro] Vector 20 μg 88 E6971 pGL4.79[hRluc/Neo] Vector 20 μg 88 E6981 pGL4.80[hRlucP/Neo] Vector 20 μg 88 E6991 pGL4.81[hRlucCP/Neo] Vector 20 μg 88 E7110 ONE-Glo™ + Tox Luciferase Reporter and Cell Viability Assay 1 plate 79 E7120 ONE-Glo™ + Tox Luciferase Reporter and Cell Viability Assay 10 plates 79 E7501 pGL4.82[hRluc/Puro] Vector 20 μg 88 E7511 pGL4.83[hRlucP/Puro] Vector 20 μg 88 E7521 pGL4.84[hRlucCP/Puro] Vector 20 μg 88 E8110 ONE-Glo™ EX Luciferase Assay System 10 ml 78 E8120 ONE-Glo™ EX Luciferase Assay System 100 ml 78 E8130 ONE-Glo™ EX Luciferase Assay System 10 × 10 ml 78 E8150 ONE-Glo™ EX Luciferase Assay System 10 × 100 ml 78 E8411 pGL4.23[luc2/minP] Vector 20 μg 12, 59, 88, 226 E8421 pGL4.24[luc2P/minP] Vector 20 μg 12, 59, 88, 226 E8431 pGL4.25[luc2CP/minP] Vector 20 μg 12, 59, 88, 226 E8441 pGL4.26[luc2/minP/Hygro] Vector 20 μg 12, 59, 88, 226 E8451 pGL4.27[luc2P/minP/Hygro] Vector 20 μg 12, 59, 88, 226 E8461 pGL4.28[luc2CP/minP/Hygro] Vector 20 μg 12, 59, 88, 226 E8471 pGL4.29[luc2P/CRE/Hygro] Vector 20 μg 12, 59, 88, 226 E8481 pGL4.30[luc2P/NFAT-RE/Hygro] Vector 20 μg 12, 59, 88, 226 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 386 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page E8491 pGL4.32[luc2P/NF-κB-RE/Hygro] Vector 20 μg 12, 59, 88, 226 E8500 GloResponse™ CRE-luc2P HEK293 Cell Line 2 vials 11, 12, 59, 88, 92, 226 E8510 GloResponse™ NFAT-RE-luc2P HEK293 Cell Line 2 vials 11, 12, 59, 88, 92, 226 E8520 GloResponse™ NF-κB-RE-luc2P HEK293 Cell Line 2 vials 11, 12, 59, 88, 92, 226 FF2000 ENLITEN® ATP Assay System 100 assays 5 FF2021 ENLITEN® rLuciferase/Luciferin Reagent 100 assays 5 FF3750 Wizard® Magnetic DNA Purification System for Food 200 preps 2, 142, 202 FF3751 Wizard® Magnetic DNA Purification System for Food 400 preps 2, 142, 202 FF3760 Wizard® Magnetic 96 DNA Plant System 2 × 96 preps 142, 202 FF3761 Wizard® Magnetic 96 DNA Plant System 4 × 96 preps 142, 202 G1001 HaloTag® Alexa Fluor® 488 Ligand 30 μl 64, 345 G1002 HaloTag® Alexa Fluor® 488 Ligand 15 μl 64, 345 G1111 CellTiter 96® AQueous MTS Reagent Powder 1 g 23 G1112 CellTiter 96® AQueous MTS Reagent Powder 250 mg 23 G1180 Proteasome-Glo™ 3-Substrate Cell-Based Assay System 10 ml 343 G1200 Proteasome-Glo™ 3-Substrate Cell-Based Assay System 50 ml 343 G1321 pFC17K HaloTag® CMVd3 Flexi® Vector 20 μg 65, 68, 347 G1471 Human Genomic DNA: Male 100 μg 281 G1521 Human Genomic DNA: Female 100 μg 281 G1551 pFC17A HaloTag® CMVd3 Flexi® Vector 20 μg 65, 68, 347 G1571 pFC16K HaloTag® CMVd2 Flexi® Vector 20 μg 65, 68, 347 G1591 pFC16A HaloTag® CMVd2 Flexi® Vector 20 μg 65, 68, 347 G1601 pFC15K HaloTag® CMVd1 Flexi® Vector 20 μg 65, 68, 347 G1611 pFC15A HaloTag® CMVd1 Flexi® Vector 20 μg 65, 68, 347 G1681 pFC20A HaloTag® T7 SP6 Flexi® Vector 20 μg 124, 125, 348 G1691 pFC20K HaloTag® T7 SP6 Flexi® Vector 20 μg 124, 125, 348 G1711 Lambda DNA/HindIII Markers 100 μg 101 G1721 Lambda DNA/EcoRI Markers 100 μg 101 G1731 Lambda DNA/EcoRI + HindIII Markers 100 μg 101 G1741 pGEM® DNA Markers 50 μg 101 G1751 ΦX174 DNA/HinfI Markers 50 μg 101 G1761 ΦX174 DNA/HaeIII Markers 50 μg 101 G1780 CytoTox 96® Non-Radioactive Cytotoxicity Assay 1,000 assays 28 G1821 Lysis Solution 5 ml 26 G1841 pFN19K HaloTag® T7 SP6 Flexi® Vector 20 μg 124, 348 G1881 Blue/Orange Loading Dye, 6X 3 ml 271 G1891 pFN19A HaloTag® T7 SP6 Flexi® Vector 20 μg 124, 348 G1912 HaloLink™ Resin 1.25 ml 359 G1913 HaloLink™ Resin 2.5 ml 359 G1914 HaloLink™ Resin 10 ml 359 G1915 HaloLink™ Resin 25 ml 359 G2101 100bp DNA Ladder 250 μl 100 G2681 pFN18K HaloTag® T7 Flexi® Vector 20 μg 124, 181, 348 G2751 pFN18A HaloTag® T7 Flexi® Vector 20 μg 124, 181, 348 G2801 HaloTag® Oregon Green® Ligand 30 μl 64, 345 G2802 HaloTag® Oregon Green® Ligand 15 μl 64, 345 Cat# Product Size Page G2821 pFN21A HaloTag® CMV Flexi® Vector 20 μg 65, 68, 347 G2831 pFN21K HaloTag® CMV Flexi® Vector 20 μg 65, 68, 347 G2841 pFN22A HaloTag® CMVd1 Flexi® Vector 20 μg 65, 68, 347 G2851 pFN22K HaloTag® CMVd1 Flexi® Vector 20 μg 65, 68, 347 G2861 pFN23A HaloTag® CMVd2 Flexi® Vector 20 μg 65, 68, 347 G2871 pFN23K HaloTag® CMVd2 Flexi® Vector 20 μg 65, 68, 347 G2881 pFN24A HaloTag® CMVd3 Flexi® Vector 20 μg 65, 68, 347 G2930 Griess Reagent System 1,000 assays 31, 60 G2981 pFN24K HaloTag® CMVd3 Flexi® Vector 20 μg 65, 68, 347 G2991 HaloTag® TMRDirect™ Ligand 30 μl 64, 181, 345, 365 G3011 ProMega-Markers® Lambda Ladders 40–60 lanes 102 G3041 Human Genomic DNA 100 μg 281 G3091 Mouse Genomic DNA 100 μg 281 G3161 PCR Markers 250 μl 100 G3191 RNA Markers 50 μl 103, 163 G3221 HaloTag® R110Direct™ Ligand 30 μl 64, 345 G3231 Anti-Human p75 pAb 200 μg 70 G3250 DeadEnd™ Fluorometric TUNEL System 60 reactions 17 G3580 CellTiter 96® AQueous One Solution Cell Proliferation Assay 1,000 assays 22 G3581 CellTiter 96® AQueous One Solution Cell Proliferation Assay 5,000 assays 22 G3582 CellTiter 96® AQueous One Solution Cell Proliferation Assay 200 assays 22 G3780 HaloTag® Flexi® Vectors—CMV Deletion Series Sample Pack 9 × 2 μg 65, 347 G4000 CellTiter 96® Non-Radioactive Cell Proliferation Assay 1,000 assays 23 G4100 CellTiter 96® Non-Radioactive Cell Proliferation Assay 5,000 assays 23 G4471 10bp DNA Step Ladder 32.5 μg 99 G4491 HaloTag® Standard Protein 30 μg 366 G4511 25bp DNA Step Ladder 100 μg 99 G4521 50bp DNA Step Ladder 90 μg 99 G5021 rhEGF 100 μg 53 G5071 rhFGF, Basic 25 μg 53 G5141 mNGF, 2.5S 100 μg 53 G5241 rhTNFα 10 μg 53 G5421 CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay 1,000 assays 23 G5430 CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay 5,000 assays 23 G5440 CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay 50,000 assays 23 G5631 rhLung β Tryptase 100 μg 344 G5711 1kb DNA Ladder 500 μl 100 G6050 HaloTag® Cloning Starter System 1 each 65, 123, 347 G6080 CellTiter-Fluor™ Cell Viability Assay 10 ml 22 G6081 CellTiter-Fluor™ Cell Viability Assay 5 × 10 ml 22 G6082 CellTiter-Fluor™ Cell Viability Assay 2 × 50 ml 22 G6270 HaloTag® Protein Purification System Sample Pack 1 each 181, 365 G6280 HaloTag® Protein Purification System 1 each 181, 365 G6320 ApoTox-Glo™ Triplex Assay 10 ml 13, 179 G6321 ApoTox-Glo™ Triplex Assay 5 × 10 ml 13, 179 G6410 ApoLive-Glo™ Multiplex Assay 10 ml 14 G6411 ApoLive-Glo™ Multiplex Assay 5 × 10 ml 14 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 387 Index by Catalog Number Cat# Product Size Page G6420 HDAC-Glo™ I/II Assay 10 ml 177 G6421 HDAC-Glo™ I/II Assay 5 × 10 ml 177 G6422 HDAC-Glo™ I/II Assay 100 ml 177 G6430 HDAC-Glo™ I/II Screening System 10 ml 177 G6431 HDAC-Glo™ I/II Screening System 5 × 10 ml 177 G6450 SIRT-Glo™ Assay 10 ml 178 G6500 HaloTag® Mammalian Pull-Down and Labeling System 24 reactions 182, 359 G6504 HaloTag® Mammalian Pull-Down System 24 reactions 182, 359 G6509 HaloTag® Complete Pull-Down System 1 each 182, 359 G6521 Protease Inhibitor Cocktail, 50X 1 ml 181, 182, 275, 338, 359, 361, 365 G6570 HeLa Nuclear Extract 10 μl 177, 178 G6591 HaloTag® Control Vector 20 μg 182, 359 G6601 HaloTEV Protease 200 μl 181, 365, 367 G6602 HaloTEV Protease 800 μl 181, 365, 367 G6790 HaloTag® Mammalian Protein Purification System 1 each 181, 365 G6795 HaloTag® Mammalian Protein Detection and Purification System 1 each 181, 365 G6799 HaloTag® Mammalian Protein Detection and Purification System Sample Pack 1 each 181, 365 G6941 1kb DNA Step Ladder 90 μg 99 G6951 100bp DNA Step Ladder 100 μg 99 G6961 200bp DNA Step Ladder 100 μg 99 G7010 ADCC Reporter Bioassay, Core Kit 1 each 236 G7013 ADCC Reporter Bioassay, Target (WIL2-S) 1 each 236 G7014 ADCC Reporter Bioassay, Complete (WIL2-S) 1 each 236 G7015 ADCC Reporter Bioassay, Complete (Raji) 1 each 236 G7016 ADCC Reporter Bioassay, Target (Raji) 1 each 236 G7018 ADCC Reporter Bioassay, Core Kit 5X 1 each 236 G7061 rhSkin β Tryptase 100 μg 344 G7102 ADCC Bioassay Effector Cells, Propagation Model 1 each 236 G7121 Anti-βIII Tubulin mAb 100 μg 71 G7130 DeadEnd™ Colorimetric TUNEL System 40 reactions 17 G7231 Caspase Inhibitor Z-VAD-FMK, 20mM 50 μl 17 G7232 Caspase Inhibitor Z-VAD-FMK, 20mM 125 μl 17 G7281 Magne™ HaloTag® Beads, 20% Slurry 1 ml 358, 366 G7282 Magne™ HaloTag® Beads, 20% Slurry 5 ml 358, 366 G7341 Anti-PARP p85 Fragment pAb 50 μl 18, 70 G7360 DeadEnd™ Colorimetric TUNEL System 20 reactions 17 G7431 TMB One Solution 100 ml 72 G7451 Anti-Luciferase pAb 200 μg 70 G7461 CaspACE™ FITC-VAD-FMK In Situ Marker 50 μl 16 G7462 CaspACE™ FITC-VAD-FMK In Situ Marker 125 μl 16 G7471 Magne™ Protein G Beads, 20% Slurry 1 ml 243, 246, 364, 366 G7472 Magne™ Protein G Beads, 20% Slurry 5 ml 243, 246, 364, 366 G7473 Magne™ Protein G Beads, 20% Slurry 50 ml 243, 246, 364, 366 G7481 Anti-ACTIVE® Caspase-3 pAb 50 μl 18, 69 G7511 BenchTop φX174 DNA/HaeIII Markers 250 μl 98 G7521 BenchTop pGEM® DNA Markers 250 μl 98 G7531 BenchTop PCR Markers 300 μl 98 G7541 BenchTop 1kb DNA Ladder 600 μl 98 G7570 CellTiter-Glo® Luminescent Cell Viability Assay 10 ml 20 G7571 CellTiter-Glo® Luminescent Cell Viability Assay 10 × 10 ml 20 G7572 CellTiter-Glo® Luminescent Cell Viability Assay 100 ml 20 G7573 CellTiter-Glo® Luminescent Cell Viability Assay 10 × 100 ml 20 G7711 pHTC HaloTag® CMV-neo Vector 20 μg 65, 68, 347 Cat# Product Size Page G7721 pHTN HaloTag® CMV-neo Vector 20 μg 65, 68, 347 G7781 Apo-ONE® Homogeneous Caspase-3/7 Buffer 100 ml 16 G7790 Apo-ONE® Homogeneous Caspase-3/7 Assay 10 ml 16, 24 G7791 Apo-ONE® Homogeneous Caspase-3/7 Assay 100 ml 16 G7792 Apo-ONE® Homogeneous Caspase-3/7 Assay 1 ml 16 G7890 CytoTox-ONE™ Homogeneous Membrane Integrity Assay 200–800 assays 28 G7891 CytoTox-ONE™ Homogeneous Membrane Integrity Assay 1,000–4,000 assays 28 G7892 CytoTox-ONE™ Homogeneous Membrane Integrity Assay, HTP 1,000–4,000 assays 28 G7940 Bio-Glo™ Luciferase Assay System 100 ml 233, 234, 240, 241 G7941 Bio-Glo™ Luciferase Assay System 10 ml 233, 234, 240, 241 G7971 pH6HTN His6 HaloTag® T7 Vector 20 μg 124, 348 G8000 Mitochondrial ToxGlo™ Assay 10 ml 29, 60 G8001 Mitochondrial ToxGlo™ Assay 100 ml 29, 60 G8031 pH6HTC His6 HaloTag® T7 Vector 20 μg 124, 348 G8080 CellTiter-Blue® Cell Viability Assay 20 ml 16, 24 G8081 CellTiter-Blue® Cell Viability Assay 100 ml 24 G8082 CellTiter-Blue® Cell Viability Assay 10 × 100 ml 24 G8090 Caspase-Glo® 3/7 Assay 2.5 ml 14, 24 G8091 Caspase-Glo® 3/7 Assay 10 ml 14 G8092 Caspase-Glo® 3/7 Assay 100 ml 14 G8093 Caspase-Glo® 3/7 Assay 10 × 10 ml 14 G8200 Caspase-Glo® 8 Assay 2.5 ml 15, 24 G8201 Caspase-Glo® 8 Assay 10 ml 15 G8202 Caspase-Glo® 8 Assay 100 ml 15 G8210 Caspase-Glo® 9 Assay 2.5 ml 15, 24 G8211 Caspase-Glo® 9 Assay 10 ml 15 G8212 Caspase-Glo® 9 Assay 100 ml 15 G8230 BacTiter-Glo™ Microbial Cell Viability Assay 10 ml 5, 21 G8231 BacTiter-Glo™ Microbial Cell Viability Assay 10 × 10 ml 5, 21 G8232 BacTiter-Glo™ Microbial Cell Viability Assay 100 ml 5, 21 G8233 BacTiter-Glo™ Microbial Cell Viability Assay 10 × 100 ml 5, 21 G8251 HaloTag® TMR Ligand 30 μl 64, 345 G8252 HaloTag® TMR Ligand 15 μl 64, 345 G8261 pFN29A His6 HaloTag® T7 Flexi® Vector 20 μg 124, 348 G8272 HaloTag® diAcFAM Ligand 30 μl 64, 345 G8273 HaloTag® diAcFAM Ligand 15 μl 64, 345 G8281 HaloTag® Biotin Ligand 30 μl 64, 345 G8282 HaloTag® Biotin Ligand 15 μl 64, 345 G8291 BenchTop 100bp DNA Ladder 300 μl 98 G8321 pFC30A His6 HaloTag® T7 Flexi® Vector 20 μg 124, 348 G8331 pFN29K His6 HaloTag® T7 Flexi® Vector 20 μg 124, 348 G8350 DPPIV-Glo™ Protease Assay 10 ml 342 G8351 DPPIV-Glo™ Protease Assay 50 ml 342 G8381 pFC30K His6 HaloTag® T7 Flexi® Vector 20 μg 124, 348 G8421 pFC27A HaloTag® CMV-neo Flexi® Vector 20 μg 65, 68, 347 G8431 pFC27K HaloTag® CMV-neo Flexi® Vector 20 μg 65, 68, 347 G8441 pFN28A HaloTag® CMV-neo Flexi® Vector 20 μg 65, 68, 347 G8451 pFN28K HaloTag® CMV-neo Flexi® Vector 20 μg 65, 68, 347 G8461 CellTiter-Glo® One Solution Assay 100 ml 20 G8462 CellTiter-Glo® One Solution Assay 500 ml 20 G8471 HaloTag® Alexa Fluor® 660 Ligand 30 μl 64, 345 G8472 HaloTag® Alexa Fluor® 660 Ligand 15 μl 64, 345 G8501 Calpain-Glo™ Protease Assay 10 ml 343 G8502 Calpain-Glo™ Protease Assay 50 ml 343 G8531 Proteasome-Glo™ 3-Substrate System 10 ml 342 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 388 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page G8532 Proteasome-Glo™ 3-Substrate System 50 ml 342 G8581 HaloTag® Coumarin Ligand 30 μl 64, 345 G8582 HaloTag® Coumarin Ligand 15 μl 64, 345 G8591 HaloTag® PEG-Biotin Ligand 30 μl 64, 345 G8592 HaloTag® PEG-Biotin Ligand 15 μl 64, 345 G8621 Proteasome-Glo™ Chymotrypsin-Like Assay 10 ml 342 G8622 Proteasome-Glo™ Chymotrypsin-Like Assay 50 ml 342 G8631 Proteasome-Glo™ Trypsin-Like Assay 10 ml 342 G8632 Proteasome-Glo™ Trypsin-Like Assay 50 ml 342 G8641 Proteasome-Glo™ Caspase-Like Assay 10 ml 342 G8642 Proteasome-Glo™ Caspase-Like Assay 50 ml 342 G8660 Proteasome-Glo™ Chymotrypsin-Like CellBased Assay 10 ml 343 G8661 Proteasome-Glo™ Chymotrypsin-Like CellBased Assay 5 × 10 ml 343 G8662 Proteasome-Glo™ Chymotrypsin-Like CellBased Assay 2 × 50 ml 343 G8731 CellTox™ Green Express Cytotoxicity Assay 200 μl 26 G8741 CellTox™ Green Cytotoxicity Assay 10 ml 26 G8742 CellTox™ Green Cytotoxicity Assay 50 ml 26 G8743 CellTox™ Green Cytotoxicity Assay 100 ml 26 G8760 Proteasome-Glo™ Trypsin-Like Cell-Based Assay 10 ml 343 G8761 Proteasome-Glo™ Trypsin-Like Cell-Based Assay 5 × 10 ml 343 G8781 Magne™ Protein A Beads, 20% Slurry 1 ml 243, 246, 364, 366 G8782 Magne™ Protein A Beads, 20% Slurry 5 ml 243, 246, 364, 366 G8783 Magne™ Protein A Beads, 20% Slurry 50 ml 243, 246, 364, 366 G8820 ROS-Glo™ H2 O2 Assay 10 ml 30, 57 G8821 ROS-Glo™ H2 O2 Assay 50 ml 30,57 G8860 Proteasome-Glo™ Caspase-Like Cell-Based Assay 10 ml 343 G8861 Proteasome-Glo™ Caspase-Like Cell-Based Assay 5 × 10 ml 343 G8941 Viral ToxGlo™ Assay 10 ml 24 G8942 Viral ToxGlo™ Assay 10 × 10 ml 24 G8943 Viral ToxGlo™ Assay 100 ml 24 G9061 NAD(P)H-Glo™ Detection System 10 ml 62 G9062 NAD(P)H-Glo™ Detection System 50 ml 62 G9071 NAD/NADH-Glo™ Assay 10 ml 61 G9072 NAD/NADH-Glo™ Assay 50 ml 61 G9081 NADP/NADPH-Glo™ Assay 10 ml 62 G9082 NADP/NADPH-Glo™ Assay 50 ml 62 G9200 MultiTox-Fluor Multiplex Cytotoxicity Assay 10 ml 26 G9201 MultiTox-Fluor Multiplex Cytotoxicity Assay 5 × 10 ml 26 G9202 MultiTox-Fluor Multiplex Cytotoxicity Assay 2 × 50 ml 26 G9211 Anti-HaloTag® Monoclonal Antibody 200 μg 70 G9241 CellTiter-Glo® 2.0 Assay 10 ml 19, 61 G9242 CellTiter-Glo® 2.0 Assay 100 ml 19, 61 G9243 CellTiter-Glo® 2.0 Assay 500 ml 19, 61 G9260 CytoTox-Fluor™ Cytotoxicity Assay 10 ml 27 G9261 CytoTox-Fluor™ Cytotoxicity Assay 5 × 10 ml 27 G9262 CytoTox-Fluor™ Cytotoxicity Assay 2 × 50 ml 27 G9270 MultiTox-Glo Multiplex Cytotoxicity Assay 10 ml 25, 179 G9271 MultiTox-Glo Multiplex Cytotoxicity Assay 5 × 10 ml 25, 179 G9272 MultiTox-Glo Multiplex Cytotoxicity Assay 2 × 50 ml 25, 179 G9281 Anti-HaloTag® pAb 200 μg 72 G9290 CytoTox-Glo™ Cytotoxicity Assay 10 ml 27 G9291 CytoTox-Glo™ Cytotoxicity Assay 5 × 10 ml 27 G9292 CytoTox-Glo™ Cytotoxicity Assay 2 × 50 ml 27 G9302 ADCC Bioassay Effector Cells, F Variant, Propagation Model 1 each 236 Cat# Product Size Page G9381 Mammalian Lysis Buffer 40 ml 182, 359 G9410 HaloCHIP™ System 20 reactions 182, 357, 359 G9441 Digitonin 40 μl 28 G9560 HDAC-Glo™ Class IIa Assay 10 ml 177 G9590 HDAC-Glo™ 2 Assay 10 ml 177 G9651 pFC14A HaloTag® CMV Flexi® Vector 20 μg 65, 68, 347 G9661 pFC14K HaloTag® CMV Flexi® Vector 20 μg 64, 68, 347 G9681 CellTiter-Glo® 3D Cell Viability Assay 10 ml 21 G9682 CellTiter-Glo® 3D Cell Viability Assay 10 × 10 ml 21 G9683 CellTiter-Glo® 3D Cell Viability Assay 100 ml 21 G9711 RealTime-Glo™ MT Cell Viability Assay 100 reactions 19, 178 G9712 RealTime-Glo™ MT Cell Viability Assay 10 × 100 reactions 19, 178 G9713 RealTime-Glo™ MT Cell Viability Assay 1,000 reactions 19, 178 G9790 ADCC Reporter Bioassay, F Variant, Core Kit 1 each 236 G9798 ADCC Reporter Bioassay, F Variant, Core Kit 5X 1 each 236 G9801 HaloTag® NanoBRET™ 618 Ligand 20 μl 357 G9831 pHAb Thiol Reactive Dye 1 × 250 μg 244 G9835 pHAb Thiol Reactive Dye 4 × 250 μg 244 G9841 pHAb Amine Reactive Dye 1 × 250 μg 244 G9845 pHAb Amine Reactive Dye 4 × 250 μg 244 G9871 FcγRIIa-H ADCP Bioassay Effector Cells, Propagation Model 1 each 235 G9901 FcγRIIa-H ADCP Reporter Bioassay, Complete Kit 1 each 235 G9902 FcγRIIa-H ADCP Reporter Bioassay, Complete Kit, Korea 1 each 235 G9903 FcγRIIa-H ADCP Reporter Bioassay, Complete Kit, Taiwan 1 each 235 G9951 Caspase-Glo® 1 Inflammasome Assay 10 ml 29 G9952 Caspase-Glo® 1 Inflammasome Assay 5 × 10 ml 29 G9991 FcγRIIa-H ADCP Reporter Bioassay, Core Kit 1 each 235 G9992 FcγRIIa-H ADCP Reporter Bioassay, Core Kit, Korea 1 each 235 G9993 FcγRIIa-H ADCP Reporter Bioassay, Core Kit, Taiwan 1 each 235 G9995 FcγRIIa-H ADCP Reporter Bioassay, Core Kit 5X 1 each 235 G9996 FcγRIIa-H ADCP Reporter Bioassay, Core Kit 5X, Korea 1 each 235 G9997 FcγRIIa-H ADCP Reporter Bioassay, Core Kit 5X, Taiwan 1 each 235 GA1040 HEK293 Autophagy LC3 HiBiT Reporter Cell Line and Detection System 1 each 18 GA1050 U2OS Autophagy LC3 HiBiT Reporter Cell Line and Detection System 1 each 18 GA1082 VEGF Bioassay, Propagation Model 1 each 233 GA1110 Janelia Fluor® 549 HaloTag® Ligand 5μg 344 GA1111 Janelia Fluor® 549 HaloTag® Ligand 3 × 5μg 344 GA1120 Janelia Fluor® 646 HaloTag® Ligand 5μg 344 GA1121 Janelia Fluor® 646 HaloTag® Ligand 3 × 5μg 344 GA2001 VEGF Bioassay 1 each 233 GA2005 VEGF Bioassay 5X 5 each 233 GA2550 Autophagy LC3 HiBiT Reporter Vector and Detection System 1 each 18 GA3001 VEGF Bioassay, Korea 1 each 233 GA3005 VEGF Bioassay 5X, Korea 5 each 233 GA4001 VEGF Bioassay, Taiwan 1 each 233 GA4005 VEGF Bioassay 5X, Taiwan 5 each 233 GEN1978 Molecular Biology Lab Guide 1 each 134 GM1050 GloMax® Discover 96 Half-Position Aperture Assembly 1 each 296, 298, 299, 310, 311 GM2000 GloMax® Navigator System 1 each 297, 299 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 389 Index by Catalog Number Cat# Product Size Page GM2010 GloMax® Navigator System with Dual Injectors and Pumps 1 each 297, 299 GM3000 GloMax® Discover System 1 each 296, 298, 310 GM3011 GloMax® Discover Luminescence Filter Paddle 1 each 296, 298, 310 GM3012 GloMax® Discover Fluorescence Filter Paddle 1 each 296, 298, 299, 310, 311 GM3030 GloMax® Dual Injectors with Pumps 1 each 296, 298, 299, 310, 311 GM3500 GloMax® Explorer Fully Loaded Model 1 each 296, 299, 311 GM3510 GloMax® Explorer with Luminescence and Fluorescence 1 each 296, 299, 311 GM3520 GloMax® Explorer Absorbance Module Upgrade 1 each 296, 299, 311 H1181 Diamond™ Nucleic Acid Dye 500 μl 271 H5001 Boric Acid, Molecular Biology Grade 500 g 271 H5003 Boric Acid, Molecular Biology Grade 1 kg 271 H5031 EDTA, Disodium Salt, Molecular Biology Grade 100 g 272 H5032 EDTA, Disodium Salt, Molecular Biology Grade 500 g 272 H5041 Ethidium Bromide Solution, Molecular Grade 10 ml 272 H5051 Formamide, Molecular Grade 100 ml 273 H5052 Formamide, Molecular Grade 500 ml 273 H5071 Glycine, Molecular Biology Grade 500 g 273 H5073 Glycine, Molecular Biology Grade 1 kg 273 H5113 Sodium Dodecyl Sulfate, Molecular Biology Grade (SDS) 100 g 277 H5114 Sodium Dodecyl Sulfate, Molecular Biology Grade (SDS) 500 g 277 H5115 Sodium Dodecyl Sulfate, Molecular Biology Grade (SDS) 1 kg 277 H5121 Tris-HCl, Molecular Biology Grade 100 g 279 H5123 Tris-HCl, Molecular Biology Grade 500 g 279 H5125 Tris-HCl, Molecular Biology Grade 2,500 g 279 H5131 Tris Base, Molecular Biology Grade 500 g 279 H5133 Tris Base, Molecular Biology Grade 100 g 279 H5135 Tris Base, Molecular Biology Grade 2,500 g 279 H5141 Triton® X-100, Molecular Biology Grade 500 ml 279 H5142 Triton® X-100, Molecular Biology Grade 100 ml 279 H5151 Tween® 20, Molecular Biology Grade 500 ml 280 H5152 Tween® 20, Molecular Biology Grade 100 ml 280 H5252 Ammonium Sulfate, Molecular Biology Grade 5 kg 269 H5271 Sodium Chloride, Molecular Biology Grade 500 g 277 H5273 Sodium Chloride, Molecular Biology Grade 1 kg 277 H5302 HEPES, Molecular Biology Grade (free acid) 100 g 274 H5303 HEPES, Molecular Biology Grade (free acid) 500 g 274 H5381 Guanidine-HCl, Molecular Biology Grade 100 g 274 H5383 Guanidine-HCl, Molecular Biology Grade 500 g 274 H5433 Glycerol, Molecular Biology Grade 1,000 ml 273 J1191 PD-L1 Negative Cells 1 each 240 J1195 PD-L1 Negative Cells 5X 1 each 240 J1201 Control Ab, Anti-PD-1 1 each 240 J1250 PD-1/PD-L1 Blockade Bioassay 1 each 240 J1252 PD-1/PD-L1 Blockade Bioassay, Propagation Model 1 each 240 J1255 PD-1/PD-L1 Blockade Bioassay 5X 1 each 240 J1341 Glucose Uptake-Glo™ Assay 5 ml 57 J1342 Glucose Uptake-Glo™ Assay 10 ml 57 J1343 Glucose Uptake-Glo™ Assay 50 ml 57 J1601 T Cell Activation Bioassay (NFAT), Propagation Model 1 each 241 J1621 T Cell Activation Bioassay (NFAT) 1 each 241 J1622 T Cell Activation Bioassay (NFAT), Korea 1 each 241 Cat# Product Size Page J1623 T Cell Activation Bioassay (NFAT), Taiwan 1 each 241 J1625 T Cell Activation Bioassay (NFAT) 5X 5 each 241 J1626 T Cell Activation Bioassay (NFAT) 5X, Korea 5 each 241 J1627 T Cell Activation Bioassay (NFAT) 5X, Taiwan 5 each 241 J1631 T Cell Activation Bioassay (IL-2), Propagation Model 1 each 241 J1651 T Cell Activation Bioassay (IL-2) 1 each 241 J1652 T Cell Activation Bioassay (IL-2), Korea 1 each 241 J1653 T Cell Activation Bioassay (IL-2), Taiwan 1 each 241 J1655 T Cell Activation Bioassay (IL-2) 5X 5 each 241 J1656 T Cell Activation Bioassay (IL-2) 5X, Korea 5 each 241 J1657 T Cell Activation Bioassay (IL-2) 5X, Taiwan 5 each 241 J2051 Control Antibody, Anti-TIGIT 100µg 239 J2092 TIGIT/CD155 Blockade Bioassay, Propagation Model 1 each 239 J2102 PD-1 + TIGIT Combination Bioassay, Propagation Model 1 each 238 J2201 TIGIT/CD155 Blockade Bioassay 1 each 239 J2205 TIGIT/CD155 Blockade Bioassay 5X 5 each 239 J2211 PD-1 + TIGIT Combination Bioassay 1 each 238 J2215 PD-1 + TIGIT Combination Bioassay 5X 5 each 238 J2232 FcγRIIb CHO-K1 Cells, Propagation Model 1 each 237 J2301 TIGIT/CD155 Blockade Bioassay, Korea 1 each 239 J2305 TIGIT/CD155 Blockade Bioassay 5X, Korea 5 each 239 J2311 PD-1 + TIGIT Combination Bioassay, Korea 1 each 238 J2315 PD-1 + TIGIT Combination Bioassay 5X, Korea 5 each 238 J2332 4-1BB Bioassay, Propagation Model 1 each 237 J2371 Recombinant VEGF 1 each 233 J2380 LDH-Glo™ Cytotoxicity Assay 10ml 25 J2381 LDH-Glo™ Cytotoxicity Assay 50ml 25 J2401 TIGIT/CD155 Blockade Bioassay, Taiwan 1 each 239 J2405 TIGIT/CD155 Blockade Bioassay 5X, Taiwan 5 each 239 J2411 PD-1 + TIGIT Combination Bioassay, Taiwan 1 each 238 J2415 PD-1 + TIGIT Combination Bioassay 5X, Taiwan 5 each 238 J2952 IL-2 Bioassay, Propagation Model 1 each 232 J2962 IL-15 Bioassay, Propagation Model 1 each 232 J5021 Lactate-Glo™ Assay 5 ml 56 J5022 Lactate-Glo™ Assay 50 ml 56 J6021 Glucose-Glo™ Assay 5 ml 56 J6022 Glucose-Glo™ Assay 50 ml 56 J7021 Glutamate-Glo™ Assay 5 ml 56 J7022 Glutamate-Glo™ Assay 50 ml 56 J8021 Glutamine/Glutamate-Glo™ Assay 5 ml 56 J8022 Glutamine/Glutamate-Glo™ Assay 50 ml 56 JA1000 RealTime-Glo™ Annexin V Apoptosis Assay 100 assays 13 JA1001 RealTime-Glo™ Annexin V Apoptosis Assay 1,000 assays 13 JA1011 RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay 100 assays 13 JA1012 RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay 1,000 assays 13 JA1020 Control Antibody, Anti-CTLA-4 100µg 239 JA1111 LAG-3/MHCII Blockade Bioassay 1 each 237 JA1112 LAG-3/MHCII Blockade Bioassay, Propagation Model 1 each 237 JA1115 LAG-3/MHCII Blockade Bioassay 5X 5 each 237 JA1400 CTLA-4 Blockade Bioassay, Propagation Model 1 each 239 JA2011 IL-15 Bioassay 1 each 232 JA2015 IL-15 Bioassay 5X 5 each 232 JA2111 LAG-3/MHCII Blockade Bioassay, Korea 1 each 237 JA2115 LAG-3/MHCII Blockade Bioassay 5X, Korea 5 each 237 JA2201 IL-2 Bioassay 1 each 232 JA2205 IL-2 Bioassay 5X 5 each 232 JA2251 FcγRIIb CHO-K1 Cells 1 each 237 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 390 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page JA2255 FcγRIIb CHO-K1 Cells 5X 5 each 237 JA2351 4-1BB Bioassay 1 each 237 JA2355 4-1BB Bioassay 5X 5 each 237 JA3001 CTLA-4 Blockade Bioassay 1 each 239 JA3005 CTLA-4 Blockade Bioassay 5X 5 each 239 JA3011 IL-15 Bioassay, Korea 1 each 232 JA3015 IL-15 Bioassay 5X, Korea 5 each 232 JA3111 LAG-3/MHCII Blockade Bioassay, Taiwan 1 each 237 JA3115 LAG-3/MHCII Blockade Bioassay 5X, Taiwan 5 each 237 JA3301 IL-2 Bioassay, Korea 1 each 232 JA3305 IL-2 Bioassay 5X, Korea 5 each 232 JA3351 4-1BB Bioassay, Korea 1 each 237 JA3355 4-1BB Bioassay 5X, Korea 5 each 237 JA4001 CTLA-4 Blockade Bioassay, Korea 1 each 239 JA4005 CTLA-4 Blockade Bioassay 5X, Korea 5 each 239 JA4011 IL-15 Bioassay, Taiwan 1 each 232 JA4015 IL-15 Bioassay 5X, Taiwan 5 each 232 JA4401 IL-2 Bioassay, Taiwan 1 each 232 JA4405 IL-2 Bioassay 5X, Taiwan 5 each 232 JA4411 4-1BB Bioassay, Taiwan 1 each 237 JA4415 4-1BB Bioassay 5X, Taiwan 5 each 237 JA5001 CTLA-4 Blockade Bioassay, Taiwan 1 each 239 JA5005 CTLA-4 Blockade Bioassay 5X, Taiwan 5 each 239 K1150 Control Ab, Anti-LAG-3 100µg 237 K1161 Control Antibody, Anti-4-1BB 50µg 237 K1201 TCR Activating Antigen Stock Solution 500µl 237 K9981 Bacterial Strain LE392, Glycerol Stock 500 μl 132 L1001 JM109 Competent Cells, >107 cfu/μg 1 ml 132 L1020 E. coli S30 Extract System for Circular DNA 30 reactions 338 L1030 E. coli S30 Extract System for Linear Templates 30 reactions 337 L1061 pF25A ICE T7 Flexi® Vector 20 μg 222, 331 L1081 pF25K ICE T7 Flexi® Vector 20 μg 222, 331 L1101 TnT® T7 Insect Cell Extract Protein Expression System 10 reactions 331 L1102 TnT® T7 Insect Cell Extract Protein Expression System 40 reactions 331 L1110 S30 T7 High-Yield Protein Expression System 24 reactions 337 L1115 S30 T7 High-Yield Protein Expression System 8 reactions 337 L1130 E. coli T7 S30 Extract System for Circular DNA 30 reactions 337 L1170 TnT® T7 Quick Coupled Transcription/ Translation System 40 reactions 124, 332 L1171 TnT® T7 Quick Coupled Transcription/ Translation System, Trial Size 5 reactions 332 L1191 BL21(DE3)pLysS Competent Cells, >106 cfu/μg 1 ml 132, 330 L1195 Single-Use BL21(DE3)pLysS Competent Cells 1 ml 132, 330 L1210 TnT® T7 Quick Starter Bundle, Chemiluminescent 1 each 333 L1215 TnT® T7 Quick Starter Bundle, Colorimetric 1 each 333 L2001 JM109 Competent Cells, >108 cfu/μg 1 ml 132 L2005 Single-Use JM109 Competent Cells, >108 cfu/µg 1 ml 132 L2011 HB101 Competent Cells, >108 cfu/μg 1 ml 132 L2015 Single-Use HB101 Competent Cells, >108 cfu/µg 1 ml 132 L2080 TnT® SP6 Quick Coupled Transcription/ Translation System 40 reactions 332 L2081 TnT® SP6 Quick Coupled Transcription/ Translation System, Trial Size 5 reactions 332 L3002 Single Step (KRX) Competent Cells 20 × 50 μl 132, 330 L3260 TnT® SP6 High-Yield Wheat Germ Protein Expression System 40 reactions 331 L3261 TnT® SP6 High-Yield Wheat Germ Protein Expression System 10 reactions 331 L4130 TnT® SP6 Coupled Wheat Germ Extract System 40 reactions 333 L4140 TnT® T7 Coupled Wheat Germ Extract System 40 reactions 333 Cat# Product Size Page L4151 Rabbit Reticulocyte Lysate, Untreated 1 ml 336 L4330 Rabbit Reticulocyte Lysate/Wheat Germ Extract Combination System 24 reactions 335 L4380 Wheat Germ Extract 5 × 200 μl 335 L4461 Amino Acid Mixture, Complete 175 μl 336 L4471 Amino Acid Mixture Minus Cysteine 175 μl 336 L4540 Flexi® Rabbit Reticulocyte Lysate System 30 reactions 335 L4561 Luciferase Control RNA 20 μg 336 L4581 Magnesium Acetate 100 μl 332 L4591 Potassium Chloride 200 μl 332 L4600 TnT® SP6 Coupled Reticulocyte Lysate System 40 reactions 332 L4601 TnT® SP6 Coupled Reticulocyte Lysate System, Trial Size 8 reactions 332 L4610 TnT® T7 Coupled Reticulocyte Lysate System 40 reactions 332 L4611 TnT® T7 Coupled Reticulocyte Lysate System, Trial Size 8 reactions 332 L4731 pGEM® β-Gal Control DNA 20 μg 338 L4741 Luciferase SP6 Control DNA 20 μg 336 L4821 Luciferase T7 Control DNA 20 μg 336 L4950 TnT® T3 Coupled Reticulocyte Lysate System 40 reactions 332 L4960 Rabbit Reticulocyte Lysate System, Nuclease Treated 30 reactions 334 L5001 FluoroTect™ GreenLys in vitro Translation Labeling System 40 reactions 349 L5010 TnT® T7/T3 Coupled Reticulocyte Lysate System 40 reactions 332 L5020 TnT® T7/SP6 Coupled Reticulocyte Lysate System 40 reactions 332 L5030 TnT® T7/SP6 Coupled Wheat Germ Extract System 40 reactions 333 L5061 Transcend™ tRNA 30 μl 349 L5070 Transcend™ Colorimetric Translation Detection System 30 reactions 349 L5080 Transcend™ Chemiluminescent Translation Detection System 30 reactions 349 L5511 Amino Acid Mixture Minus Methionine and Cysteine 175 μl 336 L5540 TnT® T7 Quick for PCR DNA 40 reactions 334 L5610 pTnT™ Vector 20 μg 222, 334 L5620 pCMVTnT™ Vector 20 μg 223, 334 L5671 pF3A WG (BYDV) Flexi® Vector 20 μg 222 L5681 pF3K WG (BYDV) Flexi® Vector 20 μg 222 L5701 L-Rhamnose Monohydrate 10 g 330 L5702 L-Rhamnose Monohydrate 50 g 330 L5900 T7 Sample System 1 each 335 L9951 Amino Acid Mixture Minus Leucine 175 μl 336 L9961 Amino Acid Mixture Minus Methionine 175 μl 336 M1051 T4 RNA Ligase 500 u 118 M1060 Subcloning Tools Bundle 1 each 123 M1201 mFcγRIV ADCC Reporter Bioassay, Complete Kit 1 each 234 M1211 mFcγRIV ADCC Reporter Bioassay, Core Kit 1 each 234 M1212 mFcγRIV ADCC Bioassay Effector Cells, Propagation Model 1 each 234 M1215 mFcγRIV ADCC Reporter Bioassay, Core Kit, 5X 1 each 234 M1301 mFcγRIV ADCC Reporter Bioassay, Complete Kit, Taiwan 1 each 234 M1302 mFcγRIV ADCC Reporter Bioassay, Core Kit, Taiwan 1 each 234 M1305 mFcγRIV ADCC Reporter Bioassay, Core Kit, 5X, Taiwan 1 each 234 M1401 mFcγRIV ADCC Reporter Bioassay, Complete Kit, Korea 1 each 234 M1402 mFcγRIV ADCC Reporter Bioassay, Core Kit, Korea 1 each 234 M1405 mFcγRIV ADCC Reporter Bioassay, Core Kit, 5X, Korea 1 each 234 M1701 M-MLV Reverse Transcriptase 10,000 u 170, 193 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 391 Index by Catalog Number Cat# Product Size Page M1705 M-MLV Reverse Transcriptase 50,000 u 170, 193 M1794 T4 DNA Ligase (HC) 500 u 118 M1801 T4 DNA Ligase 100 u 118 M1804 T4 DNA Ligase 500 u 118 M1811 Exonuclease III 5,000 u 120 M1815 Exonuclease III 25,000 u 120 M1821 Alkaline Phosphatase, Calf Intestinal 1,000 u 115 M1833 CIAP Buffer Pack 1.5 ml 115 M1871 Terminal Deoxynucleotidyl Transferase, Recombinant 300 u 121 M1875 Terminal Deoxynucleotidyl Transferase, Recombinant 1,500 u 121 M1893 Terminal Transferase Buffer Pack 3 × 500 μl 121 M2051 DNA Polymerase I 500 u 115 M2055 DNA Polymerase I 2,500 u 115 M2181 Klenow Fragment, Exonuclease Minus 100 u 116 M2201 DNA Polymerase I Large (Klenow) Fragment 150 u 115 M2206 DNA Polymerase I Large (Klenow) Fragment 500 u 115 M2825 Alkaline Phosphatase, Calf Intestinal (HC) 1,000 u 115 M3001 GoTaq® DNA Polymerase 100 u 186 M3005 GoTaq® DNA Polymerase 500 u 186 M3008 GoTaq® DNA Polymerase 2,500 u 186 M3011 Single-Stranded DNA Binding Protein 100 μg 121 M3681 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant 2,500 u 174, 194 M3682 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant 10,000 u 171, 194 M3683 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant 50,000 u 171, 194 M4021 GoTaq® Long PCR Master Mix 100 reactions 185 M4101 T4 Polynucleotide Kinase 100 u 119 M4103 T4 Polynucleotide Kinase 1,000 u 119 M4211 T4 DNA Polymerase 100 u 116 M4215 T4 DNA Polymerase 500 u 116 M4261 RNase ONE™ Ribonuclease 1,000 u 120 M4265 RNase ONE™ Ribonuclease 5,000 u 120 M4281 Ribonuclease H 50 u 120 M4285 Ribonuclease H 250 u 120 M4311 Mung Bean Nuclease 2,000 u 120 M5001 GoTaq® Hot Start Polymerase 100 u 184 M5005 GoTaq® Hot Start Polymerase 500 u 184 M5006 GoTaq® Hot Start Polymerase 2,500 u 184 M5008 GoTaq® Hot Start Polymerase 10,000 u 184 M5101 AMV Reverse Transcriptase 300 u 171, 193 M5108 AMV Reverse Transcriptase 1,000 u 171, 193 M5122 GoTaq® Hot Start Green Master Mix 100 reactions 184 M5123 GoTaq® Hot Start Green Master Mix 1,000 reactions 184 M5132 GoTaq® Hot Start Colorless Master Mix 100 reactions 184 M5133 GoTaq® Hot Start Colorless Master Mix 1,000 reactions 184 M5301 M-MLV Reverse Transcriptase, RNase H Minus 10,000 u 171, 194 M5313 M-MLV Reverse Transcriptase Buffer Pack 2 × 1 ml 170, 193 M5761 S1 Nuclease 10,000 u 121 M6101 RQ1 RNase-Free DNase 1,000 u 121, 165 M7122 GoTaq® Green Master Mix 100 reactions 186 M7123 GoTaq® Green Master Mix 1,000 reactions 186 M7132 GoTaq® Colorless Master Mix 100 reactions 186 M7133 GoTaq® Colorless Master Mix 1,000 reactions 186 M7401 GoTaq® G2 Hot Start Polymerase 100 u 184 M7405 GoTaq® G2 Hot Start Polymerase 500 u 184 M7406 GoTaq® G2 Hot Start Polymerase 2,500 u 184 M7408 GoTaq® G2 Hot Start Polymerase 10,000 u 184 M7422 GoTaq® G2 Hot Start Green Master Mix 100 reactions 184 M7423 GoTaq® G2 Hot Start Green Master Mix 1,000 reactions 184 Cat# Product Size Page M7432 GoTaq® G2 Hot Start Colorless Master Mix 100 reactions 184 M7433 GoTaq® G2 Hot Start Colorless Master Mix 1,000 reactions 184 M7501 PCR Master Mix 10 reactions 187 M7502 PCR Master Mix 100 reactions 187 M7505 PCR Master Mix 1,000 reactions 187 M7660 GoTaq® PCR Core System I 200 reactions 187 M7741 Pfu DNA Polymerase 100 u 187 M7745 Pfu DNA Polymerase 500 u 187 M7801 GoTaq® G2 Flexi DNA Polymerase 100 u 185 M7805 GoTaq® G2 Flexi DNA Polymerase 500 u 185 M7806 GoTaq® G2 Flexi DNA Polymerase 2,500 u 185 M7808 GoTaq® G2 Flexi DNA Polymerase 10,000 u 185 M7822 GoTaq® G2 Green Master Mix 100 reactions 185 M7823 GoTaq® G2 Green Master Mix 1,000 reactions 185 M7832 GoTaq® G2 Colorless Master Mix 100 reactions 185 M7833 GoTaq® G2 Colorless Master Mix 1,000 reactions 185 M7841 GoTaq® G2 DNA Polymerase 100 u 185 M7845 GoTaq® G2 DNA Polymerase 500 u 185 M7848 GoTaq® G2 DNA Polymerase 2,500 u 185 M7911 5X Green GoTaq® Reaction Buffer 20 ml 186 M7921 5X Colorless GoTaq® Reaction Buffer 20 ml 186 M8221 LigaFast™ Rapid DNA Ligation System 30 reactions 118 M8225 LigaFast™ Rapid DNA Ligation System 150 reactions 118 M8291 GoTaq® Flexi DNA Polymerase 100 u 186 M8295 GoTaq® Flexi DNA Polymerase 500 u 186 M8296 GoTaq® Flexi DNA Polymerase 2,500 u 186 M8297 GoTaq® Flexi DNA Polymerase 5,000 u 186 M8298 GoTaq® Flexi DNA Polymerase 10,000 u 186 M8901 5X Colorless GoTaq® Flexi Reaction Buffer 20 ml 186 M8911 5X Green GoTaq® Flexi Reaction Buffer 20 ml 186 M9004 AMV Reverse Transcriptase (HC) 600 u 171, 193 M9910 TSAP Thermosensitive Alkaline Phosphatase 100 units 115 MA1010 ISOQUANT® Isoaspartate Detection Kit 100 assays 245, 352 MB1004 MagaZorb® DNA Mini-Prep Kit 200 preps 141, 201 MB1008 MagaZorb® DNA Mini-Prep Kit 800 preps 141, 201 MC1411 CTAB Buffer 100 ml 2, 3, 143, 203, 304 MC5005 Proteinase K (PK) Solution 4 ml 276 MC5008 Proteinase K (PK) Solution 16 ml 141, 201, 276 MD1360 MagneSil® Blood Genomic, Max Yield System 1 × 96 preps 139 MD1370 MagneSil® ONE, Fixed Yield Blood Genomic System 1 × 96 preps 139 MD1392 Lysis Buffer, Blood 160 ml 139 MD1401 Salt Wash, Blood 90 ml 139 MD1411 Alcohol Wash, Blood 70 ml 139 MD1412 Alcohol Wash, Blood 120 ml 139 MD1421 Elution Buffer, Blood 45 ml 139, 142 MD1431 Anti-Foam Reagent 300 μl 139 MD1441 MagneSil® Paramagnetic Particles 25 ml 139 MD1451 MagneSil® PMPs-Fixed Yield 25 ml 139 MD1460 MagneSil® KF, Genomic System 200 preps 141 MD1471 MagneSil® KF, Paramagnetic Particles 40 ml 141 MD1490 MagneSil® Genomic, Fixed Tissue System 100 samples 140 MD1521 Lysis Buffer, KF 160 ml 141 MD1531 Y Chromosome Deletion Detection System, Version 2.0 25 reactions 318 MD1631 Y Chromosome AZF Analysis System 25 reactions 318 MD1641 MSI Analysis System, Version 1.2 100 reactions 317 N1001 pNL1.1[Nluc] Vector 20 μg 84, 224 N1011 pNL1.2[NlucP] Vector 20 μg 84, 224 N1021 pNL1.3[secNluc] Vector 20 μg 84, 224 N1031 pNL3.1[Nluc/minP] Vector 20 μg 84, 224 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 392 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page N1041 pNL3.2[NlucP/minP] Vector 20 μg 84, 224 N1051 pNL3.3[secNluc/minP] Vector 20 μg 84, 224 N1061 pNL2.1[Nluc/Hygro] Vector 20 μg 84, 224 N1071 pNL2.2[NlucP/Hygro] Vector 20 μg 84, 224 N1081 pNL2.3[secNluc/Hygro] Vector 20 μg 84, 224 N1091 pNL1.1.CMV[Nluc/CMV] Vector 20 μg 84, 86, 224 N1101 pNL1.3.CMV[secNluc/CMV] Vector 20 μg 84, 224 N1110 Nano-Glo® Luciferase Assay 10 ml 75 N1111 pNL3.2.NF-κB-RE[NlucP/NF-κB-RE/Hygro] Vector 20 μg 84, 224 N1120 Nano-Glo® Luciferase Assay 100 ml 75 N1130 Nano-Glo® Luciferase Assay 10 × 10 ml 75 N1150 Nano-Glo® Luciferase Assay 10 × 100 ml 75 N1221 Converted Methylated Human Control 1 μg 174 N1231 Methylated Human Control 5 μg 174 N1301 MethylEdge™ Bisulfite Conversion System 50 reactions 174 N1311 pFN31A Nluc CMV-Hygro Flexi® Vector 20 μg 85, 225 N1321 pFN31K Nluc CMV-neo Flexi® Vector 20 μg 85, 225 N1331 pFC32A Nluc CMV-Hygro Flexi® Vector 20 μg 85, 225 N1341 pFC32K Nluc CMV-neo Flexi® Vector 20 μg 85, 225 N1351 pNLF1-N [CMV/Hygro] Vector 20 μg 85, 225 N1361 pNLF1-C [CMV/Hygro] Vector 20 μg 85, 225 N1371 pNLF1-secN [CMV/Hygro] Vector 20 μg 85, 225 N1381 pNLF1-HIF1A [CMV/neo] Vector 1 each 85, 225 N1391 pNLF1-NRF2 [CMV/neo] Vector 1 each 85, 225 N1411 pNL3.2.CMV Vector 20 μg 84, 224 N1441 pNL1.1.PGK[Nluc/PGK] Vector 20 μg 84, 86, 224 N1461 pNLCoI1[luc2-P2A-NlucP/Hygro] Vector 20 μg 86, 226 N1471 pNLCoI2[luc2-P2A-NlucP/minP/Hygro] Vector 20 μg 86, 226 N1481 pNLCoI3[luc2-P2A-NlucP/CMV/Hygro] Vector 20 μg 86, 226 N1491 pNLCoI4[luc2-P2A-NlucP/PGK/Hygro] Vector 20 μg 86, 226 N1501 pNL1.1.TK[Nluc/TK] Vector 20 μg 84, 86, 224 N1521 Nano-Glo® Dual-Luciferase® Reporter Assay/ pNL1.1.TK Bundle 1 each 76, 86 N1531 Nano-Glo® Dual-Luciferase® Reporter Assay/ pNL1.1.PGK Bundle 1 each 76, 86 N1541 Nano-Glo® Dual-Luciferase® Reporter Assay/ pGL4.54[luc2/TK] Bundle 1 each 76, 86 N1551 Nano-Glo® Dual-Luciferase® Reporter Assay/ pGL4.53[luc2/PGK] Bundle 1 each 76, 86 N1561 NanoDLR/pNL1.1.TK Helix® Bundle 1 each 76, 86 N1571 NanoBRET™ Nano-Glo® Substrate 50 μl 357 N1572 NanoBRET™ Nano-Glo® Substrate 5 × 50 μl 357 N1573 NanoBRET™ Nano-Glo® Substrate 2 × 1.25 ml 357 N1581 NanoBRET™ Positive Control 2 × 20 μg 355, 356 N1610 Nano-Glo® Dual-Luciferase® Reporter Assay System 10 ml 76 N1620 Nano-Glo® Dual-Luciferase® Reporter Assay System 100 ml 76 N1630 Nano-Glo® Dual-Luciferase® Reporter Assay System 10 × 10 ml 76 N1641 NanoBRET™ PPI Control Pair (p53, MDM2) 2 × 20 μg 355, 356 N1650 Nano-Glo® Dual-Luciferase® Reporter Assay System 10 × 100 ml 76 N1661 NanoBRET™ Nano-Glo® Detection System 200 assays 355, 356, 357 N1662 NanoBRET™ Nano-Glo® Detection System 1,000 assays 355, 356, 357 N1663 NanoBRET™ Nano-Glo® Detection System 10,000 assays 355, 356, 357 N1811 NanoBRET™ PPI MCS Starter System 1 each 356 N1821 NanoBRET™ PPI Flexi® Starter System 1 each 356 Cat# Product Size Page N1830 NanoBRET™ BRD4/Histone H3.3 Interaction Assay 1 each 355 N1840 NanoBRET™ BRD9/Histone H3.3 Interaction Assay 1 each 355 N1860 NanoBRET™ BRPF1/Histone H3.3 Interaction Assay 1 each 355 N1870 NanoBRET™ cMyc/MAX Interaction Assay 1 each 355 N1880 NanoBRET™ KRas/BRaf Interaction Assay 1 each 356 N1890 NanoBRET™ BRD4/Histone H4 Interaction Assay 1 each 355 N1900 NanoBRET™ BRD9/Histone H4 Interaction Assay 1 each 355 N1910 NanoBRET™ BRPF1/Histone H4 Interaction Assay 1 each 355 N2011 Nano-Glo® Live Cell Assay System 100 assays 74, 354 N2012 Nano-Glo® Live Cell Assay System 1,000 assays 74, 354 N2013 Nano-Glo® Live Cell Assay System 10,000 assays 74, 354 N2014 NanoBiT® PPI MCS Starter System 1 each 354 N2015 NanoBiT® PPI Flexi® Starter System 1 each 354 N2016 NanoBiT® PPI Control Pair (FKBP, FRB) 1 each 354 N2080 NanoBRET™ Target Engagement HDAC Assay 100 assays 176 N2081 NanoBRET™ Target Engagement HDAC Assay 1,000 assays 176 N2090 NanoBRET™ Target Engagement HDAC Detection Reagents 10,000 assays 176 N2111 RNasin® Ribonuclease Inhibitor 2,500 u 122, 167 N2115 RNasin® Ribonuclease Inhibitor 10,000 u 122, 167 N2120 NanoBRET™ TE HDAC DNA Bundle 1 each 176 N2130 NanoBRET™ Target Engagement BET BRD Assay 100 assays 176 N2131 NanoBRET™ Target Engagement BET BRD Assay 1,000 assays 176 N2140 NanoBRET™ Target Engagement BET BRD Detection Reagents 10,000 assays 176 N2150 NanoBRET™ TE BET BRD DNA Bundle 1 each 176 N2160 Intracellular TE Nano-Glo® Substrate/Inhibitor 1,000 assays 176 N2161 Intracellular TE Nano-Glo® Substrate/Inhibitor 10,000 assays 176 N2170 NanoBRET™ Target Engagement HDAC Complete Kit 1,000 assays 176 N2180 NanoBRET™ Target Engagement BET BRD Complete Kit 1,000 assays 176 N2191 Tracer Dilution Buffer 50 ml 176 N2361 pBiT3.1-N [CMV/HiBiT/Blast] Vector 20µg 341 N2371 pBiT3.1-C [CMV/HiBiT/Blast] Vector 20µg 341 N2381 pBiT3.1-secN [CMV/HiBiT/Blast] Vector 20µg 341 N2391 pFC37K HiBiT CMV-neo Flexi® Vector 20µg 341 N2401 pFN38K HiBiT CMV-neo Flexi® Vector 20µg 341 N2410 Nano-Glo® HiBiT Blotting System 100ml 340 N2411 pFN39K secHiBiT CMV-neo Flexi® Vector 20µg 341 N2420 Nano-Glo® HiBiT Extracellular Detection System 10ml 340 N2421 Nano-Glo® HiBiT Extracellular Detection System 100ml 340 N2422 Nano-Glo® HiBiT Extracellular Detection System 10 × 100ml 340 N2441 BTK-NanoLuc® Fusion Vector 20μg 43 N2451 DDR1-NanoLuc® Fusion Vector 20μg 42 N2500 NanoBRET™ TE Intracellular Kinase Assay, K-5 100 assays 42 N2501 NanoBRET™ TE Intracellular Kinase Assay, K-5 1,000 assays 42 N2511 Recombinant RNasin® Ribonuclease Inhibitor 2,500 u 122, 167 N2515 Recombinant RNasin® Ribonuclease Inhibitor 10,000 u 122, 167 N2520 NanoBRET™ TE Intracellular Kinase Assay, K-4 100 assays 42 N2521 NanoBRET™ TE Intracellular Kinase Assay, K-4 1,000 assays 42 N2530 NanoBRET™ TE Intracellular Kinase Detection Reagents, K-5 10,000 assays 42 N2540 NanoBRET™ TE Intracellular Kinase Detection Reagents, K-4 10,000 assays 42 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 393 Index by Catalog Number Cat# Product Size Page N2570 Nano-Glo® Endurazine™ Live Cell Substrate 0.1ml 75 N2571 Nano-Glo® Endurazine™ Live Cell Substrate 1ml 75 N2572 Nano-Glo® Endurazine™ Live Cell Substrate 10ml 75 N2580 Nano-Glo® Vivazine™ Live Cell Substrate 0.1ml 75 N2581 Nano-Glo® Vivazine™ Live Cell Substrate 1ml 75 N2582 Nano-Glo® Vivazine™ Live Cell Substrate 10ml 75 N2590 Nano-Glo® Extended Live Cell Substrate Trial Pack 0.2ml 75 N2611 RNasin® Plus RNase Inhibitor 2,500 u 122, 167 N2615 RNasin® Plus RNase Inhibitor 10,000 u 122, 167 N3010 HiBiT Control Protein 100µl 74 N3020 Nano-Glo® In-Gel Detection System 10ml 74 N3030 Nano-Glo® HiBiT Lytic Detection System 10ml 340 N3040 Nano-Glo® HiBiT Lytic Detection System 100ml 340 N3050 Nano-Glo® HiBiT Lytic Detection System 10 × 100ml 340 NG1001 ProNex® DNA QC Assay Calibration Kit 1 each 206 NG1002 ProNex® DNA QC Assay ABI 7500/7500FAST 200 reactions 206 NG1003 ProNex® DNA QC Assay ABI 7500/7500FAST 800 reactions 206 NG1004 ProNex® DNA QC Assay BioRad CFX96™ 200 reactions 206 NG1005 ProNex® DNA QC Assay BioRad CFX96™ 800 reactions 206 NG1051 Wash Buffer 340ml 208 NG1201 ProNex® NGS Library Quant Kit 500 reactions 206 NG2001 ProNex® Size-Selective Purification System 10ml 208 NG2002 ProNex® Size-Selective Purification System 125ml 208 NG2003 ProNex® Size-Selective Purification System 500ml 208 NV1001 NanoLuc®-AAK1 Fusion Vector 20μg 43 NV1011 NanoLuc®-ABL1 Fusion Vector 20μg 42 NV1021 ACVR1B-NanoLuc® Fusion Vector 20μg 43 NV1031 AKT2-NanoLuc® Fusion Vector 20μg 43 NV1041 AURKA-NanoLuc® Fusion Vector 20μg 43 NV1051 AURKB-NanoLuc® Fusion Vector 20μg 43 NV1061 AURKC-NanoLuc® Fusion Vector 20μg 43 NV1071 AXL-NanoLuc® Fusion Vector 20μg 43 NV1091 NanoLuc®-BMP2K Fusion Vector 20μg 43 NV1101 BMX-NanoLuc® Fusion Vector 20μg 42 NV1111 NanoLuc®-BRSK2 Fusion Vector 20μg 43 NV1121 CDK5-NanoLuc® Fusion Vector 20μg 43 NV1131 NanoLuc®-CLK1 Fusion Vector 20μg 43 NV1141 CLK2-NanoLuc® Fusion Vector 20μg 43 NV1151 CLK4-NanoLuc® Fusion Vector 20μg 43 NV1161 CSF1R-NanoLuc® Fusion Vector 20μg 42 NV1171 CSK-NanoLuc® Fusion Vector 20μg 42 NV1181 NanoLuc®-CSNK1G2 Fusion Vector 20μg 43 NV1191 CSNK2A2-NanoLuc® Fusion Vector 20μg 43 NV1201 DDR2-NanoLuc® Fusion Vector 20μg 42 NV1211 NanoLuc®-DYRK1B Fusion Vector 20μg 43 NV1221 EPHA1-NanoLuc® Fusion Vector 20μg 42 NV1231 EPHA2-NanoLuc® Fusion Vector 20μg 42 NV1241 EPHA4-NanoLuc® Fusion Vector 20μg 42 NV1251 EPHA5-NanoLuc® Fusion Vector 20μg 42 NV1261 EPHA6-NanoLuc® Fusion Vector 20μg 43 NV1271 EPHA7-NanoLuc® Fusion Vector 20μg 43 NV1281 EPHA8-NanoLuc® Fusion Vector 20μg 42 NV1291 EPHB2-NanoLuc® Fusion Vector 20μg 42 NV1301 EPHB3-NanoLuc® Fusion Vector 20μg 42 NV1311 EPHB4-NanoLuc® Fusion Vector 20μg 42 NV1321 ERN1-NanoLuc® Fusion Vector 20μg 43 NV1331 FER-NanoLuc® Fusion Vector 20μg 43 NV1341 FGFR1-NanoLuc® Fusion Vector 20μg 43 NV1351 FGFR2-NanoLuc® Fusion Vector 20μg 43 NV1361 FGFR3-NanoLuc® Fusion Vector 20μg 43 NV1371 FGFR4-NanoLuc® Fusion Vector 20μg 43 Cat# Product Size Page NV1381 NanoLuc®-FGR Fusion Vector 20μg 42 NV1391 FLT3-NanoLuc® Fusion Vector 20μg 43 NV1401 FRK-NanoLuc® Fusion Vector 20μg 42 NV1411 FYN-NanoLuc® Fusion Vector 20μg 42 NV1421 NanoLuc®-GAK Fusion Vector 20μg 43 NV1431 NanoLuc®-IKBKE Fusion Vector 20μg 43 NV1441 NanoLuc®-IRAK3 Fusion Vector 20μg 43 NV1451 IRAK4-NanoLuc® Fusion Vector 20μg 43 NV1461 NanoLuc®-ITK Fusion Vector 20μg 43 NV1471 JAK3-NanoLuc® Fusion Vector 20μg 43 NV1481 JNK3-NanoLuc® Fusion Vector 20μg 43 NV1491 KIT-NanoLuc® Fusion Vector 20μg 42 NV1501 LATS1-NanoLuc® Fusion Vector 20μg 43 NV1511 LATS2-NanoLuc® Fusion Vector 20μg 43 NV1521 LCK-NanoLuc® Fusion Vector 20μg 42 NV1531 LIMK2-NanoLuc® Fusion Vector 20μg 42 NV1541 LTK-NanoLuc® Fusion Vector 20μg 43 NV1551 LYN-NanoLuc® Fusion Vector 20μg 42 NV1561 NanoLuc®-MAP3K10 Fusion Vector 20μg 43 NV1571 NanoLuc®-MAP3K11 Fusion Vector 20μg 43 NV1581 NanoLuc®-MAP3K12 Fusion Vector 20μg 43 NV1591 MAP3K4-NanoLuc® Fusion Vector 20μg 43 NV1601 NanoLuc®-MAP3K9 Fusion Vector 20μg 43 NV1611 NanoLuc®-MAP4K1 Fusion Vector 20μg 43 NV1621 NanoLuc®-MAP4K2 Fusion Vector 20μg 43 NV1631 NanoLuc®-MAP4K3 Fusion Vector 20μg 43 NV1641 NanoLuc®-MAPK1 Fusion Vector 20μg 43 NV1651 NanoLuc®-MAPK11 Fusion Vector 20μg 42 NV1661 MAPK14-NanoLuc® Fusion Vector 20μg 42 NV1671 NanoLuc®-MAPK3 Fusion Vector 20μg 43 NV1681 NanoLuc®-MAPK4 Fusion Vector 20μg 43 NV1691 NanoLuc®-MAPK6 Fusion Vector 20μg 43 NV1701 NanoLuc®-MAPK8 Fusion Vector 20μg 43 NV1711 NanoLuc®-MAPK9 Fusion Vector 20μg 43 NV1721 NanoLuc®-MARK2 Fusion Vector 20μg 43 NV1731 NanoLuc®-MARK4 Fusion Vector 20μg 43 NV1741 NanoLuc®-MELK Fusion Vector 20μg 43 NV1751 MET-NanoLuc® Fusion Vector 20μg 43 NV1761 MUSK-NanoLuc® Fusion Vector 20μg 43 NV1771 MYLK2-NanoLuc® Fusion Vector 20μg 43 NV1781 NanoLuc®-NEK2 Fusion Vector 20μg 43 NV1791 NanoLuc®-NEK3 Fusion Vector 20μg 43 NV1801 NanoLuc®-NEK9 Fusion Vector 20μg 43 NV1811 NTRK1-NanoLuc® Fusion Vector 20μg 43 NV1821 NTRK2-NanoLuc® Fusion Vector 20μg 43 NV1831 NanoLuc®-NUAK1 Fusion Vector 20μg 43 NV1841 PAK4-NanoLuc® Fusion Vector 20μg 43 NV1851 PAK7-NanoLuc® Fusion Vector 20μg 43 NV1861 NanoLuc®-PHKG1 Fusion Vector 20μg 43 NV1871 PKMYT1-NanoLuc® Fusion Vector 20μg 43 NV1881 NanoLuc®-PLK4 Fusion Vector 20μg 43 NV1891 NanoLuc®-PRKAA2 Fusion Vector 20μg 43 NV1901 PRKACA-NanoLuc® Fusion Vector 20μg 43 NV1911 PRKX-NanoLuc® Fusion Vector 20μg 43 NV1921 NanoLuc®-PTK2 Fusion Vector 20μg 43 NV1931 PTK2B-NanoLuc® Fusion Vector 20μg 43 NV1941 PTK6-NanoLuc® Fusion Vector 20μg 42 NV1951 RET-NanoLuc® Fusion Vector 20μg 43 NV1961 NanoLuc®-RIOK2 Fusion Vector 20μg 43 NV1971 NanoLuc®-RIPK2 Fusion Vector 20μg 42 NV1981 NanoLuc®-RPS6KA1 Fusion Vector 20μg 43 NV1991 NanoLuc®-RPS6KA2 Fusion Vector 20μg 43 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 394 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page NV2001 NanoLuc®-RPS6KA3 Fusion Vector 20μg 43 NV2011 NanoLuc®-RPS6KA4 Fusion Vector 20μg 43 NV2021 NanoLuc®-RPS6KA6 Fusion Vector 20μg 43 NV2031 NanoLuc®-SIK1 Fusion Vector 20μg 42 NV2041 NanoLuc®-SIK3 Fusion Vector 20μg 42 NV2051 NanoLuc®-SLK Fusion Vector 20μg 43 NV2061 NanoLuc®-SNF1LK2 Fusion Vector 20μg 42 NV2071 SRC-NanoLuc® Fusion Vector 20μg 42 NV2081 NanoLuc®-STK11 Fusion Vector 20μg 43 NV2091 NanoLuc®-STK16 Fusion Vector 20μg 43 NV2101 NanoLuc®-STK32B Fusion Vector 20μg 43 NV2111 NanoLuc®-STK33 Fusion Vector 20μg 43 NV2121 STK38-NanoLuc® Fusion Vector 20μg 43 NV2131 NanoLuc®-TBK1 Fusion Vector 20μg 43 NV2141 NanoLuc®-TEC Fusion Vector 20μg 42 NV2151 TEK-NanoLuc® Fusion Vector 20μg 43 NV2161 NanoLuc®-TESK1 Fusion Vector 20μg 42 NV2171 TIE1-NanoLuc® Fusion Vector 20μg 43 NV2181 NanoLuc®-TNK1 Fusion Vector 20μg 43 NV2191 TTK-NanoLuc® Fusion Vector 20μg 43 NV2201 TXK-NanoLuc® Fusion Vector 20μg 42 NV2211 NanoLuc®-ULK1 Fusion Vector 20μg 43 NV2221 NanoLuc®-ULK2 Fusion Vector 20μg 43 NV2231 WEE1-NanoLuc® Fusion Vector 20μg 43 NV2241 YES1-NanoLuc® Fusion Vector 20μg 42 P1041 VivoGlo™ Luciferin, In Vivo Grade 50 mg 67 P1042 VivoGlo™ Luciferin, In Vivo Grade 250 mg 67 P1043 VivoGlo™ Luciferin, In Vivo Grade 1 g 67 P1061 VivoGlo™ Luciferin-β-Galactoside Substrate (6-O-β-galactopyranosyl luciferin) 50 mg 67 P1062 VivoGlo™ Luciferin-β-Galactoside Substrate (6-O-β-galactopyranosyl luciferin) 250 mg 67 P1081 SP6 RNA Polymerase 5,000 u 116 P1085 SP6 RNA Polymerase 1,000 u 116 P1111 EnduRen™ In Vivo Renilla Luciferase Substrate 0.34 mg 67 P1112 EnduRen™ In Vivo Renilla Luciferase Substrate 3.4 mg 67 P1121 Riboprobe® System Buffers 1 system 165 P1132 rATP, 10mM 0.5 ml 5, 121, 165, 195 P1142 rCTP, 10mM 0.5 ml 165, 195 P1152 rGTP, 10mM 0.5 ml 165, 195 P1162 rUTP, 10mM 0.5 ml 165, 195 P1171 DTT, Molecular Grade 100 μl 165, 272 P1181 Transcription Optimized 5X Buffer 200 μl 165 P1193 Nuclease-Free Water 50 ml 165, 275 P1195 Nuclease-Free Water 150 ml 119, 148, 151, 275 P1196 Nuclease-Free Water 150ml 134, 256 P1197 Nuclease-Free Water 500 ml 136, 200, 275 P1199 Nuclease-Free Water 1,000 ml 136, 200, 275 P1221 rATP, rCTP, rGTP, rUTP, each at 10mM in separate tubes 0.5 ml 165, 195 P1231 ViviRen™ In Vivo Renilla Luciferase Substrate 0.37 mg 67 P1232 ViviRen™ In Vivo Renilla Luciferase Substrate 3.7 mg 67 P1241 pSP64 Poly(A) Vector 20 μg 130 P1280 RiboMAX™ Large Scale RNA Production System—SP6 1 system 164 P1300 RiboMAX™ Large Scale RNA Production System—T7 1 system 164 P1320 T7 RiboMAX™ Express Large Scale RNA Production System 1 system 164 Cat# Product Size Page P1420 Riboprobe® System—SP6 1 system 164 P1430 Riboprobe® System—T3 1 system 164 P1440 Riboprobe® System—T7 1 system 164 P1450 Riboprobe® Combination System—T3/T7 RNA Polymerase 1 system 165 P1460 Riboprobe® Combination System—SP6/T7 RNA Polymerase 1 system 165 P1691 HaloTag® Succinimidyl Ester (O2) Ligand 5 mg 66, 346 P1700 T7 RiboMAX™ Express RNAi System 50 × 20µl reactions 168 P1711 Ribo m7 G Cap Analog 10 A254 units 165 P1712 Ribo m7 G Cap Analog 25 A254 units 165 P1781 VivoGlo™ Caspase-3/7 Substrate (Z-DEVDAminoluciferin, Sodium Salt) 50 mg 66 P1782 VivoGlo™ Caspase-3/7 Substrate (Z-DEVDAminoluciferin, Sodium Salt) 5 × 50 mg 66 P2075 T7 RNA Polymerase 1,000 u 117 P2077 T7 RNA Polymerase 5,000 u 117 P2083 T3 RNA Polymerase 1,000 u 117 P2151 pGEM®-3Z Vector 20 μg 127 P2161 pGEM®-4Z Vector 20 μg 128 P2191 pSP72 Vector 20 μg 131 P2221 pSP73 Vector 20 μg 131 P2241 pGEM®-5Zf(+) Vector 20 μg 128 P2251 pGEM®-7Zf(+) Vector 20 μg 129 P2261 pGEM®-3Zf(–) Vector 20 μg 127 P2271 pGEM®-3Zf(+) Vector 20 μg 127 P2301 Bacterial Strain NM522, Glycerol Stock 500 μl 132 P2371 pGEM®-7Zf(–) Vector 20 μg 129 P2391 pGEM®-9Zf(–) Vector 20 μg 129 P2411 pGEM®-11Zf(+) Vector 20 μg 130 P2561 pGEM® Express Positive Control Template 10 μg 165 P4024 T3 RNA Polymerase (HC) 2,500 u 117 P4074 T7 RNA Polymerase (HC) 10,000 u 117 P4084 SP6 RNA Polymerase (HC) 2,500 u 116 PS5000 PowerSeq™ Quant MS System 500 reactions 266 P6711 HaloTag® Amine (O2) Ligand 5 mg 66, 346 P6741 HaloTag® Amine (O4) Ligand 5 mg 66, 346 P6751 HaloTag® Succinimidyl Ester (O4) Ligand 5 mg 66, 346 P6771 HaloTag® Iodoacetamide (O4) Ligand 5 mg 66, 346 P9751 Bacterial Strain JM109, Glycerol Stock 500 μl 132 P9801 Bacterial Strain JM109(DE3), Glycerol Stock 500 μl 132 PQ5002 PowerQuant™ System 200 reactions 258 PQ5008 PowerQuant™ System 800 reactions 258 Q4461 pTargeT™ Sequencing Primer 2 μg 198 Q5011 SP6 Promoter Primer 2 μg 117 Q5401 pUC/M13 Primer, Reverse (17mer) 2 μg 214 Q5601 pUC/M13 Primer, Forward (24mer) 2 μg 214 Q5761 pALTER®-MAX Vector 20 μg 126, 217 Q6131 Bacterial Strain ES1301 mutS, Glycerol Stock (noncompetent) 200 μl 132 Q6321 Bacterial Strain BMH 71-18 mutS, Glycerol Stock (noncompetent) 500 μl 132 R1851 10X Flexi® Enzyme Blend (SgfI & PmeI) 25 μl 123 R1852 10X Flexi® Enzyme Blend (SgfI & PmeI) 100 μl 123 R1901 Carboxy Flexi® Enzyme Blend (SgfI & EcoICRI) 50 μl 123 R3961 Bovine Serum Albumin, Acetylated 1 ml 114, 271 R4014 EcoRI (HC) 25,000 u 107 R4024 BamHI (HC) 12,500 u 105 R4374 RsaI (HC) 5,000 u 112 R6011 EcoRI 5,000 u 107 R6017 EcoRI 15,000 u 107 R6021 BamHI 2,500 u 105 R6025 BamHI 12,500 u 105 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 395 Index by Catalog Number Cat# Product Size Page R6041 HindIII 5,000 u 108 R6045 HindIII 15,000 u 108 R6051 SalI 2,000 u 112 R6055 SalI 10,000 u 112 R6061 SacI 1,000 u 112 R6065 SacI 5,000 u 112 R6071 BglI 1,000 u 106 R6081 BglII 500 u 106 R6085 BglII 2,500 u 106 R6111 PstI 3,000 u 111 R6115 PstI 15,000 u 111 R6121 SmaI 1,000 u 113 R6125 SmaI 5,000 u 113 R6151 TaqI 1,000 u 113 R6155 TaqI 10,000 u 113 R6161 XhoI 3,000 u 114 R6165 XhoI 10,000 u 114 R6171 HaeIII 2,500 u 108 R6175 HaeIII 10,000 u 108 R6181 XbaI 2,000 u 114 R6185 XbaI 10,000 u 114 R6201 HinfI 1,000 u 108 R6205 HinfI 5,000 u 108 R6211 ScaI 1,000 u 112 R6221 SacII 500 u 112 R6231 DpnI 200 u 107 R6241 CfoI 3,000 u 106 R6261 SphI 200 u 113 R6265 SphI 1,000 u 113 R6281 AluI 500 u 105 R6291 DdeI 200 u 107 R6295 DdeI 1,000 u 107 R6311 HpaII 1,000 u 109, 175 R6315 HpaII 5,000 u 109, 175 R6321 PvuI 100 u 111 R6325 PvuI 500 u 111 R6341 KpnI 2,500 u 109 R6345 KpnI 10,000 u 109 R6351 EcoRV 2,000 u 107 R6355 EcoRV 10,000 u 107 R6361 ApaI 5,000 u 105 R6371 RsaI 1,000 u 112 R6381 MluI 1,000 u 110 R6401 MspI 2,000 u 110, 175 R6405 MspI 10,000 u 110, 175 R6431 NotI 200 u 111 R6435 NotI 1,000 u 111 R6441 HhaI 1,000 u 108 R6501 NheI 250 u 111 R6505 NheI 1,250 u 111 R6513 NcoI 200 u 110 R6515 NcoI 1,000 u 110 R6551 ClaI 500 u 106 R6555 ClaI 2,500 u 106 R6591 SpeI 200 u 113 R6595 SpeI 1,000 u 113 R6651 BclI 1,000 u 106 R6711 MboI 200 u 109, 175 R6801 NdeI 500 u 110 R7031 I-PpoI 10,000 u 109 R7103 SgfI 250 u 113 R7251 AgeI 100 u 105 Cat# Product Size Page R9461 Bovine Serum Albumin, Acetylated 400 μl 114, 271 R9921 4-CORE® Buffer Pack (Buffers A, B, C and D), 1ml each 4 ml 114 R9991 MULTI-CORE™ Buffer Pack 3 × 1 ml 114 S1000 AttoPhos® AP Fluorescent Substrate System 3 × 36 mg 350 S1001 AttoPhos® AP Fluorescent Substrate System Trial Size 1 × 36 mg 350 S1011 AttoPhos® Substrate 36 mg 350 S1012 AttoPhos® Substrate 100 mg 350 S1013 AttoPhos® Substrate 1 g 350 S1021 AttoPhos® Buffer 60 ml 350 S1022 AttoPhos® Buffer 240 ml 350 S2001 Coelenterazine 250 μg 82, 271 S2011 Coelenterazine-h 250 μg 82, 271 S3721 Anti-Mouse IgG (H+L), AP Conjugate 100 μl 71 S3731 Anti-Rabbit IgG (Fc), AP Conjugate 100 μl 71 S3771 BCIP/NBT Color Development Substrate 1.25/2.5 ml 270 S3821 Anti-Human IgG (H+L), AP Conjugate 100 μl 71 S3841 Western Blue® Stabilized Substrate for Alkaline Phosphatase 100 ml 280 SA1098 GloMax® Discover or Explorer Instrument Rental, 1 month 1 each 296, 298, 299, 310, 311 SA1104 GloMax® Discover or Explorer Installation Qualification 1 each 296, 298, 299, 310, 311 SA1105 GloMax® Discover or Explorer Operational Qualification 1 each 296, 298, 299, 310, 311 SA1106 GloMax® Discover or Explorer Installation and Operational Qualification 1 each 296, 298, 299, 310, 311 SA1107 GloMax® Explorer Standard Service Agreement 1 each 296, 299, 311 SA1110 Maxwell® CSC Standard Service Agreement 1 each 291, 302 SA1120 Maxwell® CSC Premier Service Agreement 1 each 291, 302 SA1130 Maxwell® CSC Preventive Maintenance 1 each 291, 302 SA1140 Maxwell® CSC Installation Qualification 1 each 291, 302 SA1150 Maxwell® CSC Operational Qualification 1 each 291, 302 SA1160 Maxwell® CSC IQ/OQ Combination Package 1 each 291, 302 SA1301 GloMax® Navigator Standard Service Agreement 1 each 297, 299 SA1304 Dual Injector Pump Station Upgrade for GloMax® Navigator 1 each 297, 299 SA1305 GloMax® Navigator Installation Qualification 1 each 297, 299 SA1306 GloMax® Navigator Operational Qualification 1 each 297, 299 SA1307 GloMax® Navigator Installation and Operational Qualification 1 each 297, 299 SA1308 GloMax® Navigator Preventive Maintenance 1 each 297, 299 SA1330 HSM 2.0 Instrument 1-Year Service Agreement 1 each 136, 200, 294 SA1341 Maxwell® RSC Premier Warranty Upgrade 1 each 293 SA1342 Maxwell® RSC Standard Service Agreement 1 each 293 SA1343 Maxwell® RSC Premier Service Agreement 1 each 293 SA1346 Maxwell® RSC Preventive Maintenance 1 each 293 SA1347 Maxwell® RSC Installation Qualification 1 each 293 SA1348 Maxwell® RSC Operational Qualification 1 each 293 SA1349 Maxwell® RSC IQ/OQ Combination Package 1 each 293 SA1357 Maxwell® RSC 48 Installation Qualification 1 each 289 SA1358 Maxwell® RSC 48 Operational Qualification 1 each 289 SA1359 Maxwell® RSC 48 IQ/OQ Package 1 each 289 SA1397 Maxprep™ Liquid Handler Installation Qualification 1 each 290 SA1398 Maxprep™ Liquid Handler Operational Qualification 1 each 290 SA1399 Maxprep™ Liquid Handler IQ/OQ Package 1 each 290 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 396 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page SA3000 GloMax® 20/20 Base Instrument Service Agreement 1 each 300 SA3040 GloMax® Injectors Service Agreement, 1 year 1 each 300 SA3070 ReliaPrep™ LV 32 HSM Standard Service Agreement 1 each 136, 200, 294 SA4000 GloMax® Discover Standard Service Agreement 1 each 296, 298, 299, 310, 311 SA4030 GloMax® Discover or Explorer Preventive Maintenance 1 each 296, 298, 299, 310, 311 SA4040 Quantus™ Instrument Standard Service Agreement 1 each 162, 297, 308 SP1070 Maxwell® 16 High Strength LEV Magnetic Rod and Plunger Bar Adaptor 1 each 4, 153 SP6019 RSC/CSC Deck Tray 1 each 143, 203, 290, 292, 302, 304 U1100 Prime-a-Gene® Labeling System 30 reactions 119 U1151 Labeling 5X Buffer 300 μl 119 U1191 dUTP 40 μmol 189, 316 U1201 dATP 40 μmol 189, 195, 316 U1202 dATP 200 μmol 189, 195, 316 U1205 dATP 25 μmol 189, 195, 316 U1211 dGTP 40 μmol 189, 195, 316 U1212 dGTP 200 μmol 189, 195, 316 U1215 dGTP 25 μmol 189, 195, 316 U1221 dCTP 40 μmol 189, 195, 316 U1222 dCTP 200 μmol 189, 195, 316 U1225 dCTP 25 μmol 189, 195, 316 U1231 dTTP 40 μmol 189, 195, 316 U1232 dTTP 200 μmol 189, 195, 316 U1235 dTTP 25 μmol 189, 195, 316 U1240 Set of dATP, dCTP, dGTP, dTTP 40µmol each 189, 195, 316 U1245 Set of dATP, dCTP, dGTP, dUTP 40µmol each 189, 316 U1330 Set of dATP, dCTP, dGTP, dTTP 10µmol each 189, 195, 316 U1335 Set of dATP, dCTP, dGTP, dUTP 10µmol each 189, 316 U1410 Set of dATP, dCTP, dGTP, dTTP 200 μmol 189, 195, 316 U1420 Set of dATP, dCTP, dGTP, dTTP 25 μmol each 189, 195, 316 U1431 PCR Nucleotide Mix 200 μl 188, 315 U1432 PCR Nucleotide Mix 1,000 μl 188, 315 U1511 dNTP Mix 200 μl 188 U1515 dNTP Mix 1,000 μl 188 U2010 DNA 5´ End-Labeling System 10 reactions 119 V1061 Chymotrypsin, Sequencing Grade 25 μg 324 V1062 Chymotrypsin, Sequencing Grade 100 μg 324 V1121 MEK Inhibitor U0126 5 mg 49 V1151 Donkey Anti-Goat IgG, AP 60 μl 71 V1171 PMA 5 mg 49 V1201 LY 294002 5 mg 49 V1221 DNA IQ™ Spin Baskets 1,000 /bag 255 V1225 DNA IQ™ Spin Baskets 50/pack 134, 256 Cat# Product Size Page V1231 Microtubes, 1.5ml 1,000 /bag 137, 138, 142, 143, 149, 203, 204, 205, 304, 306, 307 V1320 HisLink™ Spin Protein Purification System 25 reactions 368 V1361 PDE-Glo™ Phosphodiesterase Assay 1,000 assays 41 V1362 PDE-Glo™ Phosphodiesterase Assay 10,000 assays 41 V1391 Slicprep™ 96 Device 10 pack 254 V1401 MAO-Glo™ Assay 200 assays 10 V1402 MAO-Glo™ Assay 1,000 assays 10 V1501 cAMP-Glo™ Assay 300 assays 39 V1502 cAMP-Glo™ Assay 3,000 assays 39 V1503 cAMP-Glo™ Assay 30,000 assays 39 V1591 Manual Differex™ Magnet 1 each 253 V1601 Four-Position Tube Holder 1 each 257 V1621 Asp-N, Sequencing Grade 2 μg 325 V1651 Glu-C, Sequencing Grade 50 μg 325 V1671 rLys-C, Mass Spec Grade 15 μg 324 V1681 cAMP-Glo™ Max Assay 2 plates 40 V1682 cAMP-Glo™ Max Assay 20 plates 40 V1683 cAMP-Glo™ Max Assay 10 × 20 plates 40 V1690 PI3K-Glo™ Class I Profiling Kit 1 each 46 V1701 PIP2:3PS Lipid Kinase Substrate, 0.25mg 0.25 ml 46 V1711 PI:3PS Lipid Kinase Substrate, 0.5mg 0.5 ml 46 V1721 PI3K (p110α/p85α), 20µg 200 μl 46 V1731 PI3K (p110α[E545K]/p85α), 20µg 200 μl 46 V1741 PI3K (p110α[H1047R]/p85α), 20µg 200 μl 46 V1751 PI3K (p110β/p85α), 20µg 200 μl 46 V1761 PI3K (p120γ), 20µg 200 μl 46 V1771 PI3K (p110δ/p85α), 20µg 200 μl 46 V1781 ADP-Glo™ Kinase Assay with PI:3PS 1,000 assays 46 V1782 ADP-Glo™ Kinase Assay with PI:3PS 10,000 assays 46 V1791 ADP-Glo™ Kinase Assay with PIP2:3PS 1,000 assays 46 V1792 ADP-Glo™ Kinase Assay with PIP2:3PS 10,000 assays 46 V1881 Arg-C, Sequencing Grade 10 μg 325 V1891 Elastase 5 mg 325 V1959 Pepsin 250 mg 325 V2011 SoftLink™ Soft Release Avidin Resin 1 ml 370 V2012 SoftLink™ Soft Release Avidin Resin 5 ml 370 V2020 PinPoint™ Xa Protein Purification System 1 system 217, 369 V2071 ProteaseMAX™ Surfactant, Trypsin Enhancer 1 mg 327 V2072 ProteaseMAX™ Surfactant, Trypsin Enhancer 5 × 1 mg 327 V2111 Agarose, Low Melting Point, Analytical Grade 25 g 269 V2460 Serine/Threonine Phosphatase Assay System 96 reactions 52 V2471 Tyrosine Phosphatase Assay System 96 reactions 52 V2791 Guanidine Thiocyanate, Molecular Grade 100 g 273 V2831 Agarose, LMP, Preparative Grade for Large Fragments (>1,000bp) 25 g 268 V2861 SAM2® Biotin Capture Membrane 96 samples 48 V3011 PEG 8000 Powder, Molecular Biology Grade 500 g 275 V3021 Proteinase K 100 mg 137, 255, 276, 328 V3031 Deep Well MagnaBot® 96 Magnetic Separation Device 1 each 284 V3111 Acrylamide, Molecular Grade 100 g 268 V3115 Acrylamide, Molecular Grade 500 g 268 V3121 Agarose, LE, Analytical Grade 100 g 268 V3125 Agarose, LE, Analytical Grade 500 g 268 V3141 Bisacrylamide, Molecular Grade 25 g 270 V3143 Bisacrylamide, Molecular Grade 125 g 270 V3151 DTT, Molecular Grade (Dry Powder) 5 g 255, 272 V3155 DTT, Molecular Grade (Dry Powder) 25 g 272 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 397 Index by Catalog Number Cat# Product Size Page V3171 Urea 1 kg 280 V3175 Urea 5 kg 280 V3181 Sephacryl® S-400 10 ml 196, 277 V3591 Pgp-Glo™ Assay System 10 ml 10 V3601 Pgp-Glo™ Assay System with P-glycoprotein 10 ml 10 V3691 Shaker Integration Plate 1 each 257 V3771 Kinase-Glo® Plus Luminescent Kinase Assay 10 ml 47 V3772 Kinase-Glo® Plus Luminescent Kinase Assay 10 × 10 ml 47 V3773 Kinase-Glo® Plus Luminescent Kinase Assay 100 ml 47 V3774 Kinase-Glo® Plus Luminescent Kinase Assay 10 × 100 ml 47 V3841 Agarose, LMP, Preparative Grade for Small Fragments (10 to 1,000bp) 25 g 269 V3941 X-Gal 100mg/2 ml 280 V3951 IPTG, Dioxane-Free 5 g 274 V3953 IPTG, Dioxane-Free 50 g 274 V3955 IPTG, Dioxane-Free 1 g 274 V4001 Thermolysin 25 mg 325 V4221 5M Sodium Chloride, Molecular Biology Grade 1 L 268 V4231 EDTA, 0.5M (pH 8.0), Molecular Biology Grade 100 ml 138, 205, 272 V4233 EDTA, 0.5M (pH 8.0), Molecular Biology Grade 400 ml 272 V4251 TBE Buffer, 10X, Molecular Biology Grade 1,000 ml 278 V4261 SSC Buffer, 20X, Molecular Grade 1,000 ml 277 V4271 TAE Buffer, 10X, Molecular Biology Grade 1,000 ml 278 V4281 TAE Buffer, 40X, Molecular Biology Grade 1,000 ml 278 V4741 ClickFit Microtube, 1.5ml 1,000 /pack 137, 138, 142, 143, 149, 203, 204, 205, 253, 255, 256, 304, 306, 307 V4745 ClickFit Microtube, 1.5ml 100/pack 134, 256 V4831 PNGase F 500 units 245, 320, 326 V4871 Endo H 10,000 units 320, 326 V4875 Endo H 50,000 units 320, 326 V4961 Fetuin 500 μg 320, 326 V5011 AMP-Glo™ Assay 1,000 assays 51 V5012 AMP-Glo™ Assay 10,000 assays 51 V5071 Trypsin/Lys-C Mix, Mass Spec Grade 20 μg 324 V5072 Trypsin/Lys-C Mix, Mass Spec Grade 100 μg 324 V5073 Trypsin/Lys-C Mix, Mass Spec Grade 100 μg 324 V5111 Sequencing Grade Modified Trypsin 100 μg 323 V5113 Sequencing Grade Modified Trypsin, Frozen 100 μg 323 V5117 Sequencing Grade Modified Trypsin 100 μg 323 V5161 cAMP-Dependent Protein Kinase, Catalytic Subunit 2,500 u 49 V5280 Trypsin Gold, Mass Spectrometry Grade 100 μg 326 V5285 AccuMAP™ Modified Trypsin Solution 120µl 243, 322 V5291 384-Well Plate, Flat 10 /pk 283, 284 V5311 384-Well Plate, Conical 10 /pk 283, 284 V5340 PepTag® Non-Radioactive cAMP-Dependent Protein Kinase Assay 120 reactions 49 V5581 Factor Xa Protease 50 μg 328 V5591 Streptavidin Alkaline Phosphatase 0.5 ml 278, 367 V5601 Kemptide (PKA) Peptide Substrate 1 mg 49 V5671 DNA-Dependent Protein Kinase Peptide Substrate 1 mg 49 V5811 DNA-Dependent Protein Kinase 2,500 u 49 V6041 MagnaBot® Flat Top Magnetic Separation Device 1 each 284 V6071 Kinase-Glo® Max Luminescent Kinase Assay 10 ml 47 V6072 Kinase-Glo® Max Luminescent Kinase Assay 10 × 10 ml 47 V6073 Kinase-Glo® Max Luminescent Kinase Assay 100 ml 47 V6074 Kinase-Glo® Max Luminescent Kinase Assay 10 × 100 ml 47 Cat# Product Size Page V6101 ProTEV Plus 1,000 u 327 V6102 ProTEV Plus 8,000 u 327 V6231 TE Buffer, 1X, Molecular Biology Grade 100 ml 278 V6232 TE Buffer, 1X, Molecular Biology Grade 500 ml 278 V6411 cGMP, 1mM 500 μl 49 V6421 cAMP, 1mM 500 μl 49 V6480 SignaTECT® Protein Tyrosine Kinase (PTK) Assay System 96 reactions 48 V6551 SDS Solution, Molecular Biology Grade (10% w/v) 100 ml 276 V6553 SDS Solution, Molecular Biology Grade (10% w/v) 500 ml 276 V6611 GSH/GSSG-Glo™ Assay 10 ml 30, 58 V6612 GSH/GSSG-Glo™ Assay 50 ml 30, 58 V6711 Kinase-Glo® Luminescent Kinase Assay 10 ml 47 V6712 Kinase-Glo® Luminescent Kinase Assay 10 × 10 ml 47 V6713 Kinase-Glo® Luminescent Kinase Assay 100 ml 47 V6714 Kinase-Glo® Luminescent Kinase Assay 10 × 100 ml 47 V6741 Deep Well Heat Transfer Block 1 each 257 V6751 VARIOMAG® Teleshake (110V, for North America use only) 1 each 257 V6761 V&P Scientific Heating Block (North America use only) 1 each 257 V6771 1.2ml, Round-Bottom Deep Well Plate 50 /case 257 V6781 2.2ml, Square-Well Deep Well Plate 50 /case 257 V6791 Pyramid-Bottom Reservoir, 12 Column 25 /case 257 V6801 Pyramid-Bottom Reservoir 25 /case 257 V6821 1.1ml, Square-Well, V-Bottom Deep Well Plate 25 /case 257 V6831 10ml, 24-Well Deep Well Plate 25 /case 257 V6850 Kinase Selectivity Profiling System: TK-1 8 × 50 reactions 45 V6851 Kinase Selectivity Profiling System: TK-1 + ADP-Glo™ Assay 8 × 50 reactions 45 V6852 Kinase Selectivity Profiling System: TK-2 8 × 50 reactions 45 V6853 Kinase Selectivity Profiling System: TK-2 + ADP-Glo™ Assay 8 × 50 reactions 45 V6854 Kinase Selectivity Profiling System: CMGC-1 8 × 50 reactions 45 V6855 Kinase Selectivity Profiling System: CMGC-1 + ADP-Glo™ Assay 8 × 50 reactions 45 V6856 Kinase Selectivity Profiling System: CMGC-2 8 × 50 reactions 45 V6857 Kinase Selectivity Profiling System: CMGC-2 + ADP-Glo™ Assay 8 × 50 reactions 45 V6858 Kinase Selectivity Profiling System: AGC-1 8 × 50 reactions 45 V6859 Kinase Selectivity Profiling System: AGC-1 + ADP-Glo™ Assay 8 × 50 reactions 45 V6910 Kinase Selectivity Profiling System: AGC-2 8 × 50 reactions 45 V6911 GSH-Glo™ Glutathione Assay 10 ml 31, 58 V6912 GSH-Glo™ Glutathione Assay 50 ml 31, 58 V6913 Kinase Selectivity Profiling System: CAMK-1 + ADP-Glo™ Assay 8 × 50 reactions 45 V6914 Kinase Selectivity Profiling System: TKL-1 8 × 50 reactions 45 V6915 Kinase Selectivity Profiling System: TKL-1 + ADP-Glo™ Assay 8 × 50 reactions 45 V6916 Kinase Selectivity Profiling System: STE-1 8 × 50 reactions 45 V6917 Kinase Selectivity Profiling System: STE-1 + ADP-Glo™ Assay 8 × 50 reactions 45 V6918 Kinase Selectivity Profiling System: Other/CK-1 8 × 50 reactions 45 V6919 Kinase Selectivity Profiling System: Other/CK-1 + ADP-Glo™ Assay 8 × 50 reactions 45 V6920 Kinase Selectivity Profiling System: TK-3 8 × 50 reactions 45 V6921 Kinase Selectivity Profiling System: TK-3 + ADP-Glo™ Assay 8 × 50 reactions 45 Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 398 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page V6922 Kinase Selectivity Profiling System: TK-4 8 × 50 reactions 45 V6923 Kinase Selectivity Profiling System: TK-4 + ADP-Glo™ Assay 8 × 50 reactions 45 V6924 Kinase Selectivity Profiling System: CAMK-2 8 × 50 reactions 45 V6925 Kinase Selectivity Profiling System: CAMK-2 + ADP-Glo™ Assay 8 × 50 reactions 45 V6926 Kinase Selectivity Profiling System: Other-2 8 × 50 reactions 45 V6927 Kinase Selectivity Profiling System: Other-2 + ADP-Glo™ Assay 8 × 50 reactions 45 V6928 Kinase Selectivity Profiling System: General Panel 24 × 50 reactions 45 V6929 Kinase Selectivity Profiling System: General Panel + ADP-Glo™ Assay 24 × 50 reactions 45 V6930 ADP-Glo™ Kinase Assay 400 assays 47 V6931 Kinase Selectivity Profiling System: AGC-2 + ADP-Glo™ Assay 8 × 50 reactions 45 V6932 Kinase Selectivity Profiling System: CAMK-1 8 × 50 reactions 45 V6941 MS Compatible Human Protein Extract, Intact 1 mg 321 V6951 MS Compatible Human Protein Extract, Digest 100 μg 321 V6961 UDP-Glo™ Glycosyltransferase Assay 200 assays 50 V6962 UDP-Glo™ Glycosyltransferase Assay 400 assays 50 V6963 UDP-Glo™ Glycosyltransferase Assay 4,000 assays 50 V6971 UDP-Glo™ Glycosyltransferase Assay + UDP-GlcNAc 200 assays 50 V6972 UDP-Glo™ Glycosyltransferase Assay + UDP-GlcNAc 400 assays 50 V6981 UDP-Glo™ Glycosyltransferase Assay + UDP-GalNAc 200 assays 50 V6982 UDP-Glo™ Glycosyltransferase Assay + UDP-GalNAc 400 assays 50 V6991 UDP-Glo™ Glycosyltransferase Assay + UDP-Glucose 200 assays 50 V6992 UDP-Glo™ Glycosyltransferase Assay + UDP-Glucose 400 assays 50 V7001 ADP-Glo™ Max Assay 1,000 assays 52 V7002 ADP-Glo™ Max Assay 10,000 assays 52 V7051 UDP-Glo™ Glycosyltransferase Assay + UDP-Galactose 200 assays 50 V7052 UDP-Glo™ Glycosyltransferase Assay + UDP-Galactose 400 assays 50 V7061 UDP-Glo™ Glycosyltransferase Assay + UDP-Glucuronic Acid (UDP-GA) 200 assays 50 V7062 UDP-Glo™ Glycosyltransferase Assay + UDP-Glucuronic Acid (UDP-GA) 400 assays 50 V7120 Gel Drying Kit, 17.5 × 20cm capacity 1 kit 283 V7131 Gel Drying Film, 25.0 × 28cm (50 uses) 100 sheets 283 V7341 MS Compatible Yeast Protein Extract, Intact 1 mg 321 V7461 MS Compatible Yeast Protein Extract, Digest 100 μg 321 V7470 SignaTECT® Protein Kinase C (PKC) Assay System 96 reactions 48 V7491 6 × 5 LC-MS/MS Peptide Reference Mix 50 μl 180, 321 V7495 6 × 5 LC-MS/MS Peptide Reference Mix 200 pmol 180, 321 V7511 IdeS Protease 5,000 units 180, 244, 328 V7515 IdeS Protease 25,000 units 180, 244, 328 V7601 MTase-Glo™ Methyltransferase Assay 400 assays 175 V7602 MTase-Glo™ Methyltransferase Assay 2,000 assays 175 V7681 GTPase-Glo™ Assay 1,000 assays 39, 41 V7682 GTPase-Glo™ Assay 10,000 assays 39, 41 V7820 High Capacity Magne® Streptavidin Beads 3 ml 246, 364 V7830 Goat Anti-Human Biotinylated IgG 4 ml 246, 364 V7840 Optical Plate Seals 100 each 253, 266 V7850 Strip Cap, 8-Well 120 each 253, 266 Cat# Product Size Page V7870 SignaTECT® DNA-Dependent Protein Kinase Assay System 96 reactions 48 V7931 Anti-ACTIVE® JNK pAb, Rabbit, (pTPpY) 40 μl 69 V7932 Anti-ACTIVE® JNK pAb, Rabbit, (pTPpY) 120 μl 69 V7983 Antibiotic G-418 Sulfate 5 g 270 V7990 Succinate-Glo™ JmjC Demethylase/ Hydroxylase Assay 1,000 assays 174 V7991 Succinate-Glo™ JmjC Demethylase/ Hydroxylase Assay 10,000 assays 174 V8031 Anti-ACTIVE® MAPK pAb, Rabbit, (pTEpY) 40 μl 69 V8051 Donkey Anti-Goat IgG, HRP 60 μl 71 V8091 Antibiotic G-418 Sulfate Solution 20 ml 270 V8151 MagnaBot® 96 Magnetic Separation Device 1 each 284 V8161 SignaTECT® Calcium/Calmodulin-Dependent Protein Kinase (CaM KII) Assay System 96 reactions 48 V8211 InCELLect™ AKAP St-Ht31 Inhibitor Peptide 150 μl 49 V8221 InCELLect™ St-Ht31P Control Peptide 150 μl 49 V8241 MagnaBot® 384 Magnetic Separation Device 1 each 284 V8251 Plate Clamp 96 1 each 284 V8261 Plate Stand 1 each 284 V8321 P450-Glo™ CYP2B6 Assay 10 ml 8 V8322 P450-Glo™ CYP2B6 Assay 50 ml 8 V8341 IdeZ Protease 5,000 units 180, 244, 328 V8342 IdeZ Protease, Frozen 2,000 units 180, 244, 328 V8345 IdeZ Protease 25,000 units 180, 244, 328 V8351 MagnaBot® II Magnetic Separation Device 1 each 284 V8381 MagnaBot® Spacer 3/16 inch 1 each 284 V8421 P450-Glo™ CYP1A2 Induction/Inhibition Assay 10 ml 8 V8422 P450-Glo™ CYP1A2 Induction/Inhibition Assay 50 ml 8 V8491 Broad Range Protein Molecular Weight Markers 100 lanes 103 V8500 MagneHis™ Protein Purification System 65 reactions 369 V8550 MagneHis™ Protein Purification System 325 reactions 369 V8560 MagneHis™ Ni-Particles 2 ml 369 V8565 MagneHis™ Ni-Particles 10 ml 369 V8571 FastBreak™ Cell Lysis Reagent, 10X 15 ml 368 V8572 FastBreak™ Cell Lysis Reagent, 10X 60 ml 368 V8573 FastBreak™ Cell Lysis Reagent, 10X 100 ml 368 V8581 MagnaBot® Spacer 1/8 inch 1 each 284 V8600 MagneGST™ Protein Purification System 40 reactions 368 V8603 MagneGST™ Protein Purification System 200 reactions 368 V8611 MagneGST™ Glutathione Particles 4 ml 368 V8612 MagneGST™ Glutathione Particles 20 ml 368 V8681 MagnaBot® Spacer 1/16 inch 1 each 284 V8751 P450-Glo™ CYP1A1 Assay 10 ml 8 V8752 P450-Glo™ CYP1A1 Assay 50 ml 8 V8761 P450-Glo™ CYP1B1 Assay 10 ml 8 V8762 P450-Glo™ CYP1B1 Assay 50 ml 8 V8771 P450-Glo™ CYP1A2 Assay 10 ml 8 V8772 P450-Glo™ CYP1A2 Assay 50 ml 8 V8781 P450-Glo™ CYP2C8 Assay 10 ml 8 V8782 P450-Glo™ CYP2C8 Assay 50 ml 8 V8791 P450-Glo™ CYP2C9 Assay 10 ml 8 V8792 P450-Glo™ CYP2C9 Assay 50 ml 8 V8801 P450-Glo™ CYP3A4 Assay 10 ml 8 V8802 P450-Glo™ CYP3A4 Assay 50 ml 8 V8811 P450-Glo™ CYP3A7 Assay 10 ml 8 V8812 P450-Glo™ CYP3A7 Assay 50 ml 8 V8821 HisLink™ Protein Purification Resin 50 ml 368 V8823 HisLink™ Protein Purification Resin 5 ml 368 V8830 MagZ™ Protein Purification System 30 reactions 367 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 399 Index by Catalog Number Cat# Product Size Page V8870 MagneGST™ Pull-Down System 80 reactions 182, 358, 367 V8881 P450-Glo™ CYP2C19 Assay 10 ml 8 V8882 P450-Glo™ CYP2C19 Assay 50 ml 8 V8891 P450-Glo™ CYP2D6 Assay 10 ml 8 V8892 P450-Glo™ CYP2D6 Assay 50 ml 8 V8901 P450-Glo™ CYP3A4 Assay (Luciferin-PFBE) Cell-Based/Biochemical Assay 10 ml 8 V8902 P450-Glo™ CYP3A4 Assay (Luciferin-PFBE) Cell-Based/Biochemical Assay 50 ml 8 V8911 P450-Glo™ CYP3A4 Assay (Luciferin-PPXE) DMSO-Tolerant Assay 10 ml 8 V8912 P450-Glo™ CYP3A4 Assay (Luciferin-PPXE) DMSO-Tolerant Assay 50 ml 8 V8920 Luciferin Detection Reagent 10 ml 10 V8921 Luciferin Detection Reagent 50 ml 10 V8930 Luciferin Detection Reagent with esterase 10 ml 10 V8931 Luciferin Detection Reagent with esterase 50 ml 10 V9001 P450-Glo™ CYP3A4 Assay with Luciferin-IPA 10 ml 8 V9002 P450-Glo™ CYP3A4 Assay with Luciferin-IPA 50 ml 8 V9012 Immobilized Trypsin 2 ml 325 V9013 Immobilized Trypsin 4 ml 325 V9101 ADP-Glo™ Kinase Assay 1,000 assays 47 V9102 ADP-Glo™ Kinase Assay 10,000 assays 47 V9103 ADP-Glo™ Kinase Assay 100,000 assays 47 V9104 ADP-Glo™ Kinase Assay, Bulk Packaged 100,000 assays 47 V9510 NADPH Regeneration System 1,000 assays 8, 9 V9770 P450-Glo™ CYP1A2 Screening System 1,000 assays 9 V9781 P450-Glo™ CYP2B6 Screening System 1,000 assays 9 V9790 P450-Glo™ CYP2C9 Screening System 1,000 assays 9 V9800 P450-Glo™ CYP3A4 Screening System 1,000 assays 9 V9880 P450-Glo™ CYP2C19 Screening System 1,000 assays 9 V9890 P450-Glo™ CYP2D6 Screening System 1,000 assays 9 V9910 P450-Glo™ CYP3A4 Screening System (Luciferin-PPXE) DMSO-Tolerant Assay 1,000 assays 9 V9920 P450-Glo™ CYP3A4 Screening System with Luciferin-IPA 1,000 assays 9 VA1000 AccuMAP™ Denaturing Solution 1ml 243, 322 VA1010 AccuMAP™ 10X Low pH Reaction Buffer 1ml 243, 322 VA1290 MagnaBot® FLEX 96 Magnetic Separation Device 1 each 285 VA1020 AccuMAP™ 100X Oxidation Suppressant 50µl 243, 322 VA1030 AccuMAP™ Low pH Resistant rLys-C Solution 120µl 243, 322 VA1040 AccuMAP™ Low pH Protein Digestion Mini Kit 1 each 243, 322 VA1050 AccuMAP™ Low pH Protein Digestion Maxi Kit 1 each 243, 322 VA1060 Rapid Digestion–Trypsin 100µg 322 VA1061 Rapid Digestion–Trypsin/Lys-C 100µg 322 VA1090 GDP-Glo™ Glycosyltransferase Assay 200 assays 38 VA1091 GDP-Glo™ Glycosyltransferase Assay 400 assays 38 VA1092 GDP-Glo™ Glycosyltransferase Assay 4,000 assays 38 VA1097 Ultra Pure GDP-Fucose, 50mM 50µl 38 VA1098 Ultra Pure GDP-Fucose, 50mM 5 × 50µl 38 VA1099 Ultra Pure GDP-Mannose, 100mM 50µl 38 VA1100 Ultra Pure GDP-Mannose, 100mM 5 × 50µl 38 VA1130 UMP/CMP-Glo™ Glycosyltransferase Assay 200 assays 38 VA1131 UMP/CMP-Glo™ Glycosyltransferase Assay 400 assays 38 VA1132 UMP/CMP-Glo™ Glycosyltransferase Assay 4,000 assays 38 VA1160 rAsp-N, Mass Spec Grade 10µg 242, 322 VA1170 Lys-C, Mass Spec Grade 20µg 242, 322 VA1180 Lys-N, Mass Spec Grade 20µg 242, 322 VB1000 TCEP 15mg 243, 322 VB1010 Iodoacetamide 15mg 243, 322 W1001 ECL Western Blotting Substrate 250 ml 350 Cat# Product Size Page W1015 ECL Western Blotting Substrate 500 ml 350 W3831 Tween® 20 2.5 ml 351 W3841 Blot-Qualified BSA 10 g 351 W4011 Anti-Rabbit IgG (H+L), HRP Conjugate 300 μl 71 W4021 Anti-Mouse IgG (H+L), HRP Conjugate 300 μl 71 W4031 Anti-Human IgG (H+L), HRP Conjugate 300 μl 71 W4121 TMB Stabilized Substrate for Horseradish Peroxidase 200 ml 279 X808X TnT® SP6 High-Yield Master Mix Minus Amino Acids 1 ml 331 Y4041 Canine Pancreatic Microsomal Membranes 50 μl 336 Y5101 MOPS/EDTA Buffer 3 × 10 ml 191 Z1001 ReliaPrep™ FFPE Total RNA Miniprep System 10 reactions 149, 307 Z1002 ReliaPrep™ FFPE Total RNA Miniprep System 100 reactions 149, 307 Z1071 ReliaPrep™ RNA Clean-Up and Concentration System 10 preps 155 Z1072 ReliaPrep™ RNA Clean-Up and Concentration System 50 preps 155 Z1073 ReliaPrep™ RNA Clean-Up and Concentration System 250 preps 155 Z3051 RNA Lysis Buffer (RLA) 50 ml 150, 151 Z3052 Wizard® SV Lysis Buffer 50 ml 138, 205 Z3091 RNA Wash Solution (RWA) 58.8 ml 150, 151 Z3100 SV Total RNA Isolation System 50 preps 150 Z3101 SV Total RNA Isolation System 10 preps 150 Z3105 SV Total RNA Isolation System 250 preps 150 Z3141 Red Blood Cell Lysis Solution (CLB) 200 ml 150 Z3191 Lysis Buffer B, Food 100 ml 2, 142, 202 Z3201 Precipitation Solution, Food 150 ml 2, 142, 202 Z3271 Heat Transfer Block 1 each 284 Z3301 1/4 inch Foam Spacer 1 each 284 Z3351 MagneSil® Total RNA mini-Isolation System 4 plate 151 Z3500 SV 96 Total RNA Isolation System 1 × 96 each 151, 283 Z3505 SV 96 Total RNA Isolation System 5 × 96 each 151, 283 Z3651 Heat Block Insert 1 each 284 Z3740 PureYield™ RNA Midiprep System 10 preps 150 Z3741 PureYield™ RNA Midiprep System 50 preps 150 Z3781 Anti-β-Galactosidase, Purified Monoclonal Antibody 100 μg 69 Z3783 Anti-β-Galactosidase, Purified Monoclonal Antibody 2 mg 69 Z5200 PolyATtract® mRNA Isolation System II with Magnetic Stand 3 isolations 152 Z5210 PolyATtract® mRNA Isolation System I (Refill for Z5200) 3 isolations 152 Z5261 Biotinylated Oligo(dT) Probe (50pmol/μl) 35 μl 152 Z5300 PolyATtract® mRNA Isolation System III with Magnetic Stand 15 isolations 152 Z5310 PolyATtract® mRNA Isolation System IV (Refill for Z5300) 15 isolations 152 Z5331 MagneSphere® Technology Magnetic Separation Stand (two-position) 0.5 ml 284 Z5332 MagneSphere® Technology Magnetic Separation Stand (two-position) 1.5 ml 152, 284 Z5333 MagneSphere® Technology Magnetic Separation Stand (two-position) 12 × 75 mm 152, 284 Z5341 MagneSphere® Technology Magnetic Separation Stand (twelve-position) 0.5 ml 284 Z5342 MagneSphere® Technology Magnetic Separation Stand (twelve-position) 1.5 ml 140, 284 Z5343 MagneSphere® Technology Magnetic Separation Stand (twelve-position) 12 × 75 mm 284 Z5400 PolyATtract® System 1000 without Magnetic Stand Scalable 152 Z5410 PolyATtract® System 1000 Magnetic Separation Stand 1 each 152, 284 Index by Catalog Number Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 400 For complete and up-to-date product information visit: www.promega.com Index by Catalog Number Cat# Product Size Page Z5420 PolyATtract® System 1000 with Magnetic Stand Scalable 152 Z5481 Streptavidin MagneSphere® Paramagnetic Particles 9 ml 152 Z5482 Streptavidin MagneSphere® Paramagnetic Particles 25 ml 152 Z5651 RNAgents® Denaturing Solution 120 ml 151 Z6010 ReliaPrep™ RNA Cell Miniprep System 10 preps 150, 307 Z6011 ReliaPrep™ RNA Cell Miniprep System 50 preps 150, 307 Z6012 ReliaPrep™ RNA Cell Miniprep System 250 preps 150, 307 Z6110 ReliaPrep™ RNA Tissue Miniprep System 10 preps 150, 307 Z6111 ReliaPrep™ RNA Tissue Miniprep System 50 preps 150, 307 Z6112 ReliaPrep™ RNA Tissue Miniprep System 250 preps 150, 307 Z6210 ReliaPrep™ miRNA Cell and Tissue Miniprep System 10 preps 149, 307 Z6211 ReliaPrep™ miRNA Cell and Tissue Miniprep System 50 preps 149, 307 Z6212 ReliaPrep™ miRNA Cell and Tissue Miniprep System 250 preps 149, 307 Z7041 Streptavidin 1 mg 277, 367 Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system 27Index and Legal Reference For complete and up-to-date product information visit: www.promega.com 401 Notes Table of Contents Section Contents Available in the Helix® on-site stocking system Life Science Catalog 2020 402 For complete and up-to-date product information visit: www.promega.com Legal Reference Product Use Limitations, Warranty, Disclaimer Promega manufactures products for a number of intended uses. Please refer to the product label for the intended use statements for specific products. Promega products contain chemicals which may be harmful if misused. Due care should be exercised with all Promega products to prevent direct human contact. Each Promega product is shipped with documentation stating specifications and other technical information. Promega products are warranted to meet or exceed the stated specifications. Promega’s sole obligation and the customer’s sole remedy is limited to replacement of products free of charge in the event products fail to perform as warranted. Promega makes no other warranty of any kind whatsoever, and SPECIFICALLY DISCLAIMS AND EXCLUDES ALL OTHER WARRANTIES OF ANY KIND OR NATURE WHATSOEVER, DIRECTLY OR INDIRECTLY, EXPRESS OR IMPLIED, INCLUDING, WITHOUT LIMITATION, AS TO THE SUITABILITY, PRODUCTIVITY, DURABILITY, FITNESS FOR A PARTICULAR PURPOSE OR USE, MERCHANTABILITY, CONDITION, OR ANY OTHER MATTER WITH RESPECT TO PROMEGA PRODUCTS. In no event shall Promega be liable for claims for any other damages, whether direct, incidental, foreseeable, consequential, or special (including but not limited to loss of use, revenue or profit), whether based upon warranty, contract, tort (including negligence) or strict liability arising in connection with the sale of Promega products or the failure of Promega products to perform in accordance with the stated specifications. Product claims are subject to change. Please contact Promega Technical Services (techserv@promega.com) or access the Promega online catalog (www.promega.com) for the most up-to-date information on Promega products. Please visit the Promega online catalog (www.promega.com) to view patent and licensing information for individual products. Applications mentioned in Promega literature are provided for informational purposes only. Promega does not warrant that all applications have been tested in Promega laboratories using Promega products. Promega products labeled “For Laboratory Use” are intended For Research Use Only outside the United States. Promega has used all commercially reasonable efforts to ensure that this catalog is accurate and free of errors. No claims may be derived from any printing or typing errors. Prices are in local currency as indicated. The prices contained herein exclude all taxes, handling fees and/or transportation costs. Contact Promega for exact information on these costs. Local terms and conditions may apply on sales and services. For the latest product pricing and related information visit: www.promega.com or contact your local Promega representative. Please contact Promega for customized packaging or if you wish to order larger quantities. Copyright © 2019 Promega Corporation. All Rights Reserved. Prices and specifications subject to change without prior notice. Trademarks Trademarks referenced herein are either registered trademarks or trademarks of Promega Corporation in the U.S. and/or other countries. The names of actual companies and products mentioned herein and/or third party trademarks, trade names and logos contained herein may be the trademarks of their respective owners. Any rights not expressly granted herein are reserved. Table of Contents Section Contents Worldwide Contact List Available in the Helix® on-site stocking system Ask A Scientist Our worldwide technical support scientists have extensive lab experience and are available to answer all your questions about Promega products. Contact us via chat, telephone or email: techserv@promega.com Visit us online at: www.promega.com/Support Promega offers best-in-class technical support for scientists. Services Include: • Troubleshooting experiments • Training on Promega technologies • Supporting Promega technologies on automated systems © 2020 Promega Corporation. All Rights Reserved. 2800 Woods Hollow Road Madison, WI 53711-5399 USA Change Service Requested Promega Corporation 2800 Woods Hollow Road Madison, WI 53711-5399 USA Tel: 608-274-4330 Fax: 608-277-2516 Toll-Free Tel: 800-356-9526 Toll-Free Fax: 800-356-1970 Internet: www.promega.com Promega BioSciences, LLC San Luis Obispo, CA, USA Promega BioSystems, Inc. Seoul, South Korea Promega BioSystems Sunnyvale, Inc. Sunnyvale, CA, USA Shanghai Promega Biological Products, Ltd. Shanghai, China Terso Solutions, Inc. Madison, WI, USA Australia, Sydney Tel: 02 8338 3800 Fax: 02 8338 3855 Freecall: 1800 225 123 Freefax: 1800 626 017 E-mail: auscustserv@promega.com Brazil, São Paulo Tel/Fax: +55 11 5096 3770 E-mail: promega.brasil@promega.com China, Beijing Tel: 86 10 5825 6268 Fax: 86 10 5825 6160 Toll-Free: 800 810 8133 E-mail: info@promega.com.cn France, Lyon Tel: 04 37 22 50 00 Fax: 04 37 22 50 10 Numero Vert Client (gratuit): 0 800 48 79 99 E-mail: contactfr@promega.com Numero Vert Technique (gratuit): 0 800 48 80 00 E-mail: supportfr@promega.com Germany/Austria/Poland, Walldorf Tel (D, AT): +49 6227 6906 291 Tel (PL): +48 22 531 06 67 Fax (D, AT): +49 6227 6906 222 Fax (PL): +48 22 531 06 69 E-mail (D, AT):de_custserv@promega.com E-mail (PL): pl_custserv@promega.com India, New Delhi Tel: +91 11 43005814/15 Fax: +91 11 41035028 E-mail: ind_custserv@promega.com Italy, Milan Tel: 02 54 05 01 94 Fax: 02 56 56 16 45 Numero Verde: 800 69 18 18 E-mail: customerservice.italia@promega.com Japan, Tokyo Tel: 03 3669 7981 Fax: 03 3669 7982 E-mail: prometec@jp.promega.com Korea, Seoul Tel: 82 1588 3718 Fax: 82 2 2638 5418 E-mail: custserviceKR@promega.com Belgium/Luxembourg/ The Netherlands, Leiden Tel: +31 (0)71-532 42 44 Fax: +31 (0)71-532 49 07 E-mail: benelux@promega.com Pacific Asia Region, Singapore Tel: +65 65133450 Fax: +65 67735210 E-mail: sg_custserv@promega.com Spain, Madrid Tel: +34 916 621 126 Fax: +34 916 615 835 E-mail: esp_custserv@promega.com Estonia & Nordic Region, Stockholm Tel: +46 8 452 2450 Fax: +46 8 452 2455 E-mail: sweorder@promega.com Switzerland, Dübendorf Customer Service Tel: 044 878 90 00 Fax: 044 878 90 10 E-mail: ch_custserv@promega.com Technical Service Tel: 044 878 90 20 E-mail: ch_techserv@promega.com United Kingdom, Southampton Tel: 023 8076 0225 Fax: 023 8076 7014 Free Phone: 0800 378994 Free Fax: 0800 181037 E-mail: ukcustserve@promega.com ©2019 Promega Corporation Printed in USA PART #CA030